CN114657188A - Gene PK1 for regulating and controlling rice cadmium accumulation, protein and application thereof - Google Patents

Abstract

The invention discloses a gene PK1 for regulating and controlling rice cadmium accumulation, which is characterized in that the nucleotide sequence is shown as SEQ ID NO: 1 is shown in the specification; a protein encoded by gene PK1 for regulating and controlling rice cadmium accumulation has an amino acid sequence shown in SEQ ID NO: 2, respectively. Also discloses the application of the gene PK1 or the coded protein thereof in cultivating cadmium pollution to repair crops, repairing cadmium pollution of soil, regulating and controlling rice yield, utilizing nitrogen or genetically improving root system configuration. The rice PK1 gene and the encoding protein thereof adopted by the invention can specifically enrich and remove the cadmium in the soil by using the rice straw without obviously influencing the content of other nutrient elements in the soil, overcome the characteristic that the cadmium is absorbed and transported and is closely coupled with other essential elements in the prior art, and achieve the aim of repairing the cadmium in the soil without losing the fertilizer efficiency of the soil.

Description

Gene PK1 for regulating and controlling rice cadmium accumulation, protein and application thereof

Technical Field

The invention belongs to the field of biotechnology and environment, and relates to a gene PK1 for regulating and controlling rice cadmium accumulation, a protein thereof and application thereof.

Background

Cadmium is one of heavy metals with the strongest biological toxicity, and can not only cause strong toxicity to plants and further seriously threaten the ecological environment after being absorbed by plant root systems, but also harm the health of human beings after being enriched by food chains. Cadmium has a low geological background value in China, but with the aggravation of industrial activities, the overuse of nitrogen fertilizers and soil acidification lead to cadmium pollution and improved mobility. As the per capita cultivated land area of China is relatively small, cadmium-polluted soil is forced to be still used for planting grain crops, so that cadmium rice is frequently encountered and seriously harms human health. At present, the cadmium pollution is mainly repaired physically and chemically. Unfortunately, none of these methods is effective in removing cadmium contamination.

At present, the researches on heavy metal absorption regulation of plants, especially the researches on molecular mechanism are relatively limited no matter internationally or domestically, the obtained results are relatively insufficient, and the researches mainly focus on the researches on some transport proteins and gene mutation. Mutation of these genes will affect the utilization of other essential elements by the plant, thus inhibiting the growth of the plant and reducing its yield. Therefore, the finding of the genes for the plant essential mineral nutrition transport and heavy metal uncoupling is a better strategy for dealing with heavy metal pollution. But the current theoretical basis is far from meeting the practical requirements of production. Therefore, the field needs to research the cadmium accumulation mechanism in plants deeply and provide gene resources for breeding germplasm with reduced soil cadmium.

Disclosure of Invention

The invention aims to solve the technical problem of overcoming the defects and shortcomings in the background art and provides a gene PK1 for regulating and controlling cadmium accumulation in rice, and a protein and an application thereof.

In order to solve the technical problems, the technical scheme provided by the invention is as follows:

a gene PK1 for regulating and controlling rice cadmium accumulation has a nucleotide sequence shown in SEQ ID NO: 1 is shown.

A protein encoded by gene PK1 for regulating and controlling rice cadmium accumulation has an amino acid sequence shown in SEQ ID NO: 2, respectively.

Based on a general inventive concept, the invention also provides application of the gene PK1 or protein for regulating and controlling the cadmium accumulation of the rice in cultivating cadmium pollution remediation crops.

In the application, preferably, the crop species of the cadmium pollution remediation crops comprise any one or more of rice, tobacco, corn and wheat.

Preferably, the method for applying the same comprises the following steps: the gene PK1 is cloned into a target vector, then is transferred into agrobacterium by a heat shock method, and is transformed into crops by a tissue culture method for overexpression to obtain a homozygous mutant, namely the cadmium pollution remediation crops.

More preferably, the target sgR-PK1 adopted when cloning the gene PK1 into a target vector comprises a forward primer and a reverse primer, wherein the nucleotide sequence of the forward primer is shown as SEQ ID NO: 3, the nucleotide sequence of the reverse primer is shown as SEQ ID NO: 4, respectively.

Based on a general inventive concept, the invention also provides an application of the gene PK1 for regulating and controlling the cadmium accumulation of rice or the protein as above in the remediation of the cadmium pollution of soil, and the application method comprises the following steps: the gene PK1 is cloned into a target vector, then is transferred into agrobacterium by a heat shock method, is transformed into crops by a tissue culture method for overexpression to obtain homozygous mutant crops, and the homozygous mutant crops are planted in a field with cadmium-polluted soil and can realize the remediation of the cadmium-polluted soil after being continuously planted for years.

Based on a general inventive concept, the invention also provides an application of the gene PK1 for regulating and controlling the cadmium accumulation of rice or the protein as above in rice yield regulation, nitrogen utilization or root system configuration genetic improvement, and the application method comprises the following steps: the gene PK1 is cloned into a target vector, then is transferred into agrobacterium by a heat shock method, and is transformed into rice by a tissue culture method for overexpression, so that the rice homozygous mutant is obtained.

Compared with the prior art, the invention has the beneficial effects that:

1. the rice PK1 gene and the encoding protein thereof adopted by the invention can utilize the rice straw to specifically enrich and remove the cadmium in the soil without obviously influencing the content of other nutrient elements in the soil, overcome the characteristic of the prior art that the cadmium is absorbed and transported and is closely coupled with other essential elements, and achieve the aim of repairing the cadmium in the soil without losing the fertilizer efficiency of the soil.

2. According to the application method, a mutant of receptor-like protein kinase PK1 in rice is created through a gene editing technology, and the discovery shows that PK1 is mainly expressed in leaves, cadmium is induced and expressed in leaf sheaths, and subcellular localization is carried out on cell membranes; the cadmium content of the mutant protoplast is obviously increased, the cadmium content of the mutant overground part and xylem bleeding sap is obviously increased, the cadmium content of the mutant straw and grains is obviously increased in the harvesting period, and the accumulation of other necessary nutrient elements is not obviously influenced, so that excellent gene resources are provided for cultivating crops with cadmium repair potential by means of biotechnology.

3. According to the application method, a group of mutants which are possibly and specifically different from rice heavy metal cadmium accumulation are obtained by means of gene editing, genes for regulating, controlling, transporting and uncoupling heavy metal and essential mineral nutrient elements by plants are found, and the method for repairing the heavy metal contaminated soil by utilizing the plant repairing technology is a better strategy, so that the specific heavy metal repairing is achieved without losing the soil fertilizer effect.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to these drawings without creative efforts.

FIG. 1 shows the results of experiments on rice PK1 gene editing mutants.

FIG. 2 shows the results of the expression patterns of PK1 gene before (A) and after (B) cadmium treatment.

FIG. 3 shows the subcellular localization of PK1 gene.

FIG. 4 shows the result of cadmium content in overground part (A) and xylem sap (B) of the rice seedling stage pk1 mutant.

FIG. 5 shows the result of cadmium content in protoplast of pk1 mutant at rice seedling stage.

FIG. 6 shows the result of cadmium accumulation of the pk1 mutant rice straw (A) and seed (B) during the rice maturation period.

FIG. 7 shows the results of the water-cultivated seedling period of rice 4 weeks for the pk1 mutant and wild type (A), plant height (B) and major root length (C).

FIG. 8 shows the results of the total nitrogen content (A) and physiological nitrogen efficiency (B) of the pk1 mutant and wild type in the 4-week hydroponic seedling period of rice.

FIG. 9 shows the individual plant yields of the pk1 mutant and wild type at the rice maturity stage.

Detailed Description

In order to facilitate understanding of the invention, the invention will be described more fully and in detail with reference to the accompanying drawings and preferred embodiments, but the scope of the invention is not limited to the specific embodiments below.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the scope of the present invention.

Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment and the like used in the present invention are commercially available or can be prepared by existing methods.

Example 1:

a gene PK1 for regulating and controlling rice cadmium accumulation is found in rice, has a gene number of Os12g0632900, and has a CDS nucleotide sequence shown as SEQ ID NO: 1, the amino acid sequence of the protein (rice receptor protein kinase) coded by the gene PK1 is shown as SEQ ID NO: 2, respectively.

1. Construction of a mutant PK1 of PK1

To investigate the role of PK1 in rice, we used gene editing techniques to generate 3 homozygous mutants 10250-12, 10250-15, 10250-17 (FIG. 1). The forward primer of the gene editing target sgR-PK1 is GGTGGTGGCGGAGGCGGCAT (the nucleotide sequence is shown as SEQ ID NO: 3), the reverse primer is ATGCCGCCTCCGCCACCACC (the nucleotide sequence is shown as SEQ ID NO: 4), the pair of primers are in vitro complemented to form double-stranded clone to an intermediate vector, and then the double-stranded clone is cloned to a target vector P1300 (obtained from University of California, San Diego, US) by an enzyme digestion method, so that the target vector containing the PK1 gene target sequence is obtained. The target vector is transferred into agrobacterium by heat shock, and is transformed into rice ZH11 by a tissue culture method for overexpression, and the tissue culture is completed by Wuhanbo remote biology Limited. After the transgenic strain is taken, the DNA of the leaf is extracted, the DNA segment near the target sequence is amplified by a PCR method by utilizing sequencing primers M-F (the nucleotide sequence of which is shown as SEQ ID NO: 5) and M-R (the nucleotide sequence of which is shown as SEQ ID NO: 6), and finally, the homozygous mutant is obtained by a sequencing method.

2. Expression pattern of PK1 Gene

The expression part of the gene determines the exertion of the function, in order to research the space-time specificity of the PK1 gene, different tissues of 3-week water culture seedling stage (roots, leaf sheaths and leaves) and field flowering stage (leaves, flag leaves, leaf sheaths, flag leaf sheaths, nodes, internodes and spikelets) are selected, RNA is extracted by adopting a kit of Nanjing NuoZan biotechnology GmbH, and is reversely transcribed into CDNA, through PK1 specific primers RT-PK1-F (the nucleotide sequence of which is shown as SEQ ID NO: 7) and RT-PK1-R (the nucleotide sequence of which is shown as SEQ ID NO: 8), internal reference gene Actin specific primers RT-Actin-F (the nucleotide sequence of which is shown as SEQ ID NO: 9) and RT-Actin-R (the nucleotide sequence of which is shown as SEQ ID NO: 10), qRT-PCR detection shows that PK1 is mainly expressed in leaf tissues of rice (figure 2A). After 3 weeks of water culture of rice, the rice was treated with 0,10 μ M Cd for 3 days, and PK1 was detected to be subjected to Cd-induced expression change in roots, leaf sheaths and leaves, and it was found that PK1 gene was strongly induced by Cd in the leaf sheath tissues (fig. 2B). The gene participates in Cd stress response.

3. Subcellular localization of PK1 Gene to cell Membrane

To clone the full-length CDS sequence of PK1, we designed to synthesize 2 pairs of primers: PK1-1F (the nucleotide sequence of which is shown in SEQ ID NO: 11), PK1-1R (the nucleotide sequence of which is shown in SEQ ID NO: 12), PK1-2F (the nucleotide sequence of which is shown in SEQ ID NO: 13) and PK1-2R (the nucleotide sequence of which is shown in SEQ ID NO: 14) take CDNA of ZH11 as a template, PCR (polymerase with high fidelity) is adopted to amplify a target fragment, the target fragment is recovered by electrophoresis, cut and connected with a vector pBWA (V) HS-GLosgfp. 10ul of ligation products were transformed into E.coli competence, plated on a (kanamycin) resistant plate, incubated at 37 ℃ for 12 hours, and subjected to plaque PCR identification. The target band is about 3031 bp. Taking bacterial liquid corresponding to 1-3 positive bands, taking 100ul of the bacterial liquid, carrying out sample sending and sequencing, inoculating the rest 400ul of the bacterial liquid into LB (kanamycin) with resistance of 5-10ml, shaking the bacteria in a test tube, and taking a tube of extracted plasmids (the plasmid is named as pBWA (V) HS-PK1-GLosgfp) with correct sequencing after a result to be tested comes out. The obtained pBWA (V) HS-PK1-GLosgfp vector is transferred into agrobacterium by heat shock, the tobacco leaf epidermal cell is injected to express PK1 protein instantly, the green fluorescence of the tobacco leaf epidermal cell is observed by a laser confocal microscope after 24 hours in a dark place, and the subcellular localization result of PK1 is obtained and is a cell membrane (figure 3).

4. The cadmium content of overground part and xylem bleeding sap of the pk1 mutant in the seedling stage of rice is obviously increased

After the rice is hydroponically cultured for 3 weeks, 10 mu M Cd is used for treating for 7 days, and the accumulation of heavy metal Cd in overground part and xylem bleeding fluid of the receptor-like protein kinase RLK1 mutant is detected to be remarkably increased (figure 4).

1) Directly collecting the overground part materials of the plants after being washed by Milli-Q water;

2) drying in an oven at 80 ℃ for 24-48 h;

3) weighing 10-20mg of dried plant material, and placing into a 14mLFalcon TM tube;

4) adding 1mL of nitric acid (MOS grade), and slightly shaking to soak all the materials overnight;

5) boiling for 30 minutes at 99 ℃, and repeatedly boiling for 2-3 times according to the actual situation of the material;

6) cooling to room temperature, supplementing Milli-Q water to 14mL, mixing uniformly, sealing, and testing;

7) and (4) measuring the content of the metal elements in the sample by inductively coupled plasma mass spectrometry (ICP-MS, ELAN DRC-e, Perkin-Elmer).

The collecting method of the xylem bleeding sap comprises the following steps: the plants were cut with a sharp blade about 1cm above the rhizome junction. To reduce contamination of damaged cytoplasm, the bleeding fluid was collected from the second drop, and collected for about 30-40min as one repeat for every 5 plants. The humidity in the incubator was maintained at 100% throughout the harvest. Adding 5% HNO into xylem supernatant₃(MOS grade) was diluted to 2ml and the Cd content was measured by ICP.

The results are shown in fig. 4, in which the accumulation of cadmium in the overground and xylem bleeding fluid of rice PK1 mutant 10250 is significantly increased compared to the wild type. Values are mean ± sd of three replicates, P values are statistical test for significance' st-test analysis P <0.05, P < 0.01.

5. The cadmium content of the rice pk1 mutant protoplast is obviously increased

In order to explore specific parts of overground part Cd accumulation, after the rice is subjected to water culture for 3 weeks, 10 mu M Cd is used for treating for 7 days, and protoplasts are obtained and separated, so that the Cd content in the protoplasts of the pk1 mutant is found to be remarkably increased (figure 5). Methods for protoplast extraction are performed with reference to literature (Zhang, y., Su, j., Duan, s., Ao, y., Dai, j., Liu, j., Wang, p., Li, y., Liu, b., Feng, d., Wang, j., & Wang, H. (2011) Ahighly effective rice green tissue protocol system for transformed gene expression and stuck light/chloroplata-related process. plant methods,7(1),30), and the cadmium content is quantified to the total protein content of the protoplasts. Values are mean ± sd of three replicates, P values are statistical test for significance's t-test analysis P <0.05, P < 0.01.

6. Increase of cadmium accumulation of pk1 mutant rice straw and seed in rice maturation period

After rice grows to a Cd-polluted field until seeds are mature, the Cd contents in seeds and straws of ZH11 and pk1 mutants in the rice maturation period are detected, and the Cd contents in the straws and the seeds in the pk1 mutant are found to be remarkably higher than those in a control (figure 6). Therefore, gene resources are provided for breeding rice germplasm with Cd remediation potential on the overground part. The method for detecting Cd is the same as that in the 4 th point. Values are mean ± sd of three replicates, P values are statistical test for significance's t-test analysis P <0.05, P < 0.01.

Example 2:

an application of a gene PK1 for regulating and controlling rice cadmium accumulation or a coded protein thereof in repairing soil cadmium pollution, namely a method for repairing soil cadmium pollution, comprising the following steps:

the method of the embodiment 1 is adopted to cultivate cadmium-polluted restored rice (namely the rice pk1 homozygous mutant of the embodiment 1), the cadmium-polluted restored rice is planted in a polluted rice field with the soil cadmium content of 0.5 mu g/g dry weight, the rice straw suitable for the cadmium-polluted rice field in southern hilly areas, the high-yield field-leaving and harvesting integrated farm machinery is used for harvesting after the rice straw is matured, the soil cadmium content is reduced by 30 percent after the rice straw is planted for 2 years continuously, and the rice soil cadmium content in the rice field is changed into 0.35 mu g/g dry weight, so that the pk1 mutant material has a good restoration effect.

Example 3:

an application of gene PK1 for regulating rice cadmium accumulation or its coded protein in rice yield regulation, nitrogen utilization or genetic improvement of root system configuration comprises the following steps:

the homozygous mutant of rice pk1 was grown by the method of example 1. Researches show that PK1 has significant influence on growth and development of rice, single plant yield and nitrogen utilization efficiency in different growth periods of rice. For example, in the 4-week water planting period, compared with wild type ZH11, the root system configuration of pk1 mutant is significantly changed, and the plant height and the main root length are significantly reduced (fig. 7); total nitrogen content increased, but physiological efficiency of nitrogen utilization decreased (fig. 8). The yield per plant at maturity was significantly lower than wild-type ZH11 (fig. 9). These results indicate that PK1 provides excellent gene resources for rice yield regulation, nitrogen utilization, and genetic improvement of root system configuration. Has great application prospect. Values are mean ± sd of three replicates, P-value is statistical test for significance's t-test analysis of significance P < 0.05.

In conclusion, the invention discloses a gene PK1 for regulating and controlling rice cadmium accumulation, and the nucleotide sequence of the gene is shown as SEQ ID NO: 1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO: 2, positions 1 to 977 as shown in figure 2. The cadmium content of the mutant obtained by the gene in the overground part of the rice seedling stage, protoplast and xylem bleeding sap, and the straw and seed in the maturation stage is higher than that of the control, which shows that the gene PK1 or the coding protein thereof can be used for cultivating crops with the potential of cadmium pollution remediation, and provides excellent gene resources for cultivating the crops with the potential of cadmium pollution remediation by means of biotechnology. Furthermore, the crops with the potential of repairing cadmium pollution can be used for repairing the cadmium pollution of soil after being planted, and the repairing effect is good.

Sequence listing

<110> Hunan university of agriculture

<120> gene PK1 for regulating and controlling rice cadmium accumulation, and protein and application thereof

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2934

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atggtgatca atctctcttc tcctccaatc ttcttgttgt tcttcttgtg gtgtgttgtc 60

gtcttcttcg tggccggcga tggcggcgcg gtggtggcgg aggcggcatt ggatgctcag 120

gcggcgtacc tgtcccagat gaagcaggag ttcgccgggc cggccatggc gaggtgggac 180

ttctcggcgc cggccgtgga ctactgcaag ttccagggtg tcgggtgcga cgcctccggc 240

aacgtgacgg ccatcgacgt cacgtcgtgg aggctgagcg gtaggctccc cggcggcgtg 300

tgcgaggcgc tcccggcgct ccgggaggtc cggctcgggt acaacgacat ccgcggcggg 360

ttccccggcg ggctggtgaa ctgcacgtcg ctggaggtgc tcaacctcag ctgctccggc 420

gtgtcgggcg ccgtgccgga cctgtcgcgg atgccggcgc tgcgggtgct cgacgtgtcc 480

aacaactact tctccggcgc gttcccgacg tcgatcgcca acgtcaccac gctcgaggtg 540

gccaacttca acgagaaccc cgggttcgac atctggtggc cgccggagtc gctgatggcg 600

ctgcggcgcc tccgcgtgct catcctgtcg acgacgtgca tgcacggcgg cgtcccggcg 660

tggctcggga acatgacgtc gctcaccgac ctggaactca gcggcaacct cctcaccggc 720

cacatcccgc tgtcgctggc gcgcctccca aacctgcagc tgctcgagct ctactacaac 780

ctgcttgagg gcgtcgtccc cgccgagctc ggcaacctca cgcagctcac cgacatcgac 840

ctctccgaga acaacctcac cggcggcatc ccggagtcca tctgcgcgct gcctcgcctc 900

cgcgtgctcc agatgtacac caacaagctc accggcgcca tcccggccgt gctcggcaac 960

tccacgcagc tccgcatcct gtccgtctac cgcaaccagc tcaccggcga gctccccgcc 1020

gacctcggcc gctactccgg cttcaacgtg ctggaggtgt cggagaacca gctcaccggc 1080

ccgctgccgc cgtacgcctg cgccaacggc cagctccagt acatcctcgt gctcagcaac 1140

ctcctcaccg gcgccatccc ggcgtcgtac gccgcgtgcc ggccgctgct ccgcttccgc 1200

gtcagcaaca accacctcga cggcgacgtc cccgcgggca tcttcgcgct cccgcacgcc 1260

tccatcatcg acctctccta caaccacctc accgggccag tgccggccac catcgccggc 1320

gccaccaacc tgacgtcgct gttcgcgtcg aacaaccgca tgtcgggggt cctgccgccg 1380

gagatcgccg gcgcggcgac gctggtcaag atcgacctga gcaacaacca gatcggcggg 1440

gcgatcccgg aggcggtggg gcggctgagc cggctgaacc agctgtcgct gcagggcaac 1500

cggctgaacg gctccatccc ggcgacgctc gccgacctcc acagcctgaa cgtgctgaac 1560

ctgtcgtaca atgcgctcgc cggcgagatc ccggaggcgc tgtgcacgct gctgcccaac 1620

tcgctggact tctccaacaa caacctgtcc gggccggtgc cgctgcagct gatcagggag 1680

gggctcctgg agagcgtcgc cggcaacccg gggctgtgcg tggcgttccg gctgaacctc 1740

accgacccgg cgctgccgct gtgccccaag ccggcgaggc tgcggatgcg ggggctcgcc 1800

gggagcgtgt gggtggtggc ggtgtgcgcg ctggtgtgcg tggtggcgac gctggcgctg 1860

gcgaggcggt gggtgctgcg ggcgcggcag gacggggagc acgacgggct cccgacgtcg 1920

ccggcgtcga gctcgtcgta cgacgtgacg agcttccaca agctgagctt cgaccagcac 1980

gagatcgtgg aggcgctgat cgacaagaac atcgtcggcc acggcggctc cggcacggtg 2040

tacaagatcg agctgagcaa cggcgagctg gtcgccgtga agaagctgtg ggtgtcgcgg 2100

cggtccaagc aggagcacgg ccatggcggc ggcggggggt gcctcgaccg cgagctgcgg 2160

acggaggtgg agacgctggg cagcatccgg cacaagaaca tcgtgaagct ctactgctgc 2220

tactccggcg ccgacagcaa cctgctggtg tacgagtaca tgcccaacgg caacctatgg 2280

gacgcgctcc acggcggcgg cgggtggggc ttcggcttcc tggactggcc gacgcgccac 2340

cgcgtcgcgc tcggcgtcgc ccagggcctc gcctacctcc accacgacct cctcttcccc 2400

atcgtccacc gcgacatcaa gtcctccaac atcctcctcg acgccgactt cgagcccaag 2460

gtcgccgact tcggcatcgc caaggtcctc caggcccgcg gcgatcgcga cgcctccacc 2520

accaccatcg ccggcaccta cggctacctc gctccagagt acgcctactc gtcaaaggcg 2580

acgacaaagt gcgacgtgta cagcttcggg gtggtgctaa tggagctggc gacggggaag 2640

aagccgatcg agccggagtt cggcgacacg agggacatcg tgcagtgggt ctccggcaag 2700

gtggccgccg gcggcgaggg cgaggcgctg gacaagcggc tcgagtggag ccccttcaag 2760

gaggagatgg tgcaggctct ccgcgtcgcc gtccgctgca cctgcagcat ccccggcctc 2820

cgccccacca tggccgacgt cgtgcagatg ctcgccgagg ccggccccgc cgccggccgg 2880

accgccaagg acgccgccaa caagaaggac tcctccggcg agccaaagct gtaa 2934

<210> 2

<211> 977

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Val Ile Asn Leu Ser Ser Pro Pro Ile Phe Leu Leu Phe Phe Leu

1 5 10 15

Trp Cys Val Val Val Phe Phe Val Ala Gly Asp Gly Gly Ala Val Val

20 25 30

Ala Glu Ala Ala Leu Asp Ala Gln Ala Ala Tyr Leu Ser Gln Met Lys

35 40 45

Gln Glu Phe Ala Gly Pro Ala Met Ala Arg Trp Asp Phe Ser Ala Pro

50 55 60

Ala Val Asp Tyr Cys Lys Phe Gln Gly Val Gly Cys Asp Ala Ser Gly

65 70 75 80

Asn Val Thr Ala Ile Asp Val Thr Ser Trp Arg Leu Ser Gly Arg Leu

85 90 95

Pro Gly Gly Val Cys Glu Ala Leu Pro Ala Leu Arg Glu Val Arg Leu

100 105 110

Gly Tyr Asn Asp Ile Arg Gly Gly Phe Pro Gly Gly Leu Val Asn Cys

115 120 125

Thr Ser Leu Glu Val Leu Asn Leu Ser Cys Ser Gly Val Ser Gly Ala

130 135 140

Val Pro Asp Leu Ser Arg Met Pro Ala Leu Arg Val Leu Asp Val Ser

145 150 155 160

Asn Asn Tyr Phe Ser Gly Ala Phe Pro Thr Ser Ile Ala Asn Val Thr

165 170 175

Thr Leu Glu Val Ala Asn Phe Asn Glu Asn Pro Gly Phe Asp Ile Trp

180 185 190

Trp Pro Pro Glu Ser Leu Met Ala Leu Arg Arg Leu Arg Val Leu Ile

195 200 205

Leu Ser Thr Thr Cys Met His Gly Gly Val Pro Ala Trp Leu Gly Asn

210 215 220

Met Thr Ser Leu Thr Asp Leu Glu Leu Ser Gly Asn Leu Leu Thr Gly

225 230 235 240

His Ile Pro Leu Ser Leu Ala Arg Leu Pro Asn Leu Gln Leu Leu Glu

245 250 255

Leu Tyr Tyr Asn Leu Leu Glu Gly Val Val Pro Ala Glu Leu Gly Asn

260 265 270

Leu Thr Gln Leu Thr Asp Ile Asp Leu Ser Glu Asn Asn Leu Thr Gly

275 280 285

Gly Ile Pro Glu Ser Ile Cys Ala Leu Pro Arg Leu Arg Val Leu Gln

290 295 300

Met Tyr Thr Asn Lys Leu Thr Gly Ala Ile Pro Ala Val Leu Gly Asn

305 310 315 320

Ser Thr Gln Leu Arg Ile Leu Ser Val Tyr Arg Asn Gln Leu Thr Gly

325 330 335

Glu Leu Pro Ala Asp Leu Gly Arg Tyr Ser Gly Phe Asn Val Leu Glu

340 345 350

Val Ser Glu Asn Gln Leu Thr Gly Pro Leu Pro Pro Tyr Ala Cys Ala

355 360 365

Asn Gly Gln Leu Gln Tyr Ile Leu Val Leu Ser Asn Leu Leu Thr Gly

370 375 380

Ala Ile Pro Ala Ser Tyr Ala Ala Cys Arg Pro Leu Leu Arg Phe Arg

385 390 395 400

Val Ser Asn Asn His Leu Asp Gly Asp Val Pro Ala Gly Ile Phe Ala

405 410 415

Leu Pro His Ala Ser Ile Ile Asp Leu Ser Tyr Asn His Leu Thr Gly

420 425 430

Pro Val Pro Ala Thr Ile Ala Gly Ala Thr Asn Leu Thr Ser Leu Phe

435 440 445

Ala Ser Asn Asn Arg Met Ser Gly Val Leu Pro Pro Glu Ile Ala Gly

450 455 460

Ala Ala Thr Leu Val Lys Ile Asp Leu Ser Asn Asn Gln Ile Gly Gly

465 470 475 480

Ala Ile Pro Glu Ala Val Gly Arg Leu Ser Arg Leu Asn Gln Leu Ser

485 490 495

Leu Gln Gly Asn Arg Leu Asn Gly Ser Ile Pro Ala Thr Leu Ala Asp

500 505 510

Leu His Ser Leu Asn Val Leu Asn Leu Ser Tyr Asn Ala Leu Ala Gly

515 520 525

Glu Ile Pro Glu Ala Leu Cys Thr Leu Leu Pro Asn Ser Leu Asp Phe

530 535 540

Ser Asn Asn Asn Leu Ser Gly Pro Val Pro Leu Gln Leu Ile Arg Glu

545 550 555 560

Gly Leu Leu Glu Ser Val Ala Gly Asn Pro Gly Leu Cys Val Ala Phe

565 570 575

Arg Leu Asn Leu Thr Asp Pro Ala Leu Pro Leu Cys Pro Lys Pro Ala

580 585 590

Arg Leu Arg Met Arg Gly Leu Ala Gly Ser Val Trp Val Val Ala Val

595 600 605

Cys Ala Leu Val Cys Val Val Ala Thr Leu Ala Leu Ala Arg Arg Trp

610 615 620

Val Leu Arg Ala Arg Gln Asp Gly Glu His Asp Gly Leu Pro Thr Ser

625 630 635 640

Pro Ala Ser Ser Ser Ser Tyr Asp Val Thr Ser Phe His Lys Leu Ser

645 650 655

Phe Asp Gln His Glu Ile Val Glu Ala Leu Ile Asp Lys Asn Ile Val

660 665 670

Gly His Gly Gly Ser Gly Thr Val Tyr Lys Ile Glu Leu Ser Asn Gly

675 680 685

Glu Leu Val Ala Val Lys Lys Leu Trp Val Ser Arg Arg Ser Lys Gln

690 695 700

Glu His Gly His Gly Gly Gly Gly Gly Cys Leu Asp Arg Glu Leu Arg

705 710 715 720

Thr Glu Val Glu Thr Leu Gly Ser Ile Arg His Lys Asn Ile Val Lys

725 730 735

Leu Tyr Cys Cys Tyr Ser Gly Ala Asp Ser Asn Leu Leu Val Tyr Glu

740 745 750

Tyr Met Pro Asn Gly Asn Leu Trp Asp Ala Leu His Gly Gly Gly Gly

755 760 765

Trp Gly Phe Gly Phe Leu Asp Trp Pro Thr Arg His Arg Val Ala Leu

770 775 780

Gly Val Ala Gln Gly Leu Ala Tyr Leu His His Asp Leu Leu Phe Pro

785 790 795 800

Ile Val His Arg Asp Ile Lys Ser Ser Asn Ile Leu Leu Asp Ala Asp

805 810 815

Phe Glu Pro Lys Val Ala Asp Phe Gly Ile Ala Lys Val Leu Gln Ala

820 825 830

Arg Gly Asp Arg Asp Ala Ser Thr Thr Thr Ile Ala Gly Thr Tyr Gly

835 840 845

Tyr Leu Ala Pro Glu Tyr Ala Tyr Ser Ser Lys Ala Thr Thr Lys Cys

850 855 860

Asp Val Tyr Ser Phe Gly Val Val Leu Met Glu Leu Ala Thr Gly Lys

865 870 875 880

Lys Pro Ile Glu Pro Glu Phe Gly Asp Thr Arg Asp Ile Val Gln Trp

885 890 895

Val Ser Gly Lys Val Ala Ala Gly Gly Glu Gly Glu Ala Leu Asp Lys

900 905 910

Arg Leu Glu Trp Ser Pro Phe Lys Glu Glu Met Val Gln Ala Leu Arg

915 920 925

Val Ala Val Arg Cys Thr Cys Ser Ile Pro Gly Leu Arg Pro Thr Met

930 935 940

Ala Asp Val Val Gln Met Leu Ala Glu Ala Gly Pro Ala Ala Gly Arg

945 950 955 960

Thr Ala Lys Asp Ala Ala Asn Lys Lys Asp Ser Ser Gly Glu Pro Lys

965 970 975

Leu

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ggtggtggcg gaggcggcat 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgccgcctc cgccaccacc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agccaccatc tgatctgtgc 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cggatgtcgt tgtacccgag 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cctgagcaac aaccagatcg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cggacaggtt gttgttggag 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tccatcttgg catctctcag 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtacccgcat caggcatctg 20

<210> 11

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cagtggtctc acaacatggt gatcaatctc tcttc 35

<210> 12

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgatggtctc aacccactgc acgatgtccc t 31

<210> 13

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cagtggtctc agggtctccg gcaaggtggc cgccg 35

<210> 14

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

cagtggtctc atacacagct ttggctcgcc ggagg 35

Claims (10)

1. A gene PK1 for regulating and controlling rice cadmium accumulation is characterized in that the nucleotide sequence is shown as SEQ ID NO: 1 is shown.

2. The protein encoded by the gene PK1 for regulating rice cadmium accumulation according to claim 1, wherein the amino acid sequence of the protein is shown as SEQ ID NO: 2, respectively.

3. The use of the gene PK1 for regulating and controlling the cadmium accumulation of rice according to claim 1 or the protein according to claim 2 in cultivating crops for repairing cadmium pollution.

4. The use of claim 3, wherein the cadmium pollution remediating crop species comprise any one or more of rice, tobacco, corn, and wheat.

5. The use according to claim 3 or 4, characterized in that it is applied in a method comprising the following steps: the gene PK1 is cloned into a target vector, then is transferred into agrobacterium by a heat shock method, and is transformed into crops by a tissue culture method for overexpression to obtain a homozygous mutant, namely the cadmium-polluted remediation crops.

6. The use of claim 5, wherein the target sgR-PK1 used for cloning the gene PK1 into a target vector comprises a forward primer and a reverse primer, and the nucleotide sequence of the forward primer is shown as SEQ ID NO: 3, the nucleotide sequence of the reverse primer is shown as SEQ ID NO: 4, respectively.

7. The application of the gene PK1 for regulating and controlling rice cadmium accumulation according to claim 1 or the protein according to claim 2 in repairing soil cadmium pollution.

8. The use according to claim 7, characterized in that it is applied in a method comprising the following steps: the gene PK1 is cloned into a target vector, then is transferred into agrobacterium by a heat shock method, is transformed into crops by a tissue culture method for overexpression to obtain homozygous mutant crops, and the homozygous mutant crops are planted in a field with cadmium-polluted soil and can realize the remediation of the cadmium-polluted soil after being continuously planted for years.

9. Use of the gene PK1 regulating rice cadmium accumulation according to claim 1 or the protein according to claim 2 for regulating rice yield, nitrogen utilization or genetic improvement of root system configuration.

10. Use according to claim 9, characterized in that it is applied in a method comprising the following steps: the gene PK1 is cloned into a target vector, then is transferred into agrobacterium by a heat shock method, and is transformed into rice by a tissue culture method for overexpression to obtain a rice homozygous mutant.

Images