CN114657188B - Gene PK1 for regulating cadmium accumulation of rice, protein and application thereof - Google Patents

Abstract

The invention discloses a gene PK1 for regulating and controlling cadmium accumulation of rice, which is characterized in that the nucleotide sequence is shown in SEQ ID NO:1 is shown in the specification; the protein obtained by encoding the gene PK1 for regulating and controlling the cadmium accumulation of rice has an amino acid sequence shown in SEQ ID NO: 2. The application of the gene PK1 or the encoding protein thereof in cultivating cadmium pollution-repaired crops, repairing soil cadmium pollution, regulating and controlling rice yield, utilizing nitrogen or genetically improving root system configuration is also disclosed. The rice PK1 gene and the coded protein thereof adopted by the invention can specifically enrich and remove the cadmium in the soil by utilizing the rice straw without obvious influence on the content of other nutrient elements in the soil, overcome the characteristic of tightly coupling the cadmium absorption and transport with other necessary elements in the prior art, and achieve the aim of repairing the cadmium in the soil without losing the fertilizer efficiency of the soil.

Description

Gene PK1 for regulating cadmium accumulation of rice, protein and application thereof

Technical Field

The invention belongs to the field of biotechnology and environment, and relates to a gene PK1 for regulating and controlling cadmium accumulation of rice, and a protein and application thereof.

Background

Cadmium is one of the most biotoxic heavy metals, and after being absorbed by plant root systems, the cadmium can cause strong toxicity to plants so as to seriously threaten the ecological environment, and can be enriched through food chains to endanger human health. Cadmium has a low geological background value in China, but with the aggravation of industrial activities, the overuse of nitrogenous fertilizers and soil acidification lead to cadmium pollution and mobility improvement. Because the average cultivated area of people in China is relatively small, the cadmium-polluted soil is forced to be used for planting grain crops, so that the cadmium rice is frequent in event and seriously endangers human health. At present, the cadmium pollution is mainly repaired by physical and chemical methods. Unfortunately, none of these methods is effective in removing cadmium contamination.

At present, research on heavy metal absorption regulation of plants, particularly molecular mechanism, is still relatively limited, and the obtained results are relatively insufficient, mainly focused on research on some transporters and gene mutation. Mutations in these genes tend to affect the plant's utilization of other essential elements, thereby inhibiting the plant's growth and reducing its yield. Therefore, finding genes for plant essential mineral nutrition transport and heavy metal uncoupling is a better strategy for coping with heavy metal pollution. However, the current theoretical basis can not meet the production practice requirement. Therefore, the field needs to deeply research the cadmium accumulation mechanism in plants, and provide gene resources for cultivating germplasm with reduced soil cadmium.

Disclosure of Invention

The invention aims to solve the technical problems, overcome the defects and shortcomings in the background art, and provide a gene PK1 for regulating and controlling cadmium accumulation in rice, and a protein and application thereof.

In order to solve the technical problems, the technical scheme provided by the invention is as follows:

a gene PK1 for regulating and controlling rice cadmium accumulation has a nucleotide sequence shown in SEQ ID NO: 1.

The protein obtained by encoding the gene PK1 for regulating and controlling the cadmium accumulation of rice has an amino acid sequence shown in SEQ ID NO: 2.

Based on a general inventive concept, the invention also provides an application of the gene PK1 or protein for regulating and controlling cadmium accumulation of rice in cultivating cadmium pollution repair crops.

For the above application, preferably, the crop species of the cadmium-contaminated restored crop include any one or more of rice, tobacco, corn and wheat.

Preferably, the method of application thereof comprises the steps of: cloning the gene PK1 into a target vector, transferring the target vector into agrobacterium through a thermal shock method, and transferring the target vector into crops through a tissue culture method for over-expression to obtain a homozygous mutant, namely the cadmium pollution repair crop.

More preferably, the target sgR-PK1 used in cloning the gene PK1 into the target vector comprises a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID NO:3, the nucleotide sequence of the reverse primer is shown as SEQ ID NO: 4.

Based on a general inventive concept, the invention also provides an application of the gene PK1 for regulating and controlling rice cadmium accumulation or the protein in repairing soil cadmium pollution, and the application method comprises the following steps: cloning the gene PK1 into a target vector, transferring the target vector into agrobacterium through a thermal shock method, transferring the target vector into crops through a tissue culture method, and performing over-expression to obtain homozygous mutant crops, planting the homozygous mutant crops in a field of cadmium-polluted soil, and repairing the cadmium pollution of the soil after continuous planting for many years.

Based on a general inventive concept, the invention also provides an application of the gene PK1 for regulating and controlling cadmium accumulation of rice or the protein in rice yield regulation, nitrogen utilization or root system configuration genetic improvement, and the application method comprises the following steps: cloning the gene PK1 into a target vector, transferring the target vector into agrobacterium through a thermal shock method, and transferring the target vector into rice through a tissue culture method for over-expression to obtain a rice homozygous mutant.

Compared with the prior art, the invention has the beneficial effects that:

1. the rice PK1 gene and the coded protein thereof adopted by the invention can specifically enrich and remove the cadmium in the soil by utilizing the rice straw without obvious influence on the content of other nutrient elements in the soil, overcome the characteristic of tightly coupling the cadmium absorption and transport with other necessary elements in the prior art, and achieve the aim of repairing the cadmium in the soil without losing the fertilizer efficiency of the soil.

2. According to the application method, a mutant of receptor-like protein kinase PK1 in rice is created by a gene editing technology, and PK1 is mainly expressed in leaves, cadmium-induced expression is carried out on leaf sheaths, and subcellular localization is carried out on cell membranes; the cadmium content of the mutant protoplast is obviously increased, and the cadmium content of the wound fluid of the overground part and the xylem of the mutant protoplast is obviously increased, the cadmium content of the mutant rice straw and the seed grain is obviously increased in the harvesting period, and the accumulation of other essential nutrient elements is not obviously influenced, so that excellent gene resources are provided for cultivating crops with cadmium repair potential by means of biotechnology.

3. According to the application method, a batch of mutants which can be used for specifically and obviously differentiating the accumulation of heavy metal cadmium in rice are obtained through a gene editing means, the genes which are uncoupled in the absorption and transportation of plant-controlled heavy metals and essential mineral nutrient elements are found, and the phytoremediation technology is utilized to remedy heavy metal contaminated soil, so that the specific heavy metal remediation is achieved without losing the soil fertilizer efficiency.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows experimental results of PK1 gene editing mutants of rice.

FIG. 2 shows the results of the expression patterns of PK1 gene before cadmium treatment (A) and after cadmium treatment (B).

FIG. 3 shows subcellular localization results of PK1 gene.

FIG. 4 shows the cadmium content results of the aerial parts (A) and xylem fluid (B) of the pk1 mutant in the seedling stage of rice.

FIG. 5 shows the result of cadmium content in protoplasts of the pk1 mutant in rice seedling stage.

FIG. 6 shows the result of cadmium accumulation in rice straw (A) and grain (B) in the pk1 mutant during the mature period of rice.

FIG. 7 shows the results of the plant height (B) and the main root length (C) of the pk1 mutant and the wild type in the 4-week water-culturing period of rice.

FIG. 8 shows the results of total nitrogen content (A) and nitrogen physiological efficiency (B) of pk1 mutant and wild type in 4-week water-culturing period of rice.

FIG. 9 shows the results of individual plant yields of pk1 mutant and wild type at rice maturation stage.

Detailed Description

The present invention will be described more fully hereinafter with reference to the accompanying drawings, in which preferred embodiments are shown, for the purpose of illustrating the invention, but the scope of the invention is not limited to the specific embodiments shown.

Unless defined otherwise, all technical and scientific terms used hereinafter have the same meaning as commonly understood by one of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the scope of the present invention.

Unless otherwise specifically indicated, the various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or may be prepared by existing methods.

Example 1:

a regulatory rice cadmium accumulation gene PK1 is found in rice, the gene number is Os12g0632900, and the CDS nucleotide sequence is shown in SEQ ID NO:1, the amino acid sequence of the protein (a rice receptor protein kinase) coded by the gene PK1 is shown as SEQ ID NO: 2.

1. Construction of mutant PK1 of PK1

To investigate the role of PK1 in rice we used gene editing techniques to obtain 3 homozygous mutants 10250-12, 10250-15, 10250-17 (FIG. 1). The forward primer of the target sgR-PK1 of the gene editing is GGTGGTGGCGGAGGCGGCAT (the nucleotide sequence of the forward primer is shown as SEQ ID NO: 3), the reverse primer is ATGCCGCCTCCGCCACCACC (the nucleotide sequence of the forward primer is shown as SEQ ID NO: 4), the pair of primers are complementary to form a double-chain outside the body and clone the double-chain outside the body onto an intermediate vector, and then the double-chain clone is cloned into a target vector P1300 (obtained from University of California, san Diego, US) by an enzyme digestion method, so as to obtain the target vector containing the PK1 gene target sequence. The target vector is transferred into agrobacterium through hot shock and is transformed into rice ZH11 through tissue culture method, and the tissue culture is completed by Wuhan Bo Yuan biological Limited company. After the transgenic strain is obtained, leaf DNA is extracted, DNA fragments near the target sequence are amplified by a PCR method through sequencing primers M-F (the nucleotide sequence of which is shown as SEQ ID NO: 5) and M-R (the nucleotide sequence of which is shown as SEQ ID NO: 6), and finally, the homozygous mutant is obtained by a sequencing method.

2. Expression pattern of PK1 Gene

The expression site of the gene determines the function of the gene, in order to study the space-time specificity of PK1 gene, we select different tissues in 3 weeks of hydroponic seedling stage (root, leaf sheath, leaf) and field flowering stage (leaf, flag leaf, leaf sheath, flag leaf sheath, node, internode, small ear), extract RNA by using Nanjinovirpresence biotechnology company's kit, reverse transcribe into CDNA, and detect PK1 mainly in rice leaf tissue expression (FIG. 2A) through PK1 specific primer RT-PK1-F (the nucleotide sequence of which is shown as SEQ ID NO: 7) and RT-PK1-R (the nucleotide sequence of which is shown as SEQ ID NO: 8), and reference gene Actin specific primer RT-Actin-F (the nucleotide sequence of which is shown as SEQ ID NO: 9) and RT-Actin-R (the nucleotide sequence of which is shown as SEQ ID NO: 10). After 3 weeks of rice water culture, PK1 was examined for Cd-induced expression changes in roots, leaf sheaths and leaves by treatment with 0, 10. Mu.M Cd for 3 days, and it was found that PK1 gene was strongly induced by Cd in leaf sheath tissues (FIG. 2B). The gene is involved in Cd stress response.

3. Subcellular localization of PK1 genes to cell membranes

To clone the full length CDS sequence of PK1, we designed 2 pairs of primers: PK1-1F (the nucleotide sequence of which is shown as SEQ ID NO: 11), PK1-1R (the nucleotide sequence of which is shown as SEQ ID NO: 12), PK1-2F (the nucleotide sequence of which is shown as SEQ ID NO: 13) and PK1-2R (the nucleotide sequence of which is shown as SEQ ID NO: 14) are connected with a vector pBWA (V) HS-GLosgfp by taking CDNA of ZH11 as a template, adopting high-fidelity polymerase and PCR to amplify target fragments and electrophoretically recovering the target fragments. Coli competent cells were transformed with 10ul ligation products, plated with (calicheamicin) resistant plates, and incubated at 37℃for 12 hours for plaque PCR identification. The target band is a fragment of about 3031 bp. Taking bacterial solutions corresponding to 1-3 positive strips, taking 100ul of bacterial solutions, carrying out sample feeding and sequencing, inoculating the rest 400ul of bacterial solutions into 5-10ml (calicheamicin) resistant LB, shaking a test tube, and taking a tube of extracted plasmid (the plasmid is named as pBWA (V) HS-PK 1-GLosgfp) corresponding to correct sequencing after the result of the sequencing is obtained. The obtained pBWA (V) HS-PK1-GLosgfp vector is thermally shocked into agrobacterium, the tobacco leaf epidermal cells are injected to transiently express PK1 protein, the light is protected for 24 hours, and after 72 hours, the green fluorescence of the tobacco leaf epidermal cells is observed through a laser confocal microscope, so that the subcellular localization result of PK1 is obtained as a cell membrane (figure 3).

4. The cadmium content of the upper part and xylem wound fluid of the pk1 mutant in the seedling stage of the rice is obviously increased

After 3 weeks of water culture of rice, the rice was treated with 10. Mu.M Cd for 7 days, and the accumulation of heavy metal Cd in the upper part and xylem wound fluid of the receptor-like protein kinase RLK1 mutant was found to be significantly increased (FIG. 4).

1) The aerial parts of the plants are directly collected after being washed by Milli-Q water;

2) In an oven at 80 ℃ for 24-48h;

3) Weighing 10-20mg of dried plant material, and placing into a 14mL FALCON (TM) tube;

4) 1mL nitric acid (MOS grade) is added, and the mixture is gently rocked to soak all materials overnight;

5) Boiling for 30 minutes at 99 ℃, and repeatedly boiling for 2-3 times according to the actual condition of the material;

6) Cooling to room temperature, supplementing Milli-Q water to 14mL, mixing, sealing, and measuring;

7) Inductively coupled plasma mass spectrometry (ICP-MS, ELAN DRC-e, perkin-Elmer) was used to determine the elemental metal content of the samples.

The xylem injury fluid collection method comprises the following steps: cutting the plants 1cm above the root junction with a sharp blade. To reduce contamination of damaged cytoplasm, wounded fluid was collected from the second drop, and collected together as one repetition for about 30-40min every 5 plants. The humidity in the incubator was maintained at 100% throughout the collection. Treating xylem up-flow with 5% HNO ₃ (MOS grade) was diluted to 2ml and the Cd content thereof was measured by ICP.

As a result, as shown in FIG. 4, the accumulation of cadmium in the upper and xylem-injured fluid of rice PK1 mutant 10250 was significantly increased compared to the wild-type. The values are the mean ± standard deviation of three replicates, P values are the significance difference statistical test Student's t-test analysis P <0.05, P <0.01.

5. The cadmium content of protoplast of the rice pk1 mutant is obviously increased

To explore the specific site of accumulation of Cd in the aerial parts, after 3 weeks of rice water culture, 10 μm Cd was used for 7 days, protoplasts were isolated from the material, and the pk1 mutant was found to have significantly increased Cd content in protoplasts (fig. 5). Methods of protoplast extraction are described in literature references (Zhang, y., su, j, dutan, s, ao, y., dai, j, liu, j, wang, p, li, y, liu, b, feng, d, wang, j, & Wang, h (2011), ahighly efficient rice green tissue protoplast system for transient gene expression and studying light/chlorofast-related proteins, plant methods,7 (1), 30), and the cadmium content is quantified to the total protein content of the protoplasts. The values are mean ± standard deviation of triplicate experiments, P values are significant difference statistical test Student's t-test analysis P <0.05, P <0.01.

6. The accumulation of cadmium in rice straw and seeds of pk1 mutant in the mature period of rice is increased

The rice was grown to Cd contaminated land and seed maturing, and we examined the Cd content in the seeds and stalks of the ZH11 and pk1 mutants during the rice maturing period and found that the Cd content in the rice and seeds in the pk1 mutants was significantly higher than in the control (fig. 6). This may provide a genetic resource for breeding rice germplasm with Cd repair potential in the aerial parts. The detection method of Cd is the same as that of the 4 th point. The values are mean ± standard deviation of triplicate experiments, P values are significant difference statistical test Student's t-test analysis P <0.05, P <0.01.

Example 2:

the application of the gene PK1 for regulating and controlling the accumulation of rice cadmium or the coded protein thereof in the remediation of the soil cadmium pollution, namely a method for remedying the soil cadmium pollution, comprises the following steps:

the method of the embodiment 1 is adopted to cultivate cadmium pollution remediation rice (namely the homozygous mutant of the rice pk1 of the embodiment 1), the cadmium pollution remediation rice is planted in a pollution rice field with the cadmium content of 0.5 mu g/g dry weight, after the rice field is ripe, straw and stubble high-quantity off-field and harvesting integrated farm machinery suitable for the cadmium pollution rice field in the southern hilly area is used for harvesting, after continuous planting for 2 years, the cadmium content of the soil is reduced by 30%, the cadmium content of the rice field is changed into 0.35 mu g/g dry weight, and the pk1 mutant material has good remediation effect.

Example 3:

the application of the gene PK1 for regulating and controlling the cadmium accumulation of rice or the coded protein thereof in the genetic improvement of rice yield regulation, nitrogen utilization or root system configuration comprises the following steps:

the homozygous mutant of rice pk1 was cultivated by the method of example 1. Through researches, PK1 has obvious influence on the growth and development of rice, the single plant yield and the nitrogen utilization efficiency in different growth periods of the rice. For example, in the 4-week period of water culture seedling, the root system configuration of the pk1 mutant is significantly changed compared with that of the wild ZH11, and the plant height and main root length are significantly reduced (figure 7); the total nitrogen content increased but the nitrogen physiological utilization efficiency decreased (fig. 8). The individual yield was significantly lower during the maturation period than the wild-type ZH11 (fig. 9). These results indicate that PK1 provides an excellent gene resource for rice yield regulation, nitrogen utilization, and genetic modification of root system configuration. Has great application prospect. Values are mean ± standard deviation of triplicate experiments, P values are significant difference statistical test Student's t-test analysis P <0.05.

In summary, the invention discloses a gene PK1 for regulating cadmium accumulation in rice, which has a nucleotide sequence shown in SEQ ID NO:1, the amino acid sequence of the coded protein is shown as SEQ ID NO:2 from positions 1 to 977. The invention also discloses that the cadmium content of the mutant obtained from the gene in the overground part, protoplast and xylem wound fluid of rice seedling stage, rice straw and seed grain in mature stage is higher than that of the control, which proves that the gene PK1 or the coded protein thereof can be used for cultivating crops with the potential of repairing cadmium pollution, and provides excellent gene resources for cultivating crops with the potential of repairing cadmium pollution by means of biotechnology. Furthermore, the crops with the potential of repairing cadmium pollution can be used for repairing the cadmium pollution of soil after being planted, and the repairing effect is good.

Sequence listing

<110> Hunan agricultural university

<120> gene PK1 for regulating cadmium accumulation in rice, protein and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2934

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atggtgatca atctctcttc tcctccaatc ttcttgttgt tcttcttgtg gtgtgttgtc 60

gtcttcttcg tggccggcga tggcggcgcg gtggtggcgg aggcggcatt ggatgctcag 120

gcggcgtacc tgtcccagat gaagcaggag ttcgccgggc cggccatggc gaggtgggac 180

ttctcggcgc cggccgtgga ctactgcaag ttccagggtg tcgggtgcga cgcctccggc 240

aacgtgacgg ccatcgacgt cacgtcgtgg aggctgagcg gtaggctccc cggcggcgtg 300

tgcgaggcgc tcccggcgct ccgggaggtc cggctcgggt acaacgacat ccgcggcggg 360

ttccccggcg ggctggtgaa ctgcacgtcg ctggaggtgc tcaacctcag ctgctccggc 420

gtgtcgggcg ccgtgccgga cctgtcgcgg atgccggcgc tgcgggtgct cgacgtgtcc 480

aacaactact tctccggcgc gttcccgacg tcgatcgcca acgtcaccac gctcgaggtg 540

gccaacttca acgagaaccc cgggttcgac atctggtggc cgccggagtc gctgatggcg 600

ctgcggcgcc tccgcgtgct catcctgtcg acgacgtgca tgcacggcgg cgtcccggcg 660

tggctcggga acatgacgtc gctcaccgac ctggaactca gcggcaacct cctcaccggc 720

cacatcccgc tgtcgctggc gcgcctccca aacctgcagc tgctcgagct ctactacaac 780

ctgcttgagg gcgtcgtccc cgccgagctc ggcaacctca cgcagctcac cgacatcgac 840

ctctccgaga acaacctcac cggcggcatc ccggagtcca tctgcgcgct gcctcgcctc 900

cgcgtgctcc agatgtacac caacaagctc accggcgcca tcccggccgt gctcggcaac 960

tccacgcagc tccgcatcct gtccgtctac cgcaaccagc tcaccggcga gctccccgcc 1020

gacctcggcc gctactccgg cttcaacgtg ctggaggtgt cggagaacca gctcaccggc 1080

ccgctgccgc cgtacgcctg cgccaacggc cagctccagt acatcctcgt gctcagcaac 1140

ctcctcaccg gcgccatccc ggcgtcgtac gccgcgtgcc ggccgctgct ccgcttccgc 1200

gtcagcaaca accacctcga cggcgacgtc cccgcgggca tcttcgcgct cccgcacgcc 1260

tccatcatcg acctctccta caaccacctc accgggccag tgccggccac catcgccggc 1320

gccaccaacc tgacgtcgct gttcgcgtcg aacaaccgca tgtcgggggt cctgccgccg 1380

gagatcgccg gcgcggcgac gctggtcaag atcgacctga gcaacaacca gatcggcggg 1440

gcgatcccgg aggcggtggg gcggctgagc cggctgaacc agctgtcgct gcagggcaac 1500

cggctgaacg gctccatccc ggcgacgctc gccgacctcc acagcctgaa cgtgctgaac 1560

ctgtcgtaca atgcgctcgc cggcgagatc ccggaggcgc tgtgcacgct gctgcccaac 1620

tcgctggact tctccaacaa caacctgtcc gggccggtgc cgctgcagct gatcagggag 1680

gggctcctgg agagcgtcgc cggcaacccg gggctgtgcg tggcgttccg gctgaacctc 1740

accgacccgg cgctgccgct gtgccccaag ccggcgaggc tgcggatgcg ggggctcgcc 1800

gggagcgtgt gggtggtggc ggtgtgcgcg ctggtgtgcg tggtggcgac gctggcgctg 1860

gcgaggcggt gggtgctgcg ggcgcggcag gacggggagc acgacgggct cccgacgtcg 1920

ccggcgtcga gctcgtcgta cgacgtgacg agcttccaca agctgagctt cgaccagcac 1980

gagatcgtgg aggcgctgat cgacaagaac atcgtcggcc acggcggctc cggcacggtg 2040

tacaagatcg agctgagcaa cggcgagctg gtcgccgtga agaagctgtg ggtgtcgcgg 2100

cggtccaagc aggagcacgg ccatggcggc ggcggggggt gcctcgaccg cgagctgcgg 2160

acggaggtgg agacgctggg cagcatccgg cacaagaaca tcgtgaagct ctactgctgc 2220

tactccggcg ccgacagcaa cctgctggtg tacgagtaca tgcccaacgg caacctatgg 2280

gacgcgctcc acggcggcgg cgggtggggc ttcggcttcc tggactggcc gacgcgccac 2340

cgcgtcgcgc tcggcgtcgc ccagggcctc gcctacctcc accacgacct cctcttcccc 2400

atcgtccacc gcgacatcaa gtcctccaac atcctcctcg acgccgactt cgagcccaag 2460

gtcgccgact tcggcatcgc caaggtcctc caggcccgcg gcgatcgcga cgcctccacc 2520

accaccatcg ccggcaccta cggctacctc gctccagagt acgcctactc gtcaaaggcg 2580

acgacaaagt gcgacgtgta cagcttcggg gtggtgctaa tggagctggc gacggggaag 2640

aagccgatcg agccggagtt cggcgacacg agggacatcg tgcagtgggt ctccggcaag 2700

gtggccgccg gcggcgaggg cgaggcgctg gacaagcggc tcgagtggag ccccttcaag 2760

gaggagatgg tgcaggctct ccgcgtcgcc gtccgctgca cctgcagcat ccccggcctc 2820

cgccccacca tggccgacgt cgtgcagatg ctcgccgagg ccggccccgc cgccggccgg 2880

accgccaagg acgccgccaa caagaaggac tcctccggcg agccaaagct gtaa 2934

<210> 2

<211> 977

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Met Val Ile Asn Leu Ser Ser Pro Pro Ile Phe Leu Leu Phe Phe Leu

1 5 10 15

Trp Cys Val Val Val Phe Phe Val Ala Gly Asp Gly Gly Ala Val Val

20 25 30

Ala Glu Ala Ala Leu Asp Ala Gln Ala Ala Tyr Leu Ser Gln Met Lys

35 40 45

Gln Glu Phe Ala Gly Pro Ala Met Ala Arg Trp Asp Phe Ser Ala Pro

50 55 60

Ala Val Asp Tyr Cys Lys Phe Gln Gly Val Gly Cys Asp Ala Ser Gly

65 70 75 80

Asn Val Thr Ala Ile Asp Val Thr Ser Trp Arg Leu Ser Gly Arg Leu

85 90 95

Pro Gly Gly Val Cys Glu Ala Leu Pro Ala Leu Arg Glu Val Arg Leu

100 105 110

Gly Tyr Asn Asp Ile Arg Gly Gly Phe Pro Gly Gly Leu Val Asn Cys

115 120 125

Thr Ser Leu Glu Val Leu Asn Leu Ser Cys Ser Gly Val Ser Gly Ala

130 135 140

Val Pro Asp Leu Ser Arg Met Pro Ala Leu Arg Val Leu Asp Val Ser

145 150 155 160

Asn Asn Tyr Phe Ser Gly Ala Phe Pro Thr Ser Ile Ala Asn Val Thr

165 170 175

Thr Leu Glu Val Ala Asn Phe Asn Glu Asn Pro Gly Phe Asp Ile Trp

180 185 190

Trp Pro Pro Glu Ser Leu Met Ala Leu Arg Arg Leu Arg Val Leu Ile

195 200 205

Leu Ser Thr Thr Cys Met His Gly Gly Val Pro Ala Trp Leu Gly Asn

210 215 220

Met Thr Ser Leu Thr Asp Leu Glu Leu Ser Gly Asn Leu Leu Thr Gly

225 230 235 240

His Ile Pro Leu Ser Leu Ala Arg Leu Pro Asn Leu Gln Leu Leu Glu

245 250 255

Leu Tyr Tyr Asn Leu Leu Glu Gly Val Val Pro Ala Glu Leu Gly Asn

260 265 270

Leu Thr Gln Leu Thr Asp Ile Asp Leu Ser Glu Asn Asn Leu Thr Gly

275 280 285

Gly Ile Pro Glu Ser Ile Cys Ala Leu Pro Arg Leu Arg Val Leu Gln

290 295 300

Met Tyr Thr Asn Lys Leu Thr Gly Ala Ile Pro Ala Val Leu Gly Asn

305 310 315 320

Ser Thr Gln Leu Arg Ile Leu Ser Val Tyr Arg Asn Gln Leu Thr Gly

325 330 335

Glu Leu Pro Ala Asp Leu Gly Arg Tyr Ser Gly Phe Asn Val Leu Glu

340 345 350

Val Ser Glu Asn Gln Leu Thr Gly Pro Leu Pro Pro Tyr Ala Cys Ala

355 360 365

Asn Gly Gln Leu Gln Tyr Ile Leu Val Leu Ser Asn Leu Leu Thr Gly

370 375 380

Ala Ile Pro Ala Ser Tyr Ala Ala Cys Arg Pro Leu Leu Arg Phe Arg

385 390 395 400

Val Ser Asn Asn His Leu Asp Gly Asp Val Pro Ala Gly Ile Phe Ala

405 410 415

Leu Pro His Ala Ser Ile Ile Asp Leu Ser Tyr Asn His Leu Thr Gly

420 425 430

Pro Val Pro Ala Thr Ile Ala Gly Ala Thr Asn Leu Thr Ser Leu Phe

435 440 445

Ala Ser Asn Asn Arg Met Ser Gly Val Leu Pro Pro Glu Ile Ala Gly

450 455 460

Ala Ala Thr Leu Val Lys Ile Asp Leu Ser Asn Asn Gln Ile Gly Gly

465 470 475 480

Ala Ile Pro Glu Ala Val Gly Arg Leu Ser Arg Leu Asn Gln Leu Ser

485 490 495

Leu Gln Gly Asn Arg Leu Asn Gly Ser Ile Pro Ala Thr Leu Ala Asp

500 505 510

Leu His Ser Leu Asn Val Leu Asn Leu Ser Tyr Asn Ala Leu Ala Gly

515 520 525

Glu Ile Pro Glu Ala Leu Cys Thr Leu Leu Pro Asn Ser Leu Asp Phe

530 535 540

Ser Asn Asn Asn Leu Ser Gly Pro Val Pro Leu Gln Leu Ile Arg Glu

545 550 555 560

Gly Leu Leu Glu Ser Val Ala Gly Asn Pro Gly Leu Cys Val Ala Phe

565 570 575

Arg Leu Asn Leu Thr Asp Pro Ala Leu Pro Leu Cys Pro Lys Pro Ala

580 585 590

Arg Leu Arg Met Arg Gly Leu Ala Gly Ser Val Trp Val Val Ala Val

595 600 605

Cys Ala Leu Val Cys Val Val Ala Thr Leu Ala Leu Ala Arg Arg Trp

610 615 620

Val Leu Arg Ala Arg Gln Asp Gly Glu His Asp Gly Leu Pro Thr Ser

625 630 635 640

Pro Ala Ser Ser Ser Ser Tyr Asp Val Thr Ser Phe His Lys Leu Ser

645 650 655

Phe Asp Gln His Glu Ile Val Glu Ala Leu Ile Asp Lys Asn Ile Val

660 665 670

Gly His Gly Gly Ser Gly Thr Val Tyr Lys Ile Glu Leu Ser Asn Gly

675 680 685

Glu Leu Val Ala Val Lys Lys Leu Trp Val Ser Arg Arg Ser Lys Gln

690 695 700

Glu His Gly His Gly Gly Gly Gly Gly Cys Leu Asp Arg Glu Leu Arg

705 710 715 720

Thr Glu Val Glu Thr Leu Gly Ser Ile Arg His Lys Asn Ile Val Lys

725 730 735

Leu Tyr Cys Cys Tyr Ser Gly Ala Asp Ser Asn Leu Leu Val Tyr Glu

740 745 750

Tyr Met Pro Asn Gly Asn Leu Trp Asp Ala Leu His Gly Gly Gly Gly

755 760 765

Trp Gly Phe Gly Phe Leu Asp Trp Pro Thr Arg His Arg Val Ala Leu

770 775 780

Gly Val Ala Gln Gly Leu Ala Tyr Leu His His Asp Leu Leu Phe Pro

785 790 795 800

Ile Val His Arg Asp Ile Lys Ser Ser Asn Ile Leu Leu Asp Ala Asp

805 810 815

Phe Glu Pro Lys Val Ala Asp Phe Gly Ile Ala Lys Val Leu Gln Ala

820 825 830

Arg Gly Asp Arg Asp Ala Ser Thr Thr Thr Ile Ala Gly Thr Tyr Gly

835 840 845

Tyr Leu Ala Pro Glu Tyr Ala Tyr Ser Ser Lys Ala Thr Thr Lys Cys

850 855 860

Asp Val Tyr Ser Phe Gly Val Val Leu Met Glu Leu Ala Thr Gly Lys

865 870 875 880

Lys Pro Ile Glu Pro Glu Phe Gly Asp Thr Arg Asp Ile Val Gln Trp

885 890 895

Val Ser Gly Lys Val Ala Ala Gly Gly Glu Gly Glu Ala Leu Asp Lys

900 905 910

Arg Leu Glu Trp Ser Pro Phe Lys Glu Glu Met Val Gln Ala Leu Arg

915 920 925

Val Ala Val Arg Cys Thr Cys Ser Ile Pro Gly Leu Arg Pro Thr Met

930 935 940

Ala Asp Val Val Gln Met Leu Ala Glu Ala Gly Pro Ala Ala Gly Arg

945 950 955 960

Thr Ala Lys Asp Ala Ala Asn Lys Lys Asp Ser Ser Gly Glu Pro Lys

965 970 975

Leu

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

ggtggtggcg gaggcggcat 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atgccgcctc cgccaccacc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

agccaccatc tgatctgtgc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

cggatgtcgt tgtacccgag 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

cctgagcaac aaccagatcg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

cggacaggtt gttgttggag 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tccatcttgg catctctcag 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gtacccgcat caggcatctg 20

<210> 11

<211> 35

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

cagtggtctc acaacatggt gatcaatctc tcttc 35

<210> 12

<211> 31

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 12

cgatggtctc aacccactgc acgatgtccc t 31

<210> 13

<211> 35

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 13

cagtggtctc agggtctccg gcaaggtggc cgccg 35

<210> 14

<211> 35

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 14

cagtggtctc atacacagct ttggctcgcc ggagg 35

Claims (4)

1. Gene for regulating cadmium accumulation of rice through silencing/deletionPK1Or the application of the coded protein thereof in cultivating cadmium pollution repair crops, which is characterized in that the genePK1The nucleotide sequence of (2) is shown as SEQ ID NO:1, wherein the amino acid sequence of the encoded protein is shown as SEQ ID NO:2, the crop species of the cadmium pollution repair crop is rice.

2. The use according to claim 1, characterized in that the method of its use comprises the steps of: silencing/deleting genes in target crop receptors using gene editing techniquesPK1Obtaining a homozygous mutant, wherein the homozygous mutant is the cadmium pollution repair crop;

the forward primer nucleotide sequence of the target sgR-PK1 utilized by gene editing is shown in SEQ ID NO:3, the nucleotide sequence of the reverse primer is shown as SEQ ID NO:4, the pair of primers are complementary in vitro to form double chains, cloned to an intermediate vector, and cloned to a target vector by an enzyme digestion method to obtain a vector containingPK1The target vector of the gene target sequence is transferred into agrobacterium through thermal shock, transformed into rice through a tissue culture method for over-expression, leaf DNA is extracted after the transgenic strain is taken, DNA fragments near the target sequence are amplified through a PCR method by using sequencing primers M-F and M-R, and finally, a homozygous mutant is obtained through a sequencing method;

the nucleotide sequences of the sequencing primers M-F and M-R are respectively shown in SEQ ID NO: 5. SEQ ID NO: shown at 6.

3. Gene for regulating cadmium accumulation of rice through silencing/deletionPK1Or the application of the cadmium pollution repair crops obtained by culturing the encoded protein thereof in repairing the cadmium pollution of soil is characterized in that the genePK1The nucleotide sequence of (2) is shown as SEQ ID NO:1, wherein the amino acid sequence of the encoded protein is shown as SEQ ID NO:2, the crop species of the cadmium pollution repair crop is rice.

4. A use according to claim 3, characterized in that the method of its use comprises the steps of: silencing/deleting genes in target crop receptors using gene editing techniquesPK1And obtaining a homozygous mutant;

the forward primer nucleotide sequence of the target sgR-PK1 utilized by gene editing is shown in SEQ ID NO:3, the nucleotide sequence of the reverse primer is shown as SEQ ID NO:4, the pair of primers are complementary in vitro to form double chains, cloned to an intermediate vector, and cloned to a target vector by an enzyme digestion method to obtain a vector containingPK1The target carrier of the gene target sequence is transferred into agrobacterium through hot shock, transformed into rice through a tissue culture method for over-expression, leaf DNA is extracted after the transgenic strain is taken, DNA fragments near the target sequence are amplified through a PCR method by using sequencing primers M-F and M-R, and finally homozygous mutants are obtained through a sequencing method and are planted in fields of cadmium contaminated soil, and the repair of the cadmium contaminated soil can be realized after continuous planting for many years;

the nucleotide sequences of the sequencing primers M-F and M-R are respectively shown in SEQ ID NO: 5. SEQ ID NO: shown at 6.