CN102417899A - Metallic cadmium resistance associated protein KdpD and coding gene and application thereof - Google Patents

Abstract

The invention discloses a metallic cadmium resistance associated protein KdpD and a coding gene and application thereof. The amino acid sequence of the metallic cadmium resistance associated protein KdpD is shown as SEQ ID NO: 1; and the coding gene of the metallic cadmium resistance associated protein KdpD is shown as SEQ ID NO: 2. Escherichia coli transformation experiments prove that the expression of the gene in escherichia coli can improve the resistance of the gene to heavy metallic cadmium. The KdpD coding gene can be used for improving the heavy metallic cadmium resistance of microbes and plants, is further used for clearing heavy metal pollution in the environment, and provides a biological resource with excellent performance for biological repair.

Description

A kind of cadmium metal resistance-associated protein KdpD and encoding sox and application

Technical field

The present invention relates to gene engineering technology field, be specifically related to a kind of cadmium metal resistance-associated protein KdpD and encoding sox and application.

Background technology

Along with development and use, the industrial development of Mineral resources, the heavy metal pollution on the environment is on the rise, and heavy metal pollution of soil has become the problem of a harm global environment quality.Heavy metal-polluted soil can influence growth and development of plant, reduces output and the quality of farm crop, has brought serious economy loss to agriculture prodn.In addition, in plant materials, accumulated by the crop of heavy metal pollution of soil, and pass through the food chain enrichment in human body and animal body, harm human and livestock health, cause cancer and other diseases etc.Improvement heavy metal contamination is very urgent, during various recovery techniques and measure are being studied and used.National governments and scientist put forth effort to address this problem through two approach: one for utilizing heavy metal contamination physics, that chemical method attempts to remove soil or water body: two for utilizing modern biotechnology to remove pollution.Since the eighties in 20th century, processing costs is low, little to environmental influence, the efficient advantages of higher because of it has for bioremediation technology, more and more receives numerous scientific and technical personnel's extensive concern.Biological prosthetic generally is divided into phytoremediation, animal is repaired and mikrobe is repaired three types, and wherein the reparation of phytoremediation and mikrobe is the focus of research.It is exactly to utilize mikrobe with the contaminant degradation in the environment or be converted into the process of other innoxious substances that mikrobe is repaired.In recent years, based on the mechanism of action of mikrobe to heavy metal, the economic worth heavy metal is arranged is that the biologic treating technique of purpose reaches its maturity to repair poisonous and harmful metallic pollution or recovery.Phytoremediation refers to utilize plant to go to administer the technology of the pollution in the media such as water body, soil and bed mud.Yet the biology that is used for the heavy metal contamination reparation tends to receive the murder by poisoning of heavy metal, and poor growth, living weight are little, even can not survive, so the toxic action of heavy metal on plants and mikrobe is the key constraints of biological prosthetic.

Heavy metal is to study the The Molecular Biology Mechanism of tolerance heavy metal in the solution biological prosthetic to the fundamental way of the toxic action of biology; The clone obtains to be used for the transgenic engineering biology of biological prosthetic excellent property to the key gene of heavy metal tolerance through genetic engineering means.

Owing to technical reason, up to date, but the utilization of microbial gene resource mainly is confined to culturing micro-organisms.Yet, culturing micro-organisms only account for the occurring in nature mikrobe less than 1%, therefore the grand genome of mikrobe in the various habitats is a huge and genetic resources storehouse that do not excavate.Extreme environment has abundant Microbial resources, in the middle of many genes relevant with crucial vital process with adverse circumstance in secular adaptive evolution, obtained stronger patience potential, excavating these resistant genes has become international important research focus.Acidic mine waste water (AMD) is the important system of extreme habitat microbiological research.AMD derives from mining activity and makes and contain sulfur mineral and (be mainly pyrite, FeS ₂) be exposed in the sky G&W, rapid oxidation is produced due to the acid under the microorganism catalysis effect, and its pH value and is rich in vitriol and heavy metals such as Pb, Zn, Cu, Cd and Ni generally about 1 ~ 4, is one of serious environmental problems of facing of mining industry.The prokaryotic micro-organisms of in AMD, surviving has formed some unique mechanism gradually in the evolution of long period of time process, compel to tackle multiple extreme environment such as low pH value, high salinity and high heavy metal association.Therefore, the AMD habitat becomes the adversity gene storehouse that has characteristic and enrich.

K ⁺For the stable state of cell and keeping of internal pH, the activation of various enzymes, the stress response under expression of gene and various the coercing plays important effect.Have three K in the intestinal bacteria at least ⁺Absorption system, wherein KdpFABC is the affine K of derivable height ⁺Absorption system can't satisfy cell to K at other translocator ⁺Absorption of K during demand ⁺KdpD comprises two and regulates albumen---and film is integrated histidine kinase KdpD and tenuigenin response regulation albumen KdpE.

Histidine kinase KdpD is known K in the tenuigenin ⁺Concentration, ionic strength, different chemical signals such as ATP content, the ratio of regulating kinases and phosphatase activity.In case activate, KdpD then converts "open" state to, it is characterized in that the very high kinases and the ratio of Phosphoric acid esterase.In the of short duration switching process of " pass " and " opening ", relate to the variation of electrostatic interaction.KdpD is a protein dimerization, in the process of conversion, self phosphorylation takes place.Supposition is in this process, and some moves and separates the structural domain of tenuigenin end a little.Therefore, the N-end structure territory in the tenuigenin becomes can be approaching, and the contact that can stablize phosphorylation KdpE and DNA.Simultaneously, KdpD passes to KdpE generation dimerization with phosphoryl group.

On cytoplasmic membrane, KdpD is made up of four membrane spaning domains of fixed, also has a pair of bigger N-and C-end structure territory simultaneously.On C-terminal; Very conservative histidine kinase structural domain HATPase_c and HisKA are arranged; The latter has comprised autophosphorylation site His673, and it is indispensable for autophosphorylation and phosphatic transhipment. and HATPase_c is as the ATP binding domains.Research shows, is a dipolymer at least when KdpD is in functional status: a subunit combines ATP on the HATPase_c structural domain, and another subunit on the HisKA structural domain phosphorylation takes place.

People such as Jung find cell K ⁺Concentration and ionic strength are regulated the autophosphorylation activity of KdpD, wherein cell K ⁺Concentration suppresses the KdpD autophosphorylation, and ionic strength activates the KdpD autophosphorylation.People such as Weber discovered at low K in 2009 ⁺KdpD/KdpE induces kdpFABC to express kdp system absorption of K outside born of the same parents under concentration and the salt stress ⁺Improve K in the cell ⁺Concentration.

Yet in mikrobe, what effect to be the heavy metal cadmium resistance played actually still unclear for the KdpD gene up to now, also from the AMD mikrobe, is not cloned into the report of KdpD gene.

(M O Walderhaug et al. KdpD and KdpE; Proteins that control expression of the kdpABC operon; Are members of the two-component sensor-effector class of regulators, J Bacteriol. 1992 April; 174 (7): 2152-2159) disclose encoding sequence and the aminoacid sequence of controlling kdpABC genetically manipulated expressed proteins KdpD of unit and KdpE.

Summary of the invention

The objective of the invention is to provides a kind of cadmium resistance-associated protein KdpD to above-mentioned deficiency of the prior art, i.e. histidine kinase KdpD albumen (being called for short DbsATPase), this proteic gene order of encoding, and the application of this albumen and gene.

The present invention realizes above-mentioned several purpose through following technical scheme:

A kind of cadmium metal resistance-associated protein KdpD, its aminoacid sequence is shown in SEQ ID NO:1.

The biotechnological formulation that contains above-mentioned cadmium metal resistance-associated protein KdpD.The application of above-mentioned cadmium metal resistance-associated protein KdpD in administering Environmental Cadmium Pollution.

The encoding sox of cadmium metal resistance-associated protein KdpD is characterized in that nucleotide sequence is shown in SEQ ID NO:2.

The application of the encoding sox of above-mentioned cadmium metal resistance-associated protein KdpD in administering Environmental Cadmium Pollution, as can be used for preparing the transgenic plant that can administer cadmium pollution etc.

The expression vector of a kind of cadmium metal resistance-associated protein KdpD, this carrier contain the encoding sox of above-mentioned cadmium metal resistance-associated protein KdpD.The said expression vector carrier that preferably sets out is pET28a, promptly inserts the coding gene sequence of KdpD among the carrier pET28a.

A kind of genetic engineering bacterium contains above-mentioned expression vector, is specifically obtained by this expression vector transfection Escherichia coli.The application of this genetic engineering bacterium in administering Environmental Cadmium Pollution is as being used for preparing the transgenic plant with cadmium ion resistance or directly rendering to Environmental Cadmium Pollution.Especially best for the environmental improvement effect of concentration of cadmium ions below 200 μ M.

The present invention has following beneficial effect:

The present invention discloses a kind of new heavy metal cadmium resistance-associated protein DbsATPase and encoding sox thereof first; Find that this albumen all has good resistance for the cadmium ion of 0 ~ 200 μ M concentration, aspect the resistance of heavy metal cadmium, have major application to be worth in raising mikrobe and plant.

Description of drawings

Phase when Fig. 1 is the expression of DbsATPase in intestinal bacteria; M is the molecular weight of albumen standard; 1 is the electrophoresis result of carrying BL21 (DE3) bacterial strain of empty carrier pET28a, and 2 ~ 9 for carrying the electrophoresis result of BL21 (DE3) bacterial strain inducing expression after 0 ~ 7 hour of pET28a-DbsATPase.

Intestinal bacteria the growing state different cadmium concentrations under cultivate 12 hour after of Fig. 2 for expressing DbsATPase.

Fig. 3 is for expressing the growth curve of intestinal bacteria under 150 μ M cadmiums are coerced of DbsATPase.

Embodiment

Except that specified otherwise is arranged, be this area common experimental reagent and laboratory facilities in following examples.

The clone of embodiment 1 DbsATPase gene complete sequence

1. open-air microbiological specimens collection

Lead/zinc ore is chosen the acidic mine waste water (AMD) of different souring stages (pH is 2,4,6) in the Yunfu, Guangdong, uses the filter membrane of 0.22 μ m to collect the cell of 20L AMD the inside.In order to keep the integrity of nucleic acid, preserve sample and freeze in liquid nitrogen, take back the laboratory in 24 hours, and be put in-70 ℃ of refrigerator prolonged preservation.

2. the extraction of nucleic acid

DNA extraction adopts the EST method, and process is following: in SET buffer, add N,O-Diacetylmuramidase and Proteinase K, digest 30 min after; 15, behind centrifugal 15 min of 000rpm with chloroform extracting 2 times, after spending the night with isopropanol precipitating; 75 % ethanol clean 2 times, are dissolved in the aqua sterilisa at last.Reclaim genomic dna with Qiagen tip-100 column purification, detect DNA quality and concentration with the nucleic acid-protein analyser.

3. gene order-checking

With press proof article in the GS FLX Titanium General Library Preparation Kit preparation of Roche company.Use Roche 454 Genome Seqencer FLX sequenators,, obtain base sequence with Pyrobayer software through checking order.

4. genome sequence analysis

After removing low-quality sequencing result, genome is analyzed as follows:

Sequence assembly: use the GS De Novo Assembler Software of Euler-SR and 454 Corp. to carry out sequence assembly.Effect with the splicing of N50 index assessment.

Genome annotation: the whole genome sequence that will splice good mikrobe carries out genomic note with IMG and SEED system, finds new gene.

5. the clone of DbsATPase gene fragment

Through PCR method, be template with the DNA that from AMD, extracts, also splice the gene order that obtains according to gene order-checking and design a pair of primer:

DBS159-F: ATGGGCTATCCCATTCCCAAT（SEQ ID NO:3）

DBS159-R: TCATGTGTCAAGTTCCTGTGG（SEQ ID NO:4）

PCR obtains the band of a 3kb size, and is cloned in PCR2.1 (available from the invitrogen company) carrier, gets the PCR2.1-DbsATPase carrier, and sequence entrusts invitrogen company to measure.

6. DbsATPase gene sequencing

Sequencing result shows that DbsATPase gene size is 2736bp (SEQ ID NO:2), 897 amino acid (SEQ ID NO:1) of encoding.

The functional analysis of embodiment 2 DbsATPase genes

Utilize the intestinal bacteria transformation experiment to analyze the function of DbsATPase gene in the present embodiment.

1. structure recombinant expression vector

A pair of primer below the design is introduced at the DbsATPase gene 5 ' EcoThe RI restriction enzyme site, 3 ' introduces XhoThe I restriction enzyme site.

DbsATPase -F: 5’ CCGGAATTCATGGGCTATCCCATTCCCAATG3’（SEQ ID NO:5）；

DbsATPase -R: 5’CCGCTCGAGTGATCCCTGCATCAACCATTGT3’ （SEQ ID NO:6）。

With the PCR2.1-DbsATPase carrier is that template is carried out PCR.Respectively PCR product and yeast shuttle expression carrier pET28a are used EcoRI with XhoI carries out enzyme and cuts, and enzyme is cut product reclaim, connect and transformed into escherichia coli DH5 α.Cut evaluation through order-checking and enzyme, obtained pET28a-DbsATPase recon.

(1) protein expression

With recon pET28a-DbsATPase transformed into escherichia coli expression strain BL21 (DE3), through PCR checking screening positive clone.The thalline list spot that picking contains recombinant plasmid 37 ℃ of incubated overnight to the 10ml LB (containing Kan 50 μ g/ml).1ml bacterium liquid joined contain 100ml LB substratum (containing Kan 50 μ g/ml), 37 ℃ of concussions are cultured to OD600 and are about 0.4 ~ 1.0 (best 0.6, approximately need 2hr).

Adding IPTG was that 1mM induces to final concentration, whenever collected 1ml bacterium liquid at a distance from 1 hour, and centrifugal 12000g * 60s gathers in the crops deposition, with 80 μ l ddH ₂O is resuspended, adds 20 μ l, 5 * SDS-PAGE sample-loading buffer, mixing, boiling water bath 10min.Get supernatant and do SDS-PAGE analysis (seeing accompanying drawing 1) as sample.

(2) transformant is to the mensuration of heavy metal cadmium resistance

The thalline list spot that picking contains recombinant plasmid 37 ℃ of incubated overnight to the 10ml LB (containing Kan 50 μ g/ml).100 μ l bacterium are joined 10ml Cd ²⁺Concentration is respectively in the LB substratum (containing Kan 50 μ g/ml, IPTG 1mM) of 0 μ M, 50 μ M, 100 μ M, 150 μ M, 200 μ M, and 37 ℃, 200rpm concussion were cultivated 12 hours, measured the OD600 value respectively.

According to experimental result, choose Cd ²⁺Concentration be 150 μ M as stress conditions, carried out the mensuration of growth curve.The thalline list spot that picking contains recombinant plasmid 37 ℃ of incubated overnight to the 10ml LB (containing Kan 50 μ g/ml).100 μ l bacterium are joined 10ml Cd ²⁺Concentration is in the LB substratum (containing Kan 50 μ g/ml, IPTG1mM) of 150 μ M, and 37 ℃, 200rpm shake cultivation, and is every at a distance from 2 hours mensuration OD600 values.

Experimental result shows that the BL21 (DE3) that expresses the DbsATPase gene is at 0 ~ 200 μ M Cd ²⁺Can normal growth under the concentration, and empty carrier is to impinging upon Cd ²⁺When surpassing 150 μ M, concentration just can not grow (seeing accompanying drawing 2).At 150 μ MCd ²⁺Under the concentration, the BL21 (DE3) that expresses the DbsATPase gene can grow in culturing process, and the growth of empty carrier contrast is suppressed (seeing accompanying drawing 3) always.The experimental result explanation, DbsATPase plays an important role to the defence of heavy metal cadmium.

SEQUENCE LISTING

< 110>Zhongshan University

< 120>a kind of cadmium metal resistance-associated protein KdpD and encoding sox and application

<130>

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 911

<212> PRT

< 213>artificial sequence

<400> 1

Met Gly Tyr Pro Ile Pro Asn Glu His Thr Gly Trp Lys Pro Cys Thr

1 5 10 15

Met Met Asp Lys Pro Arg Pro Asp Pro Asp Thr Leu Leu Glu Gln Ile

20 25 30

Gln Ala Glu Asp Ala Arg Ala Lys Arg Gly Lys Leu Lys Val Phe Phe

35 40 45

Gly Ala Cys Ala Gly Val Gly Lys Thr Tyr Ala Met Leu Ser Ala Ala

50 55 60

His Gln Leu Arg Ser Gln Gly Met Asp Val Val Val Gly Ile Val Glu

65 70 75 80

Thr His Gly Arg Ala Glu Thr Leu Ala Leu Leu Asn Asn Leu Glu Val

85 90 95

Leu Pro Leu Arg Glu Val Gln His Asn His Arg Pro Leu Lys Glu Phe

100 105 110

Asp Leu Glu Gly Ala Leu Arg Arg His Pro Thr Leu Ile Leu Val Asp

115 120 125

Glu Leu Ala His Thr Asn Ala Gln Ser Cys Arg His Thr Lys Arg Trp

130 135 140

Gln Asp Val Glu Glu Leu Leu Ala Ser Gly Ile Asp Val Phe Thr Thr

145 150 155 160

Val Asn Val Gln His Leu Glu Ser Leu Asn Asp Val Val Gly Gly Ile

165 170 175

Thr Gly Val Arg Val Trp Glu Thr Val Pro Asp His Val Phe Asp Glu

180 185 190

Ala Asn Glu Val Met Leu Val Asp Leu Pro Pro Glu Glu Leu Leu Gln

195 200 205

Arg Leu Lys Glu Gly Lys Ile Tyr Leu Pro His Gln Ala Glu Arg Ala

210 215 220

Ile Arg Asn Phe Phe Arg Lys Gly Asn Leu Ile Ala Leu Arg Glu Leu

225 230 235 240

Ser Leu Arg Arg Thr Ala Asp Arg Val Asp Gly Asp Met Leu Ala Tyr

245 250 255

Arg Arg Thr Lys Ala Val Gln Thr Val Trp Gln Thr Arg Glu Ser Leu

260 265 270

Leu Val Cys Val Gly Pro Gly Pro Gly Ser Glu Arg Val Val Arg Ser

275 280 285

Ala Ala Arg Leu Ala Thr Gln Ile Asp Gly Arg Trp His Ala Ile Tyr

290 295 300

Val Glu Thr Pro Arg Leu Gln Arg Leu Pro Arg Ala Ala Arg Glu Arg

305 310 315 320

Ile Leu Gln Thr Leu Asn Leu Ala Lys Glu Leu Gly Ala Glu Thr Ala

325 330 335

Thr Leu Pro Ala Glu Asp Ala Thr Ala Val Thr Val Ala Tyr Ala Arg

340 345 350

Glu His Asn Leu Thr Lys Val Val Ile Gly Arg Asp His Asp Asn Pro

355 360 365

Leu Trp Arg His Ser Phe Ala Glu Arg Ile Gly Arg Met Ala Ser Asp

370 375 380

Leu Asp Val Ile Gln Val Ala Arg Asn Pro His His Thr Val Pro Lys

385 390 395 400

Glu Lys Thr Ser Thr Leu Leu Phe Ser Glu Asp Ile Pro Leu Trp Pro

405 410 415

Ala Tyr Gly Lys Ser Val Gly Leu Cys Ile Ala Val Thr Leu Leu Ala

420 425 430

Thr Pro Leu Arg His Trp Leu Glu Leu Thr Asn Ile Val Met Ile Phe

435 440 445

Leu Leu Ala Val Ile Gly Val Ala Leu Arg Leu Gly Arg Gly Pro Ala

450 455 460

Val Leu Ala Ser Phe Leu Ser Val Val Phe Phe Asp Phe Phe Phe Val

465 470 475 480

Pro Pro Arg Phe Ser Phe Ala Val Ser Asp Val Gln Tyr Leu Leu Thr

485 490 495

Phe Gly Val Met Leu Thr Val Ala Leu Val Ile Ala Gln Leu Met Ala

500 505 510

Asn Leu Arg Tyr Gln Ala Arg Val Ala Met Asn Arg Glu Ser Arg Ala

515 520 525

Leu Ala Leu Tyr Glu Ala Ala Arg Asp Leu Ser Gly Thr Leu Gln Pro

530 535 540

Lys Gln Ile Ala Glu Val Cys Asp Arg Phe Ala Asn His Val Leu Gly

545 550 555 560

Ala Lys Ile Gly Leu Leu Leu Met Gly Gly Asn Gly Asn Leu Gln Glu

565 570 575

Pro Ile Asp Leu Asp Gly Thr Leu Thr Asp Val Asp Thr Gly Ile Ala

580 585 590

Gln Trp Ser Phe Asp His Gly Glu Val Ala Gly Leu Gly Thr Gln Thr

595 600 605

Leu Ala Ala Ser Pro Ile Phe Tyr Leu Pro Leu Lys Ala Pro Met Arg

610 615 620

Ile Arg Gly Val Leu Ala Ile Glu Pro Arg His Gly His Trp Leu Gln

625 630 635 640

Ile Pro Glu Gln Arg Arg Leu Leu Asp Thr Phe Ala Ser Leu Val Ala

645 650 655

Ile Ala Ile Glu Arg Ile His Tyr Val Glu Val Ala His Glu Ala Leu

660 665 670

Ile Lys Met Glu Ser Glu Arg Leu Arg Asn Ser Val Leu Ser Val Leu

675 680 685

Ser His Asp Leu Arg Thr Pro Leu Thr Ala Leu Val Gly Leu Ser Asp

690 695 700

Thr Leu Ser Leu Glu Pro Leu Pro Asp His Gln Leu Glu Ala Val Gln

705 710 715 720

Ala Ile His Asp Glu Ala Val Arg Met Gly Ser Leu Val Asn Asn Leu

725 730 735

Leu Asp Met Ala Arg Leu Gln Ser Gly Gln Val Thr Leu Lys Arg Glu

740 745 750

Trp Gln Pro Val Glu Glu Val Ile Gly Ser Ala Leu Lys Ala Ser Thr

755 760 765

Arg Ala Leu Ala Asp Arg Thr Val His Ile Asp Met Lys Pro Glu Leu

770 775 780

Pro Phe Val Glu Phe Asp Ala Val Leu Ile Glu Arg Val Leu Arg Asn

785 790 795 800

Leu Leu Glu Asn Ala Gly Lys Tyr Thr Asn Pro Gly Asn Asn Ile Ile

805 810 815

Ile Gln Ala Gln Arg Ile Lys Glu Ser Ile Gln Ile Ser Val Ser Asp

820 825 830

Asp Gly Pro Gly Phe Ser Ala Gly Ser Glu Glu Ser Val Phe Asp Lys

835 840 845

Phe Thr Arg Gly Arg Thr Glu Ser Pro Ile Ser Gly Val Gly Leu Gly

850 855 860

Leu Ala Ile Cys Arg Ala Ile Val Glu Ala His Asn Gly Arg Ile Trp

865 870 875 880

Ala Glu His Val Thr Pro Gln Gly Ala Arg Phe Ile Phe Ser Leu Pro

885 890 895

Val Gly Thr Pro Pro Asp Leu Ser Val Pro Gln Glu Leu Asp Thr

900 905 910

<210> 2

<211> 2736

<212> DNA

< 213>artificial sequence

<400> 2

atgggctatc ccattcccaa tgagcatact ggctggaaac cctgcacgat gatggataag 60

ccgcgccccg accctgacac actgctggaa caaatccagg ccgaggacgc acgcgccaag 120

cgtggtaagt tgaaggtatt ttttggggcc tgcgccggag tgggcaaaac ctacgccatg 180

ctatcggccg cacaccagtt gcgttcccaa ggcatggatg tggtagtggg catcgtcgaa 240

acccatggac gggctgaaac gctggctctt ttgaataatc tggaagttct ccccttgcgc 300

gaggtacaac acaaccaccg cccactcaag gaatttgatc tggaaggagc attacgccgc 360

caccccactc tgatactggt ggatgagttg gctcatacca atgcccaaag ttgccgtcac 420

accaagcgtt ggcaagatgt ggaagaactc ctggcttccg gaatcgatgt ttttacgacg 480

gtaaatgtac aacatctgga aagcttgaac gatgtcgtgg ggggaatcac cggagtccga 540

gtctgggaaa cagtccccga ccatgtcttc gatgaagcca atgaagtcat gctggtggat 600

ttgcctcctg aagaactact gcaacgactc aaggaaggaa aaatctacct accccatcag 660

gcagagcggg ccattcgaaa tttctttcgc aaaggtaatc tcatcgcgtt gcgcgaactt 720

tccctgcgcc gcactgcaga ccgcgtggat ggagacatgc tcgcctatcg gcgcaccaaa 780

gccgtccaaa ccgtgtggca gacacgggag tccctgctgg tgtgtgtcgg accagggccc 840

ggcagtgaac gagtggtccg cagtgccgca cgtctggcaa cccaaatcga tggaagatgg 900

catgccatct acgtcgaaac tccgcgcctg caacgcctgc cccgcgcagc acgggagcgg 960

atcctgcaaa ccctgaatct ggccaaggag ctgggtgcag aaacagccac actgcccgcc 1020

gaagatgcca ccgccgtcac cgtcgcctat gccagggaac ataacctgac caaggtggtg 1080

atcggacggg atcatgacaa tccactgtgg cgacattcct ttgctgaacg aatcggacgt 1140

atggcctcgg atctggatgt tatccaggtg gcacgcaacc ctcaccatac cgtacccaaa 1200

gaaaaaactt ccacccttct gttttccgaa gatatccctc tctggcctgc ctacggaaaa 1260

agcgtgggac tctgcattgc cgtcaccctt ctggcaacgc cgttgcgaca ctggctcgaa 1320

ttgaccaata tcgtcatgat ctttttgctg gccgtcatcg gcgtggctct gcgtcttggc 1380

cggggacctg ccgtgctcgc ctcctttctc agcgtcgtct tctttgactt cttttttgtt 1440

cctccccgtt tttcctttgc tgtcagcgat gtgcaatatc ttcttacttt cggagtgatg 1500

ctcaccgtgg cactggtcat cgcccaattg atggccaatc tacgctatca ggcacgcgtt 1560

gccatgaatc gtgaaagccg cgcactggcg ctctacgaag cagcgcgtga tctatcagga 1620

acgttgcagc caaaacagat cgcagaggtt tgtgaccgct ttgccaatca cgtcctgggc 1680

gcaaaaattg gtctgctgtt gatgggcggg aatggcaacc tgcaagaacc aatcgatctc 1740

gatggaacct tgacggatgt cgataccggt atcgctcaat ggtctttcga tcacggagaa 1800

gtcgccggac tgggaaccca gactctggct gcttccccga tattctacct gcctctcaag 1860

gcacccatgc ggatccgtgg agtcctggca atcgaacctc gtcacggaca ctggctacaa 1920

atccccgagc aacggcgttt gctggatacc tttgcttctc tggtcgccat cgccatcgaa 1980

cgtattcact atgttgaagt agcccatgaa gccttgatca aaatggagtc agagcgtctg 2040

cgcaattctg tgctatcggt gctgtcccat gatttgcgca cgccattgac cgctttggta 2100

ggattgtctg ataccctgag tctggaaccc ttgccggacc atcagttgga agcggtgcaa 2160

gccatccacg acgaagccgt gcgcatggga tcattggtca acaatcttct ggatatggcg 2220

cgcctgcaat ccggccaagt aacgctaaag cgtgaatggc aaccggtgga agaagtcatc 2280

ggaagtgccc ttaaagcctc aacccgtgcg ctggcagatc gaaccgtaca catagacatg 2340

aaacccgaac taccttttgt cgaatttgat gctgtgttga tcgaacgcgt actacgcaac 2400

cttctggaga acgccggcaa gtacacaaat ccaggaaaca acattataat tcaagcgcaa 2460

cgtattaaag aatcaataca aatatccgtc agtgatgacg gccctggttt ctccgccggc 2520

agcgaagaaa gtgtatttga caaattcacc cgcggacgta cggaatcacc catttcaggg 2580

gtgggattgg gtcttgccat ctgtcgtgcc atcgtggaag cccataacgg acgaatatgg 2640

gccgaacacg tcacccccca gggggcccgt ttcatcttct cactgcctgt gggaactcca 2700

ccggatctgt ctgtcccaca ggaacttgac acatga 2736

<210> 3

<211> 21

<212> DNA

< 213>artificial sequence

<400> 3

atgggctatc ccattcccaa t 21

<210> 4

<211> 21

<212> DNA

< 213>artificial sequence

<400> 4

tcatgtgtca agttcctgtg g 21

<210> 5

<211> 31

<212> DNA

< 213>artificial sequence

<400> 5

ccggaattca tgggctatcc cattcccaat g 31

<210> 6

<211> 31

<212> DNA

< 213>artificial sequence

<400> 6

ccgctcgagt gatccctgca tcaaccattg t 31

Claims (9)

1. a cadmium metal resistance-associated protein KdpD is characterized in that aminoacid sequence is shown in SEQ ID NO:1.

2. the application of the said cadmium metal resistance-associated protein of claim 1 KdpD in administering Environmental Cadmium Pollution.

3. the encoding sox of the said cadmium metal resistance-associated protein of claim 1 KdpD is characterized in that nucleotide sequence is shown in SEQ ID NO:2.

4. the application of the encoding sox of the said cadmium metal resistance-associated protein of claim 3 KdpD in administering Environmental Cadmium Pollution.

5. the expression vector that contains the encoding sox of the said cadmium metal resistance-associated protein of claim 3 KdpD.

6. according to the said carrier of claim 5, the carrier that it is characterized in that setting out is pET28a.

7. a genetic engineering bacterium is characterized in that being obtained by the described expression vector transfection Escherichia coli of claim 6.

8. the application of the said genetic engineering bacterium of claim 7 in administering Environmental Cadmium Pollution.

9. application according to claim 8 is characterized in that the concentration of cadmium ions in the metal Environmental Cadmium Pollution is below the 200 μ M.

Images