CN113754748A

CN113754748A - Polypeptide immune activator for improving insect resistance and disease resistance of rice

Info

Publication number: CN113754748A
Application number: CN202111164692.XA
Authority: CN
Inventors: 李剑峰; 沈文忠
Original assignee: Sun Yat Sen University
Current assignee: Sun Yat Sen University
Priority date: 2021-09-30
Filing date: 2021-09-30
Publication date: 2021-12-07

Abstract

The invention discloses a polypeptide immune activator for improving insect resistance and disease resistance of rice. It contains any one of the following polypeptides as an active ingredient: OsPep 1: ARLRPKPPGNPREGSGGNGGHHH, respectively; OsPep 2: DDSKPTRPGAPAEGSGGNGGAIH, respectively; OsPep 3: ADSAPQRPGSPAEGAGGNGGAVH, respectively; OsPep 7: SKPKPEPPGYPREGGGGNGGVVD are provided. According to the invention, the exogenous spraying of the polypeptide immune activator activates the natural immune defense mechanism of rice, synthesizes insect-resistant and disease-resistant secondary metabolites and improves the tolerance of rice to plant diseases and insect pests. Compared with the traditional pesticide, the pesticide is non-toxic and pollution-free, is easy to degrade and has no residue; compared with the cultivation of disease-resistant and insect-resistant rice varieties, the method is efficient, convenient and fast and is easy to popularize.

Description

Polypeptide immune activator for improving insect resistance and disease resistance of rice

The technical field is as follows:

the invention belongs to the field of prevention and control of rice diseases and insect pests, and particularly relates to a polypeptide immune activator for improving the insect resistance and disease resistance of rice.

Background art:

rice is a main food crop related to the national civilization. Brown planthopper (Brown planthopper, Nilaparvata lugens)

) Is a migratory pest special for sucking rice, and seriously threatens the safe production of rice in China. The rice planthopper is the most serious area in south China, south China and middle and lower reaches of Yangtze river, and the rice planthopper generation area is the first disease and insect pest of rice. The rice blast is a fungal disease caused by infection of a kind of rice blast fungus (Magnaporthe oryzae), is one of the most serious diseases damaging rice production in China, causes serious grain yield reduction during disease attack, and is called as rice cancer. At present, chemical pesticides are still the main means for controlling rice diseases and insect pests. But the method not only pollutes the environment but also threatens the food safety, and simultaneously easily causes the drug resistance of pests. In recent years, more and more researches are focused on developing a novel efficient, non-toxic and pollution-free pest control technology by utilizing the natural immune mechanism of rice.

At present, the conventional strategy for cultivating brown planthopper-resistant rice varieties is to excavate and utilize new brown planthopper resistance genes from the existing rice germplasm resources to cultivate the insect-resistant varieties. At least 30 brown planthopper resistance genes have been discovered and mapped to chromosomes, however only 6 of them were successfully cloned, Bph3/6/9/14/29/32 respectively. The gene Bph3 encodes a lectin receptor kinase OsLecRK1-OsLeckRK3 located on cell membranes, which are probably involved in the recognition of pest-associated pattern molecules (HAMP) and mediate broad-spectrum and durable insect-resistant immunity. Bph9 and Bph14 encode rice R protein, can recognize effector factors released by brown planthopper, and can be combined with transcription factors such as OsWRKY46 and OsWRKY72 to activate insect-resistant immunity. Bph6 is an unknown functional protein positioned in the cytocomplex exocysts, participates in the building and stabilization of cell walls, and reduces the damage of brown planthopper to the cell walls. Bph29 and Bph32 encoded unknown functional proteins containing the B3-DNA binding domain and the SCR domain, respectively. By utilizing a hybridization technology, some brown planthopper resistance genes such as Bph14 and Bph15 are integrated into high-yield and high-quality rice varieties, and insect-resistant varieties such as 'Lopa erythrosepoides 4A' are cultivated. However, the early insect-resistant varieties (with Bph1, Bph2, Bph3 monoclonal antibody genes) bred by international rice institute (IRRI) rapidly lost resistance several years after planting. The rapid adaptation of the brown planthopper to the insect-resistant variety of rice brings great challenges to prevention, control and treatment of the brown planthopper.

Until this year, researchers have identified more than 100 rice blast resistance genes among different rice varieties, and 24 of them are major disease resistance genes. Among them, 10 rice blast resistance genes such as Pi1, Pi2, Pi5, Piz, Pi9, Pi40(t), Pizt, Pi33, Pigm and bsr-d1 are considered to have broad spectrum resistance and can cope with a plurality of physiological races of rice blast bacteria. Long-term practical experience shows that the dominant physiological race of rice blast fungus can change rapidly along with the popularization of water varieties containing only one resistance gene in the same area, so that the disease resistance of the original disease-resistant varieties can be lost rapidly. The aggregation of multiple resistance genes is often required to breed varieties with broad-spectrum, persistent resistance, which greatly increases the difficulty and workload of breeding.

Pests or pathogens induce plant Damage-associated molecular Patterns (DAMPs) during plant infestation, and trigger-triggered Immunity (PTI) in activated or amplified Patterns. Pep small peptides (Plant peptides) are a class of DAMP signal molecules found in 2006 and widely occur in a large number of plants of the families brassicaceae, solanaceae, rosaceous, gramineae, and the like. In Arabidopsis thaliana, the Pep precursor protein, PROPEP, is synthesized intracellularly and then processed by protease, and the C-terminal sequence becomes a mature Pep small peptide. The present applicant discovered that arabidopsis II type metacase (mc) protease is an enzyme that processes a precursor of PROPEP almost simultaneously in 2019 with hand et al at the university of belgium. The Pep small peptides are then transported extracellularly by unknown means and, after recognition by the membrane receptor pepr (plant enzyme peptides receptor), activate the receptor and recruit the co-receptor BAK 1. PEPR belongs to the classical plant-like Receptor kinase (RLK), comprising an extracellular binding domain that recognizes a signal molecule, a transmembrane sequence, and an intracellular kinase domain that activates and regulates signal transduction. Protein phosphorylation plays an important role in RLK-mediated plant signal transduction. Phosphorylation of the receptor complex consisting of PEPR and BAK1 activates downstream receptor-like cytoplasmic kinases(Receptor-like cytoplasmic kinase, RLCK) BIK1 and PBL 1. Both further phosphorylate downstream substrate proteins, activating immune signaling pathways, and generating a series of immune responses: such as extracellular Ca²⁺Internal flow, Reactive Oxygen Species (ROS) outbreak, MAPK and CDPK signal path activation, defense of related secondary metabolites and defense hormone synthesis and the like, and finally, the plant obtains broad-spectrum pest resistance. PTI immunity mediated by the Pep-PEPR signaling pathway has been shown to be involved in the regulation of resistance of a variety of plants such as Arabidopsis, maize, soybean to chewing insects. Exogenous Pep treatment can up-regulate the expression of defense genes PR-1 and PDF1.2, induce the deposition of callose, synthesize insect-resistant metabolite phytoalexin and the like, thereby enhancing the resistance of arabidopsis thaliana to cotton leafworms and corn to beet armyworms and soybean to weak nematodes.

Recently, the treatment of rice OsPep3 has been reported in literature to induce rice suspension cells to generate a series of anti-insect immune responses, such as activation of MAPK signal pathway, synthesis of anti-insect secondary metabolites and the like, and the Pep-PEPR signal pathway is also possibly involved in regulation and control of rice defense against pests. It is worth noting that unlike chewing insects, the piercing-sucking brown planthopper only causes a small wound on the rice stem and leaf, and whether it can induce rice to produce Pep small peptides is not yet determined. As the application of the invention, no document reports whether the rice OsPep3 small peptide can enhance the insect-resistant and disease-resistant capability of rice.

Disclosure of Invention

The first purpose of the invention is to provide a polypeptide immune activator for improving the insect resistance and disease resistance of rice.

The polypeptide immune activator for improving the insect resistance and the disease resistance of the rice contains any one of the following polypeptides as an active ingredient:

OsPep 1: ARLRPKPPGNPREGSGGNGGHHH, the sequence of which is shown in SEQ ID NO. 1;

OsPep 2: DDSKPTRPGAPAEGSGGNGGAIH, the sequence of which is shown in SEQ ID NO. 2;

OsPep 3: ADSAPQRPGSPAEGAGGNGGAVH, the sequence of which is shown in SEQ ID NO. 3;

OsPep 7: SKPKPEPPGYPREGGGGNGGVVD, and the sequence is shown in SEQ ID NO. 4.

The second purpose of the invention is to provide the application of the polypeptide in preparing preparations for improving the insect resistance and/or disease resistance of rice.

Preferably, the insect resistance is against brown planthopper.

Preferably, the disease resistance is resistance to rice blast.

The third purpose of the invention is to provide a method for enhancing the disease and insect resistance of rice, which is to spray the polypeptide on the rice, activate the natural immune defense mechanism of the rice, synthesize insect-resistant and disease-resistant secondary metabolites and improve the tolerance of the rice to diseases and insect pests.

Preferably, the polypeptide is OsPep 3.

Preferably, the polypeptide is sprayed to the rice at the 4-leaf stage or 1 month of the rice.

Preferably, the rice may be rice ZH 11.

Chemical pesticide application is one of the main modes for controlling rice diseases and insect pests, but long-term pesticide abuse causes drug resistance of a plurality of pests and germs, beneficial insects and beneficial flora are easily killed by mistake, and ecological imbalance is caused. Moreover, pesticide residues on crops also harm food safety. However, a large amount of labor and time cost is usually required for cultivating and popularizing the rice variety with insect resistance and disease resistance. According to the invention, the exogenous spraying of the polypeptide immune activator activates the natural immune defense mechanism of rice, synthesizes insect-resistant and disease-resistant secondary metabolites and improves the tolerance of rice to plant diseases and insect pests. Compared with the traditional pesticide, the pesticide is non-toxic and pollution-free, is easy to degrade and has no residue; compared with the cultivation of disease-resistant and insect-resistant rice varieties, the method is efficient, convenient and fast and is easy to popularize.

Drawings

FIG. 1 is the amino acid sequence of an immune small peptide Pep from various species of plants;

FIG. 2 is a 4 OsPep small peptides consisting of 23 amino acids;

FIG. 3 shows that OsPep small peptide induces the outbreak of ROS in rice leaves;

FIG. 4 is a graph of changes in kinase phosphorylation levels in the leaf MAPK cascade pathway;

FIG. 5 is a plot of the mutation sites of ospepr1pepr2#1 and # 2;

FIG. 6 is a ROS burst plot showing that OsPep3 fails to induce ospepr1pepr2 mutant;

FIG. 7 is a graph showing that OsPep3 is unable to induce phosphorylation of MAPK of ospepr1pepr2 mutant;

FIG. 8 is a graph showing the tolerance of rice to brown planthopper 10 days after OsPep3 treatment;

FIG. 9 is a graph showing the number of brown planthoppers per rice plant after 48 hours of feeding of the brown planthoppers;

FIG. 10 is a size chart of leaf lesions.

Detailed Description

The following examples are further illustrative of the present invention and are not intended to be limiting thereof.

Example 1:

1.1 alignment of amino acid homologous sequences for predicting OsPROPEP gene of rice

The present invention first analyzed the amino acid sequences of the immune small peptides Pep of various species of plants using the published database (NCBI: https:// www.ncbi.nlm.nih.gov /) (FIG. 1). Through homology comparison, 7 PROPEP homologous genes are found in the genome of japonica rice (Oryza sativa. ssp. japonica). The C-terminal of the OsPROPEP has higher similarity with other Pep small peptides of the Gramineae, and all the C-terminal of the OsPROPEP has a PGxEGxGGxGG conserved motif. It is presumed that these OsPROPEP processed products may produce OsPep small peptides.

1.2 artificially synthesized OsPep small peptide

Various documents show that exogenously applied synthetic arabidopsis AtPep small peptides and ZmPep small peptides can activate the immune response of plant cells. The invention artificially synthesizes 4 OsPep small peptides consisting of 23 amino acids by using a solid phase polypeptide synthesis method according to the predicted OsPep sequence (figure 2).

OsPep1：ARLRPKPPGNPREGSGGNGGHHH；

OsPep2：DDSKPTRPGAPAEGSGGNGGAIH；

OsPep3：ADSAPQRPGSPAEGAGGNGGAVH；

OsPep7：SKPKPEPPGYPREGGGGNGGVVD。

The artificially synthesized OsPep3 powder was dissolved in pure water to give a 10mM aqueous solution, and stored in a refrigerator at-80 ℃. After being taken out of the refrigerator at the time of use, the aqueous solution is diluted with pure water to a target concentration of, for example, 10. mu.M. In order to overcome the absorption of the waxy layer of the epidermis of tissues such as rice leaves, leaf sheaths, stems and the like to the OsPep small peptide, 0.05 percent of Silwet-L77 (Kyoho, Guangzhou: product number: L77080596) is added into the corresponding OsPep small peptide aqueous solution before treatment. Meanwhile, the control group is 0.05 percent Silwet-L77 aqueous solution (hereinafter referred to as Mock solution) without the OsPep3 small peptide.

1.3 verification of the immunogenic Activity of OsPep Small peptides

The invention detects the immunological activity of the 4 OsPep small peptides. Leaves of 10-day-old wild rice (Zhonghua 11) were soaked in an aqueous solution (concentration 10. mu.M, the same applies below) containing OsPep small peptide for 30 minutes, and the content of Reactive Oxygen Species (ROS) produced in the leaves of rice was analyzed by a chemiluminescence method. The results show that all OsPep small peptides can effectively induce rice leaves to generate ROS outbreaks (figure 3). The results suggest that the 4 OsPep small peptides have immunogen activity and can induce the immune response of rice cells. OsPep3 has the strongest immunogenic activity.

To further verify the immunogenic activity of the OsPep small peptide, 10-day-old leaves of wild-type rice were soaked in an aqueous solution containing the OsPep small peptide for 15 minutes, and then the total protein was extracted by lysing the leaves for Western-blot Western blotting, and the changes in kinase phosphorylation levels in the MAPK cascade pathway of the leaves were detected using α -MAPK antibodies (FIG. 4). The results show that OsPep2, OsPep3 and OsPep7 can effectively activate the MAPK cascade pathway of rice leaves and phosphorylate OsMPAK. This indicates that OsPep2, OsPep3, and OsPep7 have immunogenic activity.

1.4 construction of OsPep small peptide receptor mutant to verify specificity

In order to verify that the OsPep immunogenic activity is mediated by a receptor OsPER, the CRIPSR-Cas9 gene editing technology is utilized, the rice line Zhonghua No. 11 (ZH11) is taken as a background material, and OsPEPR1 (rice database RAP-DBhttps:// rapdb.dna.affrc.go.jp/index.html, gene number: Os08g0446200) and OsPEPR2 (gene number: Os08g0446200) transgenic rice are knocked out. Finally, after PCR amplification of the target fragment and first-generation sequencing detection, Ospepr1 and Ospepr2 of transgenic rice strains OsPEPR1pepr2#1 and #2 are successfully knocked out. Wherein, the insertion of A at the upstream target position of the CDS of the OsPEPR1 gene in the genome of OsPEPR1pepr2#1 leads to the advanced appearance of a stop codon, and the downstream target position of the CDS of the OsPEPR2 gene has a long fragment deletion of 1093 bp. OsPEPR1 and OsPEPR2 genes of OsPEPR1pepr2#2 have gene mutation similar to OsPEPR1pepr2#1, and are different from OsPEPR1pepr2#1 only in the position of the target point downstream of the CDS of OsPEPR1 (fig. 5).

Soaking and treating the leaves of the large ospepr1pepr2 mutant and wild rice (middle flower 11) for 10 days by using OsPep3 with the highest immunogenic activity for 30 minutes, detecting the change of the ROS content in the leaves, and finding that the OsPep3 cannot induce the ROS outbreak of the ospepr1pepr2 mutant (figure 6); phosphorylation of MAPK was also not induced in ospepr1pepr2 mutant (fig. 7). This indicates that the immune function of the OsPep3 small peptide depends on the immune signal path mediated by the receptor OsPEPR.

The results of all the experiments show that the externally applied artificially synthesized OsPep3 small peptide can activate the insect-resistant and disease-resistant immune signal pathway of rice.

2.1 spraying OsPep3 small peptide can enhance the resistance of rice to brown planthopper

The activation capability of the OsPep3 small peptide on rice immunity suggests that the OsPep3 small peptide is a potential biological pesticide and can rapidly improve the disease resistance and insect resistance of rice in an external application mode. For this purpose, the ZH11 and ospepr1pepr2 rice in the 4-leaf stage are treated with an aqueous solution (concentration is 10 μ M) of OsPep3 small peptides by a spraying method (small peptide aqueous solution is filled in a small spray can and is uniformly sprayed on the whole plant at a position 5cm away from the rice plant until the surface of the plant drips), then brown planthoppers are inoculated on each plant by means of 15-head 3-year-old nymphs, and the tolerance of the rice to the brown planthoppers is observed after the continuous treatment of the OsPep3 for 10 days. The experimental results show that ZH11 brown planthopper tolerance after OsPep3 treatment is significantly higher than that of the control untreated group (brown planthopper after Mock treatment), while OsPep3 treatment cannot enhance the tolerance of OsPep 1pepr2 to brown planthopper (fig. 8). This indicates that the treatment of the OsPep3 small peptide can enhance the tolerance of rice to brown planthopper.

In addition to tolerance, rice is also capable of repelling pests by secreting volatile secondary metabolites, thereby increasing their resistance to the pests. For this purpose, ZH11 and ospepr1pepr2 rice were planted in the same square pot (length: width: height: 15 cm: 25 cm) at a density of two seedlings per pot. When the rice grows to be 1 month old, carrying out OsPep3 treatment on the rice by adopting a spraying mode (the same as the above). After 24 hours of treatment, brown planthoppers were inoculated at a density of 60 nymphs at 3 years per pot. And counting the number of brown planthoppers on each rice plant after the brown planthoppers eat the rice plants for 48 hours. The experimental results showed that OsPep3 treatment was effective in increasing the rice insect repellency and decreasing the number of brown planthoppers resting thereon, compared to the control untreated group (using Mock treatment followed by brown planthopper) (fig. 9).

In conclusion, the OsPep3 treatment can improve the tolerance and the insect repellency of the rice to the brown planthopper, thereby enhancing the resistance to the brown planthopper.

2.2OsPep3 small peptide can enhance rice resistance to Magnaporthe grisea

In order to verify whether the OsPep3 small peptide can improve the resistance of rice to rice blast, OsPep3 treatment is carried out on 1-month-old ZH11 and ospepr1pepr2 rice by adopting a spraying method (the same as 2.1), and rice leaves with the length of 8 centimeters are cut after 24 hours. Then, the cut rice leaves were gently punctured into the epidermis with a pipette tip to make a wound, and 5. mu.L of a suspension of Magnaporthe grisea spores (2X 10) was subsequently dropped onto the wound⁵spores/mL). Then, the leaves on which the rice blast fungus spores were dropped were floated in a 0.1% 6-BA aqueous solution (10. mu.M OsPep3 was added or water was added as a control), and the lesion size of the leaves was counted after culturing at 28 ℃ for 12 hours in light/12 hours in dark for 7 days. The experimental results showed that the lesion size of ZH11 rice leaves after OsPep3 treatment was significantly smaller than the control group, while OsPep3 treatment failed to alter the susceptibility of ospepr1pepr2 rice to Magnaporthe grisea as expected (FIG. 10).

Meanwhile, in order to further quantify the disease degree, diseased scab tissues are uniformly punched, DNA is extracted, and the biomass of the rice blast fungi in the scab tissues is detected by utilizing a fluorescent quantitative PCR technology. The quantification of the biomass of the rice blast fungi takes the DNA quantity ratio of the rice blast fungi housekeeping gene MoPot2 gene and the rice housekeeping gene OsUG gene as reference. The experimental results show that the biomass of the rice blast bacteria in the ZH11 rice lesion tissues after the OsPep3 treatment is obviously less than that in the control group.

The above results indicate that the resistance of rice to rice blast bacteria can be effectively enhanced by the treatment with OsPep 3.

Appendix: part of the experimental methods used:

1) solid phase chemical method for synthesizing OsPep small peptide

The synthesis of the OsPep small peptide is entrusted by Wuhanxing Hao Biotechnology Limited. The synthesis process includes the first linking the hydroxyl group of the hydroxyl terminal amino acid of the peptide chain to be synthesized with insoluble polymer resin in covalent bond structure, and the subsequent reaction of the amino acid combined onto the solid phase carrier as amino component to eliminate amino protecting group and with excessive amount of activated carboxyl component to grow peptide chain. Repeating (condensation → washing → deprotection → neutralization and washing → next round of condensation) operation to reach the length of the peptide chain to be synthesized, finally cracking the peptide chain from the resin, and carrying out purification and other treatments to obtain the polypeptide, wherein the alpha-amino is protected by FMOC (9-fluorenylmethyloxycarbonyl).

2) Reactive oxygen species ROS burst detection

Punching 7-day-old young leaves of rice to 0.25cm²After overnight incubation in the aqueous solution of the leaflet, the aqueous solution was replaced with the reaction solution, and the reaction was carried out in real time by using a chemiluminescence detector Varioskan Lux (Thermo) within 30 minutes by adding OsPep3 treatment (10. mu.M OsPep3 aqueous solution + 0.05% silwet-L77) or control treatment (deionized water + 0.05% silwet-L77) as required for the experiment. The formula of the reaction solution is as follows: 200 μ M Luminol,0.01 μ g/. mu.L horserach peroxidase.

3) Phosphorylation detection of rice MAPK protein

After cutting 7-day-old rice leaves into small fragments with uniform length, grinding the small fragments into powder by using liquid nitrogen, adding 2x SDS-PAGE protein loading buffer (Beijing Biyun, Cat. P0015B), and heating and boiling at 100 ℃ for 5 minutes. After the boiled protein was electrophoresed by 10% SDS-PAGE (Samorfei, NP0326BOX), it was electrophoresed into PDVF membrane (Merck, IEVH85R), blocked with 5% skim milk for 1h, then transferred into milk-TBST buffer (Solebao, T1081) containing α -MAPK antibody (Sigma, cat # MA5-15174) for overnight incubation, washed with TBST buffer, added with milk-TBST buffer containing secondary antibody for hybridization at room temperature for 2 hours, and washed clean with TBST buffer. A chemiluminescent substrate, SuperSignal West Femto kit (Thermo Scientific), was added to the PDVF membrane and the signal was detected using a chemiluminescent detector.

4) Construction of pYL-CRISPR/Cas9-OsPEPR1/2 vector

pYL-construction of CRISPR/Cas9-OsPEPR1/2 vector refer to the relevant literature (Ma X. and Liu Y. CRISPR/Cas9-based multiplex genome editing in monocot and dicot plants. curr. Protoc. mol. biol.2016.115:31.6.1-31.6.21), a targeted OsPEPR1/2sgRNA expression cassette driven by OsU6a, OsU6b, OsU6c and OsU3m promoters was first obtained by performing 2-round PCR using the following primers according to the literature description, and finally the sgRNA expression cassette was ligated into a pYL binary vector containing CRISPR/Cas9 related elements using BsaI restriction endonuclease and T4 Ligase.

OsU6aT1F:gccgTAGCCCTTCTTTCTCTGTCT

OsU6aT1R:aaacAGACAGAGAAAGAAGGGCTA

OsU6bT2F:gttgTGCGCTATACCATAGCTCT

OsU6bT2R:aaacAGAGCTATGGTATAGCGCA

OsU6cT3F:tcagCTCAAACTACAACACAATG

OsU6cT3R:aaacCATTGTGTTGTAGTTTGAG

OsU3T4F:ggcaTCCGCTACAGCATAGCTCT

OsU3T4R:aaacAGAGCTATGCTGTAGCGGA

Wherein T1, T2, T3 and T4 target sgRNA of OsPEPR1 and an OsPEPR target region respectively. Other primers are referred to the corresponding literature.

5) Creation of OsPEPR1/2 mutant Rice

The surface of the wild rice Zhonghua No. 11 (ZH11) seed is disinfected and inoculated to N6 culture medium for callus induction, dark culture is carried out for one month at 28 ℃, bright yellow embryogenic callus is selected and transferred to N6 culture medium for subculture under the same conditions. After 2 weeks of subculture, the calli were soaked in an infection medium containing pYL-CRISPR/Cas9-OsPEPR1/2 plasmid Agrobacterium for transformation, after draining, transferred to a co-culture medium, and dark culture was continued for 2 days at 28 ℃. And (3) cleaning the surface of the transformed callus with sterile water, transferring the callus to a screening culture medium containing screening resistance, carrying out dark culture at 28 ℃, carrying out subculture for 1 time every 2 weeks until new compact bright yellow callus grows out again, inoculating the new callus to a differentiation culture medium, carrying out culture for 7 days at 28 ℃, transferring to the differentiation culture medium, carrying out illumination culture at 25 ℃ until seedlings grow out, transferring to a rooting culture medium containing hygromycin, carrying out illumination culture at 25 ℃ until the seedlings are strong enough, and then transplanting to the outdoor to obtain T1 transgenic rice, wherein the screening method of the transgenic rice positive seedlings is shown in 2 in the appendix.

Stock number of N6 medium: c0203.0001 (ametiy science);

infection culture medium: N6D2(N6 plus 2 mg/L2, 4-D) liquid medium + acetosyringone AS (100. mu.M);

co-culture medium: N6D2+ AS (100 μ M) solid medium + 1.5% agar;

screening a culture medium: N6D2+ Timentin (50mg/L) + hygromycin Hyg (50mg/L) solid medium + 1.5% agar;

differentiation medium: N6D2+6-BA (2mg/L) + NAA (0.2mg/L) + Timentin (50mg/L) + hygromycin Hyg (50mg/L) + 1.5% agar;

rooting culture medium: N6D2+ NAA (0.2mg/L) + Timentin (50mg/L) + hygromycin Hyg (50mg/L) + 1.5% agar.

6) Detection of OsPEPR1/2 mutant rice positive seedling

A transgenic rice seedling 7 days old is germinated in a resistance culture medium added with hygromycin, 50mg leaves are cut, total DNA is extracted by a DNA extraction kit (Solebao, product number: D1500), fragments near target sequences of OsPEPR1 and OsPEPR2 are amplified by PCR (polymerase chain reaction) by using the following primers, and then the Shanghai Biotechnology Limited company is entrusted to complete PCR fragment sequencing by using a first-generation sequencing technology to analyze mutation of the target sequence.

OsPEPR1-sgRNA1-F:TTGTGCTGTTTGACAAATGA

OsPEPR1-sgRNA1-R:TTGTAGGCTCTTCATAAGTC

OsPEPR1-sgRNA2-F:CAATATCTGCACAGAAAGGT

OsPEPR1-sgRNA2-R:CAGATTATGCATGCTAATGT

OsPEPR2-sgRNA1-F:GGTTGTGATTCCGCGGTGCT

OsPEPR2-sgRNA1-R:AAGGATCCCACTCAATCGAT

OsPEPR2-sgRNA2-F:GAGGTCAGGAGAAGTATATG

OsPEPR2-sgRNA2-R:TAGCTAGATCACAAAGACAA

7) And (3) fluorescent quantitative PCR. Fluorescent quantitative PCR was performed using a fluorescent quantitative PCR kit (Applied Biosystems TaqMan, ThermoFisher) according to the instructions.

8) Quantification of rice blast biomass

After the plaques were uniformly sampled as described above, total DNA was extracted using a plant DNA extraction kit (same as above), and the DNA amounts of the rice blast fungus housekeeping gene MoPot2 and the rice housekeeping gene OsUG were detected by fluorescent quantitative PCR. The primers used were:

MoPot2_F:ACGACCCGTCTTTACTTATTTGG

MoPot2_R:AAGTAGCGTTGGTTTTGTTGGAT

OsUG-F:TTCTGGTCCTTCCACTTTCAG

OsUG-R:ACGATTGATTTAACCAGTCCATGA

9) biological materials used in this patent

The rice used in this patent (Oryza sativa l. japonica) was wild type medium flower No. 11, purchased from boehr remote biology ltd. The brown planthopper (Nilaparvata lugens) used in the patent is of type 1 organism and is provided by plant protection of the agricultural academy of Guangdong province. The rice blast fungus (Magnaporthe oryzae) strain used in the patent is GUY11, provided by the plant immunity research center of Fujian agriculture and forestry university.

Sequence listing

<110> Zhongshan university

<120> a polypeptide immune activator for improving the insect resistance and disease resistance of rice

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Ala Arg Leu Arg Pro Lys Pro Pro Gly Asn Pro Arg Glu Gly Ser Gly

1 5 10 15

Gly Asn Gly Gly His His His

20

<210> 2

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Asp Asp Ser Lys Pro Thr Arg Pro Gly Ala Pro Ala Glu Gly Ser Gly

1 5 10 15

Gly Asn Gly Gly Ala Ile His

20

<210> 3

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Ala Asp Ser Ala Pro Gln Arg Pro Gly Ser Pro Ala Glu Gly Ala Gly

1 5 10 15

Gly Asn Gly Gly Ala Val His

20

<210> 4

<211> 23

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Ser Lys Pro Lys Pro Glu Pro Pro Gly Tyr Pro Arg Glu Gly Gly Gly

1 5 10 15

Gly Asn Gly Gly Val Val Asp

20

Claims

1. A polypeptide immune activator for improving the insect resistance and disease resistance of rice is characterized by comprising any one of the following polypeptides as an active ingredient:

the polypeptide is:

OsPep1：ARLRPKPPGNPREGSGGNGGHHH；

OsPep2：DDSKPTRPGAPAEGSGGNGGAIH；

OsPep3：ADSAPQRPGSPAEGAGGNGGAVH；

OsPep7：SKPKPEPPGYPREGGGGNGGVVD。

2. the application of the polypeptide in preparing a preparation for improving the insect resistance and/or disease resistance of rice;

the polypeptide is any one of the following:

OsPep1：ARLRPKPPGNPREGSGGNGGHHH；

OsPep2：DDSKPTRPGAPAEGSGGNGGAIH；

OsPep3：ADSAPQRPGSPAEGAGGNGGAVH；

OsPep7：SKPKPEPPGYPREGGGGNGGVVD。

3. use according to claim 2, wherein the pest resistance is against brown planthopper.

4. The use according to claim 2, wherein the disease resistance is resistance to rice blast.

5. A method for enhancing the disease-resistant and insect-resistant capability of rice is characterized in that polypeptide is sprayed on the rice to improve the tolerance of the rice to diseases and insect pests; .

The polypeptide is any one of the following:

OsPep1：ARLRPKPPGNPREGSGGNGGHHH；

OsPep2：DDSKPTRPGAPAEGSGGNGGAIH；

OsPep3：ADSAPQRPGSPAEGAGGNGGAVH；

OsPep7：SKPKPEPPGYPREGGGGNGGVVD。

6. the method of claim 5, wherein said polypeptide is OsPep 3.

7. The method of claim 5, wherein the spraying of the rice with the polypeptide is carried out at the 4-leaf stage or 1 month old of the rice.

8. The method of claim 5, wherein said rice is rice ZH 11.