CN106834337A - The DON tolerances and FHB resistances of arabidopsis are improved using wheat cdna - Google Patents
The DON tolerances and FHB resistances of arabidopsis are improved using wheat cdna Download PDFInfo
- Publication number
- CN106834337A CN106834337A CN201510881572.XA CN201510881572A CN106834337A CN 106834337 A CN106834337 A CN 106834337A CN 201510881572 A CN201510881572 A CN 201510881572A CN 106834337 A CN106834337 A CN 106834337A
- Authority
- CN
- China
- Prior art keywords
- tametrs
- gene
- don
- arabidopsis
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention belongs to field of plant genetic, and in particular to improve the DON tolerances and FHB resistances of arabidopsis using wheat cdna.A kind of isolated gene TaMetRS that can improve arabidopsis DON tolerances and scab resistance.Method by screening wheat cells Subtractive hybridization cDNA library and RACE clone gene total lengths, the isolated one gene TaMetRS by DON inductions from wheat breed.Using agrobcterium-mediated transformation, make gene overexpression in arabidopsis, improve transgenic arabidopsis to DON tolerances and the resistance to head blight, research confirms new application of the gene as plant anti gibberellic disease function.The nucleotide sequence of the gene is SEQ ID NO：The corresponding sequence of 1-2186 bit bases in 1, encodes 596 amino acid.The protein sequence of the gene code such as SEQ ID NO：Shown in 2.
Description
Technical field
The invention belongs to wheat transgenic technical field.Particularly relate to DON tolerances and FHB resistances that wheat cdna improves arabidopsis.Institute
The Gene Isolation stated is cloned from TaMetRS genes, and the gene is proved to be a kind of MetRS genes with New function, plant defense reaction and
Played an important role in During Detoxification.TaMetRS genes are induced by DON, are positioned at nucleus, participate in the regulation and control of cellular defensive response.
Overexpressing the gene can improve arabidopsis to the tolerance of DON and the resistance of FHB.Using gene of the invention, it is expected to improve the red mould of plant
Sick resistance, for transgenic wheat breeding for disease resistance provides new safe genetic resources.
Background technology
Wheat is one of most important cereal crops in the world, and wheat scab (Fusarium head blight, FHB) is to be by Fusarium graminearum
The fungal disease that master causes, occurs mainly in world's warm moist and semi-humid region, occurs mainly in In Middle And Lower Reaches of Changjiang River in China, seriously
Yield and quality of wheat is reduced, grain security is threatened.Fusarium graminearum can infect wheat and cause seedling maize ear rot and ear rot in seedling stage and florescence, and produce
Life includes trichothecene, various mycotoxins such as zearalenone and fumonisins.It is most wide as being distributed in trichothecene toxoid
Deoxynivalenol (DON) toxin, has become one of primary pollution source of grain and feed in world wide.DON toxin can suppress true
The biosynthesis of nucleus protein, human or animal can cause strong vomiting and destroy immune system after the edible food containing DON toxin,
Have a strong impact on the health of people and livestock.
The basic traditional function of MetRS genes is the connection for being catalyzed methionine (methionion) and corresponding tRNA, forms Met-tRNAi Met,
Vital effect is played in the biosynthetic process of albumen.But MetRS also has other important effects simultaneously.MetRS may
Played an important role in the biosynthesis of rRNA, MetRS has the activity for suppressing cancer cell in mammal, while MetRS is people
The target of class African typanosomiasis nagana anti-parasite medicine.But it is also relevant with DON resistances and FHB resistances without MetRS genes to up to now
Relevant report.In the early-stage Study of applicant, from Subtractive hybridization library (the suppression subtractive of wheat cells
Hybridization, SSH) in screen an EST fragment of 390bp, strong by DON is induced, later by 3 ' RACE and
5 ' RACE are cloned into the total length of gene, are TaMetRS by the unnamed gene.In view of can the TaMetRS genes in wheat improve plant
FHB resistances there is no report, therefore, TaMetRS genes are separated to from wheat, and identify that it has new function, overexpressed in arabidopsis
After the gene, it is possible to increase the DON tolerances and FHB resistances of arabidopsis, had very important significance for cultivating disease-resistant wheat new varieties.
The content of the invention
The purpose of the present invention is related to application of the TaMetRS gene for wheat in the scab resistance improvement of control plant.The present invention is separated and applied
A kind of DNA fragmentation comprising TaMetRS genes, the fragment assigns the resistance of Arabidopsis thaliana Seedlings DON and the resistance of florescence FHB.It is wherein described
TaMetRS genes nucleotide sequence such as list SEQ ID NO：Shown in 1, sequence length is 2186bp, and the code area of the wherein gene is
SEQ ID NO：The corresponding sequence of 70-1860 bit bases in 1, the protein sequence such as list SEQ ID NO of the gene code：Shown in 2, coding
596 amino acid.
Specifically, technical scheme is as described below：
One kind is subject to applications of the wheat cdna TaMetRS of mycotoxin deoxynivalenol (DON) inductions in the improvement of plant scab resistance,
The nucleotide sequence of the gene such as sequence table SEQ ID NO：The corresponding sequence of 1-2186 bit bases in 1.
One kind is subject to applications of the wheat cdna TaMetRS of mycotoxin deoxynivalenol (DON) inductions in the improvement of plant scab resistance,
The sequence of the protein of the gene code such as sequence table SEQ ID NO：Shown in 2.
The plant of application of the present invention is arabidopsis.
Application of the invention comprises the following steps：
Using the coding region of PCR amplification wheat cdnas TaMetRS, and EcoRI and BamHI restriction enzyme sites are added respectively at two ends, be connected to
In intermediate carrier PTRAkc-VDM1-ERH, plant overexpression carrier PTRAkc-35SS-TaMetRS is obtained, using agriculture bacillus mediated something lost
Method for transformation arabidopsis thaliana transformation is passed, the transgenic arabidopsis of TaMetRS gene overexpressions is obtained, by spray inoculation Fusarium graminearum 5035
Spore liquid, demonstrates the anti gibberellic disease ability of transgenic arabidopsis.Wherein, described plant overexpression carrier PTRAkc-35SS-TaMetRS
Include SEQ ID NO：The corresponding sequences encoding regions of 70-1860 bit bases in 1.
Nutrient media components and proportioning in the present invention is as follows：
Agrobacterium culture medium (YEB)：Nutrient broth 5g+ yeast extract 5g+ peptone 5g+ sucrose 5g, (15g/L agar) pH 7.0；
1/2MS screening and culturing mediums：Organic (200 ×) 5mL+MS molysite (200 ×) 2.5mL of a large amount of (20 ×) 25mL+MS of MS
+ MS micro (200 ×) 2.5mL+100mg/L inositols+20g/L sucrose+50mg/L Kana, (6.3g/L agar) pH 5.8.
Above-mentioned culture medium adds distilled water and is settled to 1L after each component has been added, and is sterilized 18 minutes under 121 DEG C of high steams.In culture medium
The sterilizing of the antibiotic being related to uses filtration sterilization, and the training being cooled to after 60 DEG C of autoclaving is added under the gnotobasis in superclean bench
Used in foster base.
The advantage of the invention is that：
The TaMetRS genes of present invention clone can improve tolerance of the Arabidopsis plant to mycotoxin DON, and significantly improve transgenosis
Resistance of the Arabidopsis plant to head blight pathogen Fusarium graminearum.
Plant overexpression vector pTRAkc-35SS-TaMetRS used in the present invention can in arabidopsis high efficient expression TaMetRS genes, make
The scab resistance for improving plant is possibly realized.
The present invention will be further described with reference to the accompanying drawings and examples.
Brief description of the drawings
Sequence table SEQ ID NO：1 is the nucleotides sequence of the wheat cdna TaMetRS (methionyl-tRNA synthetase gene) of present invention clone
Row, sequence length is 2186bp, and its corresponding amino acid sequence (i.e. code area) is SEQ ID NO：The corresponding sequence of 70-1860 bit bases in 1
Row, encode 596 amino acid.
Sequence table SEQ ID NO：2 is the protein of wheat cdna TaMetRS of the invention (methionyl-tRNA synthetase gene) codings
Sequence.
Sequence table SEQ ID NO：3 is the EST pieces that screening obtains 390bp from the Subtractive hybridization library (SSH) of the suspension cell of wheat
The nucleotide sequence of section.
Fig. 1：It is that the present invention separates the general technical route map for cloning TaMetRS genes and Function Identification.
Fig. 2：The full length sequence clone of TaMetRS genes.Description of reference numerals：A figures in Fig. 2 are 3 ' RACE products；B figures in Fig. 2
It is 5 ' RACE products, the C figures in Fig. 2 are the full-length cDNA of TaMetRS genes.
Fig. 3 .TaMetRS genes are inoculated with DON, Fusarium graminearum in two wheat breeds of Zheng wheat 9023 (Z9) and Sumai 3 (S3)
Expression pattern after 5035 and Tri5- spore liquids.A figures in Fig. 3 are TaMetRS genes after wheat breed Z9 and S3 inoculation DON toxin
Expression pattern；B figures in Fig. 3 are the expression pattern after the wheat breed Z9 Fusarium graminearum bacterial strains 5035 different with S3 inoculations and Tri5-.
Fig. 3 shows that TaMetRS genes of the invention can be by DON and the toxigenic bacterium strain induced expression of Fusarium graminearum 5035, and Tri5 gene delections
Expression of the bacterial strain Tri5- on TaMetRS genes do not influence.
Fig. 4：The structure collection of illustrative plates of intermediate carrier PTRAkc-VDM1-ERH.
Fig. 5：The structure collection of illustrative plates of the plant overexpression carrier PTRAkc-35SS-TaMetRS that the present invention builds.
Fig. 6：The Molecular Identification and expression analysis of transgenic arabidopsis..Description of reference numerals：A figures in Fig. 6 are the PCR of transgenic arabidopsis
Identification, primer is TaMetRS-F2/TaMetRS-R2, and purpose product size is 1800bp；B figures in Fig. 6 are TaMetRS in transgenic arabidopsis
The expression analysis of gene, the primer for extending TaMetRS genes is TaMetRS-F3/TaMetRS-R3, and purpose fragment size is bp；Internal reference base
Because the amplimer of Actin is Actin-F/Actin-R, purpose fragment size is 135bp.
Fig. 7：T2 is processed 2 weeks for transgenic arabidopsis seedling under the conditions of various concentrations DON (0ppm, 5ppm, 10ppm and 15ppm)
Phenotype afterwards.
Fig. 8：After T3 is for the arabidopsis inoculation spore liquid of Fusarium graminearum 5035, the phenotype of 7 days and 10 days
Specific embodiment
Following examples define the present invention, and describe the present invention and include TaMetRS genes complete coding region section and checking separating clone
The method of TaMetRS gene functions.According to following description and these embodiments, those skilled in the art can determine essential characteristic of the invention,
And without departing from the spirit and scope of the invention, various changes and modifications can be made to the present invention so that its be applicable different purposes and
Condition.
Embodiment 1：Separate the full length sequence of clone's TaMetRS genes.
Screening obtains the EST fragments of 390bp from the Subtractive hybridization library (SSH) of the suspension cell of wheat, and strong by DON is lured
(previous work of applicant, do not deliver) is led, the sequence is as follows：
AAAAGATGTCTTGCAACAGCTGAATCTCTGTCCGAATGAGCATATTTCTTTTGCCGATGAAAAGGGG
GAGAGTGACAAGGCGAAAAGGCCTTGGGATCTTATACCATCAAACCACAGGATTGGGAAAATTGTG
CCTTTGTTCACAGAGTTGAAAGATGATGCAGTGGATAGCTTCAGGGAAACATTTGCAGGCAGTCAGG
CCGAAAGAAACGCAAGGGCTAATTAAAGAAGCCAATGAAGTTGTTGCCTAACTGGAAGCTGCAAAA
CATTTCTTGCAAAGTTGATCACAATACTTAATCAAATGACATTGAGATCCAGAAATGTGAGTTCGAA
GGATGAATCACAATGTATATTTTACTGATTATTAGTGATGATGCATTCAGAAAATGT
According to the sequence, applicant devises two sense primers and two anti-sense primers, is respectively:3 ' RACE-F1/3 ' RACE-F2 and
5 ' RACE-R1/5 ' RACE-R2 (being shown in Table 1), operate, PCR reaction systems according to RACE kits (being purchased from Clontech companies) specification
Cumulative volume be 50 μ L, cDNA templates 1uL (about 100ng), 10 × KOD plus buffer enzyme reaction buffer solutions 5uL, 2.5mM dNTP 5
UL, 10uM primer 1.5uL, 1uL KOD enzymes, plus distilled water is to 50 μ L.Response procedures are：94 DEG C of denaturation 5min, 94 DEG C of 30s, 60
DEG C 30s, 72 DEG C of 3min, 35 circulations, 72 DEG C of extension 5min.PCR amplifications such as Fig. 2,3 ' RACE obtain the fragment of 501bp
(the A figures in Fig. 2), 5 ' RACE obtain the fragment (the B figures in Fig. 2) of 1858bp, and the fragment (sequence of 2186bp is obtained after the two splicing
Row are shown in SEQ ID NO：1), design primer TaMetRS-F1/TaMetRS-R1 (table 1) expands TaMetRS total lengths and sequencing obtains 2186bp
Fragment (C figure) in Fig. 2.
Primer used in the gene cloning of table 1
The explanation of table 1：English alphabet F, R after Primer represent forward primer and reverse primer respectively.
Embodiment 2：The expression pattern of TaMetRS genes in detection wheat breed
Applicant's two kinds of wheat breeds of selection, Zheng wheat 9023 (susceptible to FHB, state examines kind, and state examines wheat 2003027, referring to Cheng etc.,
Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody
and a fungal chitinase protects wheat against Fusarium pathogens and mycotoxins.Plant Biotechnology Journal.
2015.doi:10.1111/pbi.12289) and Sumai 3 (it is disease-resistant to FHB, 1970 by the seed selection of the Jiangsu Province institute of agricultural sciences, it is high to head blight anti-,
Referring to Cheng etc., Tissue-specific and pathogen-inducible expression of a fusion protein containing a
Fusarium-specific antibody and a fungal chitinase protects wheat against Fusarium pathogens and mycotoxins.
Plant Biotechnology Journal.2015.doi:10.1111/pbi.12289), as the material of expression pattern analysis.After presprouting of seeds, 4 are placed in
DEG C refrigerator spring flower treatment (vernalization and spring flower treatment are the general knowledge of this area) 2 weeks, transplanting to greenhouse.At wheat poplar bloassom initial stage, growth selection state
Consistent wheat tassel, the awn of wheat of wheat head middle part small ear is cut off with scissors, and 10uL, 5 × 10 are injected with micro syringe5The spore liquid of individual/mL or
The middle part small ear of mark was done in the DON solution of sterilized water or 15uL 1.5mg/mL, every plant of inoculation one, put transparent plastic bag moisturizing 3 days
After take sack off, respectively at 24h, 48h, 72h and 96h sampling are inoculated with the small ear of DON toxin in 4h, 12h to the small ear of inoculating spores liquid,
24h and 48h is sampled.The sample that will be taken freezes in being initially positioned at liquid nitrogen, is subsequently placed in -80 DEG C of Refrigerator stores.(Invitrogen is purchased from using Trizol
Company) reagent extraction total serum IgE (test procedure is operated according to Trizol reagents specification).Using reverse transcriptase SuperScriptTMIII (is purchased from
Invitrogen companies) its reverse transcription is synthesized into cDNA (method according to Invitrogen companies reverse transcriptase reagent specification), reaction condition is：
65 DEG C of 5min, 50 DEG C of 60min, 70 DEG C of 10min.CDNA with above-mentioned reverse transcription synthesis uses primer pair as template
TaMetRS-F3/TaMetRS-R3 (being shown in Table 1) gene carries out special PCR amplifications.Simultaneously with primer Actin-F/Actin-R to wheat Actin
Gene (AB181991) does specific amplified (amplified production 135bp long), and quantitative analysis is carried out as reference gene.Reaction condition is：95
℃5min；95 DEG C of 10sec, 60 DEG C of 5sec, 72 DEG C of 34sec, 45 circulations.Fluoroscopic examination real-time quantitative analysis are carried out in course of reaction (glimmering
Light detection real-time quantitative analysis are method commonly used in the art, referring to document：Li etc., Resistance to Fusarium head blight and seedling
blight in wheat is associated with activation of a cytochrome P450gene.Phytopathology.2010.100:183-191).Knot
Fruit shows (Fig. 3) that TaMetRS genes are subject to the induced strong of DON toxin, distinguish in Z9 and S3 after inoculation 4h 43 times of induced expression and
22 times, induction peak value is reached in 24h, respectively 700 times and 600 times, induced expression starts to reduce in 48h.TaMetRS genes
Also it is subject to the Toxigenic fungi of Fusarium graminearum 5035 (to be separated and a kind of highly pathogenicity standing grain for preserving in Wuhan within 1999 by laboratory where applicant simultaneously
Paddy reaping hook bacteria strain, referring to Xu etc., Disruption of the chitin synthase gene Chs1from Fusarium asiaticum results in an
altered structure of cell walls and reduced virulence.Fungal Genetics and Biology.2010.47:Induction 205-215),
But it is non-toxigenic bacterium Tri5-(a kind of Fusarium graminearum Tri5 deletion mutant bacterial strains with preservation are built by laboratory where applicant, referring to Xu
Deng Disruption of the chitin synthase gene Chs1from Fusarium asiaticum results in an altered structure of cell
walls and reduced virulence.Fungal Genetics and Biology.2010.47:205-215) it is expressed does not influence.In cereal reaping hook
Bacterium 5035 starts to produce after poison (36h) in the wheat head, and TaMetRS genes start induced expression, and the induced expression of the gene is only relevant with DON,
It doesn't matter with wheat breed and its FHB resistances (i.e. genetic background).
Embodiment 3：The structure and arabidopsis thaliana transformation of TaMetRS gene overexpression carriers
The structure of PTRAkc-35SS-TaMetRS plant expression vectors
In order to be able to preferably analyze the function of TaMetRS genes, applicant's overexpression in arabidopsis by TaMetRS genes.Planted from transgenosis
The phenotype of strain studies the function of the gene.Overexpression carrier construction method is as follows：12h is processed with wheat breed Zheng wheat 9023 (Z9) DON
The cDNA that total serum IgE reverse transcription afterwards is obtained is template, with primer TaMetRS-F2/TaMetRS-R2 (see table 1), is amplified comprising TaMetRS
The cDNA fragments of gene complete coding region are (see sequence table SEQ ID NO:Sequence shown in 1), EcoRI is added respectively at the two ends of the cDNA fragments
With BamHI restriction enzyme sites, reaction condition is：94 DEG C of predegeneration 5min；94 DEG C of 30sec, 58 DEG C of 30sec, 72 DEG C of 1min, 35 are followed
Ring；72 DEG C of extension 5min.After PCR primer electrophoresis, the purpose fragment of 1800bp or so is cut, (be purchased from DNA fragmentation QIAquick Gel Extraction Kit
Axgen companies), to 3 times of DE-A buffer solutions (kit is carried) of volume are added in gel, 75 DEG C of water-baths are dissolved 6min, make gel complete
After dissolving, 1.5 times of DE-B buffer solutions (kit is carried) of volume are added, moved into recovery column, 1min, abandoned stream are centrifuged with 12000rpm
The liquid for going out, to addition 500ul washing buffer 1 in recovery column, 12000rpm centrifugation 1min, then to addition 700ul washing in recovery column
Buffer 2,12000rpm are centrifuged 1min again, and repetition washed once with washing buffer 2, add 25ul elution buffer, stand 2min
Afterwards, above-mentioned PCR primer after purification is used EcoRI by 12000rpm centrifugations 2min, the PCR primer for being purified i.e. TaMetRS genes respectively
After BamHI digestions, absolute ethyl alcohol precipitation is reclaimed.Simultaneously also by carrier PTRAkc-VDM1-ERH (see Fig. 4, by Hua Zhong Agriculture University wheat
Class crop molecular biotechnology laboratory transforms) respectively with after EcoRI and BamHI digestions, gel extraction finally uses the good purpose fragment of digestion
T4DNA ligase (Transgene) are connected in carrier framework, and structure obtains overexpression carrier, and bacillus coli DH 5 alpha is converted thereafter, passes through
Screening positive clone, obtains the PTRAkc-35SS-TaMetRS (Fig. 5) of recombinant vector.
The genetic transformation and Screening and Identification of transfer-gen plant
The genetic transformation of TaMetRS genes
Above-mentioned overexpression vector PTRAkc-35SS-TaMetRS is transferred in arabidopsis by agriculture bacillus mediated arabidopsis genetic transforming method, agriculture
The genetic transforming method of the arabidopsis of bacillus mediation be with reference to Zhang Xiuren et al. report method (Zhang Xiuren etc.,
Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method, Nature protocols,
1:641-646,2006).Concrete operation step is as follows：When arabidopsis culture is to terminal inflorescence about 3cm, removes its terminal inflorescence and flower is given birth to stimulated side
Sequence grows.Side life inflorescence it is long to 6~10cm when converted.Soil is suctioned moisture before conversion, and the little Hua for having pollinated and young tender silique are gone
Remove.To there is single bacterium colony, picking single bacterium is dropped down onto in 5ml YEB culture mediums, 28 DEG C, 200r/min shaken cultivations 40 for Agrobacterium tumefaciems line culture
H, by 1：100 ratios are seeded in 50ml YEB culture mediums, 28 DEG C, 200r/min shaken cultivations to OD660Up to 0.8 or so, 6000r/min from
Heart 15min collects thallines, with isometric conversion resuspended bacterial sediment of re-suspension liquid.Arabidopsis plant lotus throne leaf above section is totally immersed into re-suspension liquid,
Keep 15sec.Plant after conversion lies against and is covered with the pallet of wetting filter paper, preservative film is covered to keep humidity, after 1h, according to same side
Method is reprocessed once.Plant is taken out upright after 24h is kept under dark condition, in culture under 22 DEG C, 8h illumination conditions.Plant to be planted is normally bloomed
Seed is harvested after solid, -20 DEG C save backup after drying.The seed of results is put into centrifuge tube, is first 70% ethanol postincubation 1min with concentration, then
2min is processed with 0.15% hypochlorite solution, sterile water wash is for several times；Sowing is on 1/2MS culture mediums (pH 5.7,50mg/ml containing Kan) with sieve
Positive transformant is selected, per about 1000 seeds of ware, after 4 DEG C of 3~4d of vernalization, in culture under 22 DEG C, 8h illumination conditions.The plant of energy normal growth
Transplanted into Nutrition Soil after long to 5,6 leaves of strain.
The Molecular Identification and expression analysis of transgenic positive plant
Extract the fresh blade of transgenosis T0 plant and extract DNA (using plant genome DNA extracts kit, purchased from Tiangeng biochemical technology (north
Capital) Co., Ltd's product), genes of interest primer TaMetRS-F2/TaMetRS-R2 enters performing PCR Positive test, the A figures as a result seen in Fig. 6.
The expression analysis of transgenic positive plant TaMetRS genes
Total serum IgE (the experiment step of transgenic positive plant MetRS-1 and MetRS-2 is extracted using Trizol (being purchased from Invitrogen companies) reagent
It is rapid to be operated according to Trizol reagents specification).Using reverse transcriptase SuperScriptTMIts reverse transcription is synthesized cDNA by III (being purchased from Invitrogen companies)
(method according to Invitrogen companies reverse transcriptase reagent specification), reaction condition is：65 DEG C of 5min, 50 DEG C of 60min, 70 DEG C of 10min.
CDNA with above-mentioned reverse transcription synthesis carries out special PCR with primer pair TaMetRS-F3/TaMetRS-R3 (being shown in Table 1) gene and expands as template
Increase.Specific amplified (amplified production 135bp long) is done to wheat Actin genes (AB181991) with primer Actin-F/Actin-R simultaneously, to make
For reference gene carries out semi-quantitative analysis.Reaction condition is：95℃5min；95 DEG C of 10sec, 60 DEG C of 5sec, 72 DEG C of 34sec, 28 are followed
Ring.The concentration of electrophoresis detection PCR primer.Result shows (B see Fig. 6 schemes), TaMetRS genes great expression in transfer-gen plant.
Embodiment 4：TaMetRS overexpression transgenosis T2/T3For upgrowth situation of the strain under DON stress
The present embodiment chooses the T of the overexpression for turning TaMetRS genes of the invention2Various concentrations have been carried out for strain (numbering is MetRS-1)
DON stress tests.Comprise the following steps that：It (is first 70% with concentration that overexpression transgenic line (MetRS-1) seed is sterilized according to a conventional method
Ethanol postincubation 1min, then 2min is processed with 0.15% hypochlorite solution, sterile water wash is for several times), in the 1/2MS trainings containing 50mg/L kanamycins
Support and germinateed on base, wildtype Arabidopsis thaliana (non-transgenic, abbreviation WT) is sowed on the 1/2MS culture mediums without kanamycins, at 4 DEG C of vernalization
Reason 2 days, is placed in 20 DEG C, and germination is selected after 7 days well for growth and the consistent seed of growing way is transferred to and contains 0ppm, 5ppm, 10ppm and 15ppm tetra-
Plant on the 1/2MS culture mediums of various concentrations DON.After growing 2 weeks, measurement transfer-gen plant and WT lines root is long and fresh weight, experiment repeats 3
It is secondary, each each young plant of strain 20.Result of the test shows (Fig. 7), under conditions of two kinds of concentration DON of 0ppm and 5ppm, wild type and turns base
Because the root of plant is long and fresh weight does not have notable difference, but DON can suppress the growth of arabidopsis.Under 10ppm and 15ppm DON concentration,
The growth of wild type and transfer-gen plant is inhibited, but the root of transfer-gen plant is long and fresh weight is all apparently higher than wild type, and 15
Difference is maximum under ppm DON concentration.Therefore applicant's selection 15ppm DON concentration carries out follow-up DON stress tests.
Different transgenic line (numbering is MetRS-1 and MetRS-2) T2/T3Stress tests of the strain under 15ppm DON concentration.Specific steps
It is as follows：By overexpression transgenic line (MetRS-1 and MetRS-2) T2/T3(concentration is 70% ethanol postincubation 1min, 0.15% for seed disinfection
Hypochlorous acid processes 2min, and sterile water wash is for several times), germinateed on the 1/2MS culture mediums containing 50mg/L kanamycins, wildtype Arabidopsis thaliana (WT)
It is sowed on the 1/2MS culture mediums without kanamycins, 4 DEG C of vernalization 2 days, is placed in 20 DEG C, growth selects that germination is good and the consistent seed of growing way after 7 day
It is transferred on the 1/2MS culture mediums containing 15ppm DON concentration.After growing 2 weeks, measurement transfer-gen plant and WT lines root is long and fresh weight,
Experiment is repeated 3 times, each each young plant of strain 20.Result of the test shows (table 2), different transgenic line (MetRS-1 and MetRS-2) T2/T3
Under 15ppm DON concentration, root is long and fresh weight is high compared with wild type, illustrates that the overexpression of TaMetRS genes can actually be improved and turns base for material
Because of the DON tolerances of plant, concrete outcome is shown in Table 2.
The transgenic line of table 2 (MetRS-1 and MetRS-2) T2/T3Material processes that the root of 2 weeks is long and fresh weight under 15ppm DON concentration
A represents in 0.05 level there is significant difference
B represents in 0.01 level there is significant difference
Embodiment 5：TaMetRS overexpression transgenosis T2For the FHB Analysis of Resistance of strain
The present embodiment have chosen different transgenic lines of the invention (numbering is MetRS-1 and MetRS-2) T2/T3Strain, is inoculated with cereal reaping hook
The spore liquid of bacterium 5035, concentration is 5 × 105After individual/ml, the incidence of plant is analyzed.Comprise the following steps that：By overexpression transgenic line
(MetRS-1 and MetRS-2) T2/T3(concentration is 70% ethanol postincubation 1min, and 0.15% hypochlorous acid treatment 2min, sterilized water is clear for seed disinfection
Wash for several times), germinateed on the 1/2MS culture mediums containing 50mg/L kanamycins, wildtype Arabidopsis thaliana (WT) is seeded in without kanamycins
1/2MS culture mediums on, 4 DEG C of vernalization treatments 2 days are placed in 20 DEG C, and growth is transplanted in small alms bowl after 7 days.The soil of experiment is charcoal soil：
Vermiculite：Perlite=2：1：1 (weight ratio) is mixed.20 DEG C of growths 35 days or so of short photoperiod condition (illumination/16 were dark in 8 hours) are placed in,
Now arabidopsis is bloomed, and comparing is luxuriant, and selection growth conditions carry out the spore spray inoculation of Fusarium graminearum 5035 than more consistent plant, and every plant
Even spraying is once.Specific inoculation method is as follows：The Silwet L-77 of the spore liquid addition 0.001% of concentration are adjusted, selection spray effect is preferably small
Type sprayer, it is uniform to spray to the inflorescence position of arabidopsis, and sprayer is shaken in attention at any time, makes spore liquid even suspension, it is to avoid spore liquid it is heavy
Form sediment；Arabidopsis after spray inoculation covers moisturizing with big resin retainer, and lucifuge moisturizing 2 days allows spore fully to sprout, and relative humidity is 100%,
Water spray moisturizing daily；Illumination cultivation is transferred to after 2 days, continues moisturizing of spraying water；Incidence is investigated respectively within postvaccinal 7th day and the 10th day.
20 plants of inoculation, three repetitions every time.
Arabidopsis investigation is main to be counted to inflorescence (F), old silique (OS) and new silique (NS) incidence, final disease index
(Fusarium-Arabidopsis disease, FAD) is three's sum, i.e. the specific scoring criterions of FAD value=F+NS+OS are shown in Table 3 (Urban
Deng Arabidopsis is susceptible to the cereal ear blight fungal pathogens Fusarium graminearum and Fusarium
Culmorum, The Plant Journal, 32:961-973).
The arabidopsis of table 3 is inoculated with the investigation statisticses method of Fusarium graminearum 5035
Result shows that FAD value of the transfer-gen plant the 7th day and the 10th day is intended to less than wild type (table 4).Wherein, T2For transgenic line
MetRS-1 is 6.59 and 8.41 in the FAD values of the 7th day and the 10th day, reduces 41% and 38% respectively compared with WT, and MetRS-2
The FAD values of the 7th day and the 10th day be 5.10 and 5.91, reduced respectively compared with WT 55% and 57%, T3 for transgenic line FAD
Value is significantly reduced (Fig. 8).Therefore the above results explanation, overexpression TaMetRS genes can improve the FHB resistances of plant in arabidopsis.
Disease index (FAD) investigation after the arabidopsis of table 4 inoculation Fusarium graminearum 5035
B represents in 0.01 level there is significant difference.
Claims (5)
1. a kind of wheat cdna TaMetRS by mycotoxin deoxynivalenol (DON) inductions is in plant scab resistance
Application in improvement, it is characterised in that the nucleotide sequence of the gene is sequence table SEQ ID NO：1-2186 bit bases in 1
Corresponding sequence.
2. a kind of wheat cdna TaMetRS by mycotoxin deoxynivalenol (DON) inductions is in plant scab resistance
Application in improvement, it is characterised in that the protein sequence of the gene code such as sequence table SEQ ID NO：Shown in 2.
3. the application described in claim 1 or 2, wherein described plant is arabidopsis.
4. the application described in any one of claim 1-3, it is characterised in that described application comprises the following steps：
Using the coding region of PCR amplification wheat cdnas TaMetRS, and EcoRI and BamHI digestions are added respectively at two ends
Site, is connected in intermediate carrier PTRAkc-VDM1-ERH, obtains plant overexpression carrier
PTRAkc-35SS-TaMetRS, using agrobcterium-mediated transformation arabidopsis thaliana transformation, obtains TaMetRS genes and surpasses
The transgenic arabidopsis of expression are measured, by being inoculated with the spore liquid of Fusarium graminearum 5035, the anti gibberellic disease of transgenic arabidopsis is verified
Ability；
Wherein
Described plant overexpression carrier PTRAkc-35SS-TaMetRS includes sequence table SEQ ID NO：Shown in 1
The code area of 70-1860 bit bases correspondence sequence.
5. a kind of plant overexpression carrier, it is characterised in that：The carrier contains gene as claimed in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510881572.XA CN106834337B (en) | 2015-12-03 | 2015-12-03 | Method for improving DON tolerance and FHB resistance of arabidopsis thaliana by using wheat gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510881572.XA CN106834337B (en) | 2015-12-03 | 2015-12-03 | Method for improving DON tolerance and FHB resistance of arabidopsis thaliana by using wheat gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106834337A true CN106834337A (en) | 2017-06-13 |
| CN106834337B CN106834337B (en) | 2020-05-29 |
Family
ID=59150184
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510881572.XA Active CN106834337B (en) | 2015-12-03 | 2015-12-03 | Method for improving DON tolerance and FHB resistance of arabidopsis thaliana by using wheat gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834337B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733182A (en) * | 2020-07-10 | 2020-10-02 | 西南大学 | Method for improving resistance of plants to fusarium graminearum by using AtALA1 gene |
| CN112410371A (en) * | 2020-11-10 | 2021-02-26 | 华中农业大学 | Application of wheat gene TaAn in improving DON tolerance and FHB resistance of plants |
-
2015
- 2015-12-03 CN CN201510881572.XA patent/CN106834337B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| DONG-YUN ZUO ET AL.: "A Deoxynivalenol-Activated Methionyl-tRNA Synthetase Gene from Wheat Encodes a Nuclear Localized Protein and Protects Plants Against Fusarium Pathogens and Mycotoxins", 《PHYTOPATHOLOGY》 * |
| LIAO,Y. AND ZUO,D.: "AKQ53362.1", 《GENBANK》 * |
| MONIKA KAMINSKA ET AL.: "A recurrent general RNA binding domain appended to plant methionyl‐tRNA synthetase acts as a cis‐acting cofactor for aminoacylation", 《THE EMBO JOURNAL》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111733182A (en) * | 2020-07-10 | 2020-10-02 | 西南大学 | Method for improving resistance of plants to fusarium graminearum by using AtALA1 gene |
| CN111733182B (en) * | 2020-07-10 | 2022-11-25 | 西南大学 | Method for improving resistance of plants to fusarium graminearum by using AtALA1 gene |
| CN112410371A (en) * | 2020-11-10 | 2021-02-26 | 华中农业大学 | Application of wheat gene TaAn in improving DON tolerance and FHB resistance of plants |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106834337B (en) | 2020-05-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103756975B (en) | A kind of preparation method and application thereof infecting the soybean mosaic virus of tobacco | |
| CN109777810A (en) | PUB41 gene is improving the application in graw mold of tomato and Resistance to bacterial wilt as negative regulatory factor | |
| CN111440743A (en) | Bacillus belezii PEBA20 for disease prevention and growth promotion and soil improvement and application thereof | |
| AU2020100800A4 (en) | Use of aegilops tauschii hmt1 gene | |
| CN105219781A (en) | The method of cultivation of pest-resistant transgenic rice T1c-19 | |
| CN115896045A (en) | Application of birch pear E3 ubiquitin ligase gene PbrATL18 in genetic improvement of plant drought resistance and anthracnose | |
| CN101117639A (en) | Method for acquiring disease-resistance expression of agrobacterium-mediated potato transgenic hrap | |
| CN105039354A (en) | Medicago sativa MsSOS3 gene and encoding protein and application thereof | |
| CN112359049B (en) | Lilium regale chitinase gene LrCHI2 and application thereof | |
| CN111837766B (en) | Method for controlling pathogen of seedling phlobacterium phlogistii by composite microorganism treatment and application | |
| CN106834337A (en) | The DON tolerances and FHB resistances of arabidopsis are improved using wheat cdna | |
| CN112322555A (en) | Paenibacillus polymyxa strain on surface of corn leaf sheath and application thereof | |
| CN115491380B (en) | Plant lipoxygenase gene LOX and application thereof in broad-spectrum disease resistance of plants | |
| CN105200081A (en) | Melon regeneration in vitro method and application of melon regeneration in vitro method in melon genetic transformation | |
| CN109576301A (en) | ZmCOL3 gene and its albumen are improving the application in the anti-stem rot of target plant | |
| CN115418410A (en) | Defense response and identification method for OsPIL1 transgenic rice line induced by dark inoculation of rice blast fungus | |
| Szegedi et al. | Bacterial diseases of grapevine | |
| CN107325973B (en) | Beauveria bassiana strain with strong pathogenicity on corylus avenae sinensis and application thereof | |
| CN111549042B (en) | Application of nucleic acid molecule in plant transgenosis, molecular breeding, disease control and molecular marker | |
| WO2017155384A1 (en) | Methods for obtaining oil palm plants that have tolerance to ganoderma boninense | |
| CN106520791A (en) | Grape disease-resistant related gene VvPUB21, plant expression vector thereof and application of grape disease-resistant related gene VvPUB21 and plant expression vector | |
| CN113403321B (en) | Application of OsAKR4C10 in creating non-transgenic glyphosate-resistant rice germplasm resources | |
| CN114875044B (en) | Wild grape VyVTE gene, protein coded by same and application thereof | |
| CN109852718B (en) | Molecular marker primer of cabbage cadmium transporter coding gene BrHMA3 and application thereof | |
| CN100497631C (en) | Genes of resveratrol stilbene synthase in parthenocissus or its allied genus and their use |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |