CN109371036B - An alfalfa salt tolerance gene MsPIP 2; 2 and uses thereof - Google Patents

Abstract

The invention discloses an alfalfa salt-tolerant gene MsPIP 2; 2, the alfalfa salt-tolerant gene MsPIP 2; 2, transferring the transgenic plant into wild arabidopsis thaliana to obtain MsPIP 2; 2, a salt stress treatment result of a transgenic plant discovers the salt-tolerant gene MsPIP2 of alfalfa; 2, the salt tolerance of the arabidopsis can be improved. And real-time quantification shows that the alfalfa salt-tolerant gene MsPIP2 also responds to salt stress in alfalfa.

Description

An alfalfa salt tolerance gene MsPIP 2; 2 and uses thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to an alfalfa salt-tolerant gene MsPIP 2; 2 and applications thereof.

Background

The salinization of soil is a worldwide problem, and the salinization soil area is about 10 hundred million hm all over the world²The salinization of the Chinese land occupies 1/10 of the global saline-alkali soil area, and is mainly distributed in the inland areas of northeast, north China and northwest and coastal areas of the Yangtze river, and the salinization degree is generally high. At present, salinization is an important factor influencing agricultural development, and meanwhile, the salinization also has a serious influence on the development of agriculture and animal husbandry. In recent years, research on the plant's ability to adapt to salt stress has become a global focus of attention. The consequences of soil salinization are reduced vegetation density, reduced forage yield and quality. Crops can have certain influence on the growth and development of saline-alkali soil, but the pasture has stronger salt tolerance than the crops, so the stronger salt tolerance of the pasture is taken into consideration when the saline-alkali soil is improved, and the development of animal husbandry in saline-alkali areas can be greatly promoted.

Alfalfa (Medicago sativa) is the oldest perennial legume used and most widely cultivated in the world. Because of high grass yield, rich nutrition and good palatability, the forage grass is known as the king of pasture and plays an important role in the production and development of animal husbandry in China. In addition, the alfalfa has a developed root system, has the advantages of strong abiotic stress resistance, capability of performing biological nitrogen fixation through rhizobium symbiosis and the like, and has important significance for improving soil fertility, promoting crop and grass rotation and the like. With the large-scale cultivation, intensive and commercial production of alfalfa in China, the demand for new varieties with high quality, high yield and high resistance is more and more urgent. Traditional breeding means, such as crossbreeding, backcross breeding, comprehensive variety breeding and the like, have long time and are highly dependent on wide germplasm resources, seriously restrict the breeding process of the alfalfa and influence the sustainable development of the alfalfa industry. Compared with the traditional breeding technology, the transgenic technology overcomes the weakness of sexual hybridization, can carry out gene recombination among farther genetic relationships, has more definite purpose, and can greatly accelerate the breeding process of the alfalfa. In recent years, researches on drought resistance, cold resistance and the like of alfalfa are more and more carried out by utilizing a transgenic means, great convenience is provided for genetic research on stress resistance of alfalfa, a new alfalfa variety with high quality, high yield and strong stress resistance can be rapidly cultured, and development of the livestock industry is promoted.

Disclosure of Invention

The invention aims to provide an alfalfa salt-tolerant gene MsPIP 2; 2, and verifying the function thereof.

In order to realize the task, the invention adopts the following technical solution:

an alfalfa salt tolerance gene MsPIP 2; 2, characterized in that the salt-tolerant gene MsPIP2 of alfalfa is; 2 the nucleotide sequence of the coding region is as follows:

according to the invention, the salt-tolerant gene MsPIP2 of alfalfa is described; 2 the amino acid sequence of the coding region is as follows:

the invention further discloses an alfalfa salt-tolerant gene MsPIP 2; 2, characterized in that it comprises the following steps:

(1) alfalfa seedling cDNA Synthesis:

extracting total RNA of alfalfa seedlings, and performing reverse transcription to obtain first-strand cDNA;

(2) MsPIP 2; 2 cloning of the full Length of the Gene:

taking alfalfa cDNA as a template, and performing amplification according to PIP2 of Medicago truncatula on NCBI; 2, carrying out homologous comparison on the gene sequences, designing a primer P1 and a primer P2, carrying out PCR amplification, recovering and purifying PCR amplification products, and sequencing to obtain an intermediate fragment; 5 ' RACE primers P3 and 3 ' are designed according to the sequence obtained by sequencing '

RACE primer P4, carrying out PCR amplification of 5 'end sequence and 3' end sequence, recovering and purifying PCR amplification product, and sequencing; finally splicing the intermediate sequence, the 5 'end sequence and the 3' end to obtain MsPIP 2; 2, finding the ORF of the open reading frame of the gene by using the ORF Finder; wherein:

the sequence of the primer P1 is as follows: 5'-GATGCTGAAGAACTCACAAAAT-3', respectively;

the sequence of the primer P2 is as follows: 5'-AAAAGGCTCCCCCTGTAACGAA-3', respectively;

the 5' RACE primer P3 is:

5’-GATTACGCCAAGCTTGTAGAAGGCTGCAATGGCTGCCCCAA-3’；

the 3' RACE primer P4 sequence is:

5’-GATTACGCCAAGCTTTTGGGGCAGCCATTGCAGCCTTCTAC-3’；

(3) primers P5 and P6 are designed at two ends of ORF, PCR amplification is carried out, the product is purified, vector connection and escherichia coli transformation are carried out, and alfalfa salt-tolerant gene MsPIP2 is obtained by sequencing; 2, the nucleotide sequence and the amino acid sequence of the coding region; wherein:

the sequence of the primer P5 is as follows: 5'-ATGGCAAAGGACGTTGAAG-3', respectively;

the sequence of the primer P6 is as follows: 5'-TCAAACAGTAGGGTTACTCCTG-3' are provided.

According to the experiments of the applicant, the alfalfa MsPIP 2; 2, the gene utilizes agrobacterium-mediated transgenic technology to carry out flower dipping on alfalfa MsPIP 2; 2, transferring the gene into wild arabidopsis (Col-0) and expressing the gene in arabidopsis to obtain MsPIP 2; 2 transgenic arabidopsis plants. Experiments prove that compared with wild plants, the MsPIP 2; 2 the salt tolerance of the transgenic plant is obviously improved. Illustrating the alfalfa MsPIP 2; the 2 gene plays an important role in improving the salt tolerance of plants.

Compared with the prior art, the salt-tolerant gene MsPIP2 of alfalfa provided by the invention; 2, the beneficial technical effects brought are that:

MsPIP2 related to salt tolerance is cloned from alfalfa for the first time; 2, obtaining the complete nucleotide sequence and amino acid sequence of the coding region. And the alfalfa salt-tolerant gene MsPIP2 is verified in Arabidopsis by a transgenic technology; 2, and supposing that the gene also has an important function for improving the salt tolerance of the alfalfa.

Drawings

FIG. 1 is a schematic diagram of RACE procedure;

FIG. 2 is alfalfa MsPIP 2; 2 obtaining a technical route map of the gene;

FIG. 3 is a diagram showing the quality of RNA extraction from alfalfa;

FIG. 4 is a 5' RACE amplification plot;

FIG. 5 is a 3' RACE amplification plot;

FIG. 6 is alfalfa MsPIP 2; 2 amplification of the sequence of the coding region of the gene;

FIG. 7 is a graph of the results of the identification of transgenic plants;

FIG. 8 is a table of salt tolerance of transgenic plants;

FIG. 9 is a diagram of the salt treatment results of salt tolerance genes of alfalfa.

The invention is described in further detail below with reference to the figures and specific examples.

Detailed Description

Example 1: alfalfa MsPIP 2; 2 obtaining the sequence of the coding region of the Gene

PIP2 from medicago truncatula on NCBI; 2, carrying out homologous comparison on the gene sequences, designing a primer P1 and a primer P2, carrying out PCR amplification, recovering and purifying PCR amplification products, carrying out vector connection, converting escherichia coli, and sequencing to obtain an intermediate fragment.

The sequence of the primer P1 is as follows: 5'-GATGCTGAAGAACTCACAAAAT-3', respectively;

the sequence of the primer P2 is as follows: 5'-AAAAGGCTCCCCCTGTAACGAA-3', respectively;

the schematic diagram of RACE step is shown in figure 1: 5 'RACE primer P3 and 3' RACE primer P4 were designed according to Clotech Corp

RACE 5 '/3 ' Kit instructions preparation for subsequent cloning by adding a 15bp (GATTACGCCAAGCTT) linker base sequence to the 5 ' end of the primer.

Finishing RACE process according to the kit instruction, and respectively amplifying to obtain the 5 'end sequence and the 3' end sequence of the gene.

The 5' RACE primer P3 is:

5’-GATTACGCCAAGCTTGTAGAAGGCTGCAATGGCTGCCCCAA-3’；

the 3' RACE primer P4 sequence is:

5’-GATTACGCCAAGCTTTTGGGGCAGCCATTGCAGCCTTCTAC-3’；

alfalfa MsPIP 2; 2 Gene acquisition method the technical scheme is shown in FIG. 2: total RNA Extraction Kit (TAKARA) is used for extracting total RNA of alfalfa seedlings, and the operation steps are carried out according to the instruction of the Extraction Kit. Mu.l of the total RNA solution extracted was pipetted and assayed using a microplate reader, and the RNA concentration (ng/. mu.l) in the solution was determined using RNase-free water as a blank control. Then, the cDNA was reverse-transcribed using the cDNA reverse transcription Kit PrimeScriptTM II 1st Strand cDNA Synthesis Kit (TAKARA) according to the protocol.

The alfalfa RNA extraction quality chart is shown in figure 3: the extracted RNA is detected by 1% agarose gel electrophoresis, and the result shows that the integrity of the extracted RNA is better and the extracted RNA can be used for subsequent tests.

Sequencing the cloned 5 'end sequence and 3' end sequence, splicing the 5 'end sequence and the 3' end sequence with DNAMAN software and a middle segment to obtain a full-length sequence of the gene, designing primers P5 and P6 at two ends of ORF, amplifying by using high-fidelity enzyme to obtain full-length cDNA of the gene, purifying the product, connecting vectors, converting escherichia coli, and sending to sequence to obtain the alfalfa salt-tolerant gene MsPIP 2; 2, wherein:

the sequence of the primer P5 is as follows: 5'-ATGGCAAAGGACGTTGAAG-3', respectively;

the sequence of the primer P6 is as follows: 5'-TCAAACAGTAGGGTTACTCCTG-3' are provided.

The 5' RACE amplification map is shown in FIG. 4, and the target band is 960bp in length.

The 3' RACE amplification map is shown in FIG. 5, and the target band is 430bp in length.

Alfalfa MsPIP 2; 2 the amplification map of the coding region sequence of the gene is shown in FIG. 6: the full length of the target band is 864 bp.

In conclusion, the obtained alfalfa salt-tolerant gene MsPIP 2; 2 the nucleotide sequence of the coding region is as follows:

alfalfa salt tolerance gene MsPIP 2; 2 the amino acid sequence of the coding region is as follows:

example 2: obtaining transgenic arabidopsis and identifying positive seedling

Constructing MsPIP2 using 35S as a promoter; 2 overexpression vector (35S: MsPIP 2; 2), and the alfalfa salt-tolerant gene MsPIP 2; 2 into wild arabidopsis thaliana, obtaining transgenic arabidopsis thaliana plants (Basta resistance), detecting by RT-PCR to obtain positive transgenic plants (figure 7), collecting homozygous seeds, and performing phenotype analysis.

Example 3: identification of resistance phenotype of transgenic Arabidopsis to salt stress

Wild type Arabidopsis (Col-0) and 2 transgenic lines L22 and L25 were sown in small pots containing vermiculite and placed in a light culture room for culture. After 2 weeks of growth, treated with 350 mM NaCl for 10 days, the plant phenotype was observed and recorded by photography.

The results of phenotypic analysis show that the growth conditions of the transgenic plants are obviously better than those of wild plants after 10 days of salt stress treatment (figure 8). Indicating a salt tolerance gene MsPIP2 of medicago sativa; 2 can improve the resistance of arabidopsis thaliana to salt stress.

Example 4: alfalfa was sampled at 0, 2, 4, 8 and 12h under salt (150mM NaCl) treatment, and MsPIP2 was subjected to real-time fluorescent quantitative PCR; 2 the expression level of the gene was measured, and the results are shown in FIG. 9.

Because the tissue culture growth period of the alfalfa is long, although the function of the gene is not verified in alfalfa plants, the gene can be preliminarily judged, and the gene also plays a certain regulating role in the salt resistance process of the alfalfa, and has important significance for the next step of researching the salt resistance of the transgenic alfalfa.

The above description is only a preferred embodiment of the present invention, and should not be taken as limiting the invention, and any modifications, equivalents, improvements and the like made in the technical solutions of the present invention should be considered as the protection scope of the present invention.

Nucleotide or amino acid sequence listing

<110> northwest agriculture and forestry science and technology university

<120> an alfalfa salt-tolerant gene MsPIP 2; 2 and uses thereof

<160>

<210> 1

<211> 864

<212> DNA

<213> nucleotide sequence

<220>

<400>

atggcaaagg acgttgaagt tgctgaacgt ggctctttct ctaacaaaga ctaccatgac cctccaccag caccactcat tgatgctgaa gaactcacaa aatggtcctt ttatagggcc cttattgctg agttcattgc aactttactt ttcctttacg ttactgtttt gactgttatt ggttacagta tccaaactga tgttaaagct ggtggtgatg cttgtggtgg tgttggaatt cttggtattg cttgggcttt tggtggcatg atctttgtcc ttgtttactg cactgctgga atttcaggtg gtcacattaa cccagcagtg acatttgggc tatttttggc tcgtaaggtg tctttgatca gagcaattat gtacatggtg gctcagtgtt taggggctat tgctggagtt gggttggtta aggcttttca aagtgcttac tttgatagat atggtggtgg tgctaatttt ctccatgatg gttacagtac tggtgttgga ttaggtgctg agattgttgg tacctttgtt ttggtttaca ccgttttctc tgctactgat cctaagagaa gtgctagaga ttcacatgtg ccggttttgg caccacttcc cattggcttt gctgtattca tggttcattt ggcaaccatc ccagtcactg gcactggcat caatcctgct agaagtcttg gttctgctgt tatctacaac aaagataagc cctgggatga ccattggatc ttttgggttg gaccattcat tggggcagcc attgcagcct tctaccatca attcatctta agagcaggtg ctgttaaagc tcttggatca ttcaggagta accctactgt ttga。

<210> 2

<211> 287

<212>

<213> amino acid sequence

<220>

<400>

Met Ala Lys Asp Val Glu Val Ala Glu Arg Gly Ser Phe Ser Asn Lys Asp Tyr His Asp Pro Pro Pro Ala Pro Leu Ile Asp Ala Glu Glu Leu Thr Lys Trp Ser Phe Tyr Arg Ala Leu Ile Ala Glu Phe Ile Ala Thr Leu Leu Phe Leu Tyr Val Thr Val Leu Thr Val Ile Gly Tyr Ser Ile Gln Thr Asp Val Lys Ala Gly Gly Asp Ala Cys Gly Gly Val Gly Ile Leu Gly Ile Ala Trp Ala Phe Gly Gly Met Ile Phe Val Leu Val Tyr Cys Thr Ala Gly Ile Ser Gly Gly His Ile Asn Pro Ala Val Thr Phe Gly Leu Phe Leu Ala Arg Lys Val Ser Leu Ile Arg Ala Ile Met Tyr Met Val Ala Gln Cys Leu Gly Ala Ile Ala Gly Val Gly Leu Val Lys Ala Phe Gln Ser Ala Tyr Phe Asp Arg Tyr Gly Gly Gly Ala Asn Phe Leu His Asp Gly Tyr Ser Thr Gly Val Gly Leu Gly Ala Glu Ile Val Gly Thr Phe Val Leu Val Tyr Thr Val Phe Ser Ala Thr Asp Pro Lys Arg Ser Ala Arg Asp Ser His Val Pro Val Leu Ala Pro Leu Pro Ile Gly Phe Ala Val Phe Met Val His Leu Ala Thr Ile Pro Val Thr Gly Thr Gly Ile Asn Pro Ala Arg Ser Leu Gly Ser Ala Val Ile Tyr Asn Lys Asp Lys Pro Trp Asp Asp His Trp Ile Phe Trp Val Gly Pro Phe Ile Gly Ala Ala Ile Ala Ala Phe Tyr His Gln Phe Ile Leu Arg Ala Gly Ala Val Lys Ala Leu Gly Ser Phe Arg Ser Asn Pro Thr Val。

<210> 3

<211> 22

<212> primer P1 sequence

<213>DNA

<220>

<400>

5’-GATGCTGAAGAACTCACAAAAT-3’

<210> 4

<211> 22

<212> primer P2 sequence

<213>DNA

<220>

<400>

5’-AAAAGGCTCCCCCTGTAACGAA-3’

<210> 5

<211> 41

<212> 5' RACE primer P3 sequence

<213>DNA

<220>

<400>

5’-GATTACGCCAAGCTTGTAGAAGGCTGCAATGGCTGCCCCAA-3’

<210> 5

<211> 41

<212> 3' RACE primer P4 sequence

<213>DNA

<220>

<400>

5’-GATTACGCCAAGCTTTTGGGGCAGCCATTGCAGCCTTCTAC-3’

<210> 6

<211> 19

<212> primer P5 sequence

<213>DNA

<220>

<400>

5’-ATGGCAAAGGACGTTGAAG-3’

<210>7

<211> 22

<212> primer P6 sequence

<213>DNA

<220>

<400>

5’-TCAAACAGTAGGGTTACTCCTG-3’

Claims (1)

1. An alfalfa salt tolerance gene MsPIP 2; 2, the salt tolerance of the alfalfa is improved, and the alfalfa salt tolerance gene MsPIP2 is used for improving the salt tolerance of transgenic arabidopsis thaliana and alfalfa; 2 the nucleotide sequence of the coding region is as follows:

atggcaaaggacgttgaagttgctgaacgtggctctttctctaacaaagactaccatgaccctccaccagcaccactcattgatgctgaagaactcacaaaatggtccttttatagggcccttattgctgagttcattgcaactttacttttcctttacgttactgttttgactgttattggttacagtatccaaactgatgttaaagctggtggtgatgcttgtggtggtgttggaattcttggtattgcttgggcttttggtggcatgatctttgtccttgtttactgcactgctggaatttcaggtggtcacattaacccagcagtgacatttgggctatttttggctcgtaaggtgtctttgatcagagcaattatgtacatggtggctcagtgtttaggggctattgctggagttgggttggttaaggcttttcaaagtgcttactttgatagatatggtggtggtgctaattttctccatgatggttacagtactggtgttggattaggtgctgagattgttggtacctttgttttggtttacaccgttttctctgctactgatcctaagagaagtgctagagattcacatgtgccggttttggcaccacttcccattggctttgctgtattcatggttcatttggcaaccatcccagtcactggcactggcatcaatcctgctagaagtcttggttctgctgttatctacaacaaagataagccctgggatgaccattggatcttttgggttggaccattcattggggcagccattgcagccttctaccatcaattcatcttaagagcaggtgctgttaaagctcttggatcattcaggagtaaccctactgtttga。

Images