CN103146818B - Recombinase Cre modification method, and application of modified recombinase Cre in plants - Google Patents

Abstract

The invention discloses a recombinase Cre modification method and an application of a modified recombinase Cre in plants. According to the invention, a recombinase Cre is split to an inactive N end (NCre) and a C end (CCre), the in-vitro prokaryotic expression and the active detection of the above split proteins are carried out, and new Cre/loxp systems are simultaneously constructed respectively; the recombination activity is recovered and the systems have deletion activities when the new Cre/loxp systems are applied in the plants and the N end and the C end are in a same plant cell; and the systems have no deletion activities when the N end and the C end are not in a same plant cell. The invention also discloses an influence of a nuclear localization signal (NLS) to the systems, and all plant expression vectors and in-vitro prokaryotic expression vectors.

Description

A kind ofly transform the method for recombinase Cre and the application in plant thereof

Technical field

The invention belongs to the plant genetic engineering field in biology field, relate to and recombinase Cre is split, build method and the application of new Cre/loxp system.

Background technology

In agricultural production practice, widely, tremendous contribution has been made in the aspects such as this technology, in Crop Improvement quality, improves crop yield, the usage quantity of minimizing weedicide, agrochemical agricultural chemicals in plant transgenic technology application.While transgenic technology brings huge economic interests and ecological benefits to us, due to this technology development break through and develop time still short, the query that transgenic plant cause in ecotope and food safety etc. gets more and more, Jia Shirong etc. think that the potentially danger that the current mankind can't bring this technology makes correct evaluation, and its major cause is the existence of the selectable marker gene of some external sources in the middle of transgenic plant.Goldsbrough etc. adopt transposon technology, Komari etc. to adopt cotransformation technology to remove selectable marker gene in transgenic plant, and application the earliest, the most extensively, the most deep be Cre/loxp system in site specific system.

Cre/loxp system is widely used in the organisms such as animal, plant and yeast, and the research especially in the middle of mouse is the most deep.Gilbertson etc. think that Cre/loxp system is the important tool of excising foreign gene on transgenic plant karyomit(e) in plant biotechnology field.This system was applied to yeast saccharomyces cerevisiae as far back as 1987 by Sauer etc., and the Cre recombinase demonstrated first from prokaryotic cell prokaryocyte also can knock out by producer in eukaryotic cell.Luo etc. adopt tissue-specific promoter Bgp to start the expression of recombinase, reach the deletion to exogenous marker gene in the specific organ of plant materials (seed or pollen).But specific promotor can only control the expression of recombinase gene at privileged site, thus greatly limit Cre/loxp systematic difference scope.

The activity of interaction between protein-protein to regulation and control Growth of Cells supervisor plays important role, and some technology are used to detect the interaction in the middle of viable cell between protein-protein.Luciferase is split as N end and the C end of non-activity by Yukichi etc., merges respectively, uciferase activity detected after arabidopsis thaliana transformation protoplastis with histone H2A and H2B.Arabidopsis thaliana transformation after gus reporter gene split in 2003 by Yang etc., the enzyme that the protein complementation technology utilizing intein to mediate has recovered gus gene in the middle of transgenic plant is lived.

Large quantity research shows, is split as by a complete albumen and does not have activated two portions, by by a pair relevant albumen cofactor, merges one of them cofactor respectively, and then reach the reconstruction of protein and active recovery at two portions.The present invention carries out resolution to the critical elements recombinase Cre in Cre/loxp system, be split as N end and the C end of non-activity, by this two portions cotransformation Tobacco Hairy Roots, realize when these two portions are in the middle of same vegetable cell, recover the activity of recombinase and producer is deleted, otherwise any part transformed separately, this system does not all have deletes activity.Adopt after this technology transforms Cre/loxp system, not only can obtain and not have activated Cre/loxp system, its activity recovery in the middle of transgenic plant can be made as required again simultaneously, add controllability and the range of application of Cre/loxp system.The application of the present invention in the middle of plant never appears in the newspapers.

Summary of the invention

In order to solve the problem, the object of the present invention is to provide a kind of method transforming recombinase Cre, and being applied in the middle of plant.

In the present invention, described method utilizes albumen disassemble technique to be held by the recombinant protein c re N that resolution is non-activity between the 59th and 60 amino acid (NCre) and C to hold (CCre) two portions, carries out restructuring Activity determination to fractionation albumen.

In a specific embodiments of the present invention, be building up to by NCre and CCre on prokaryotic expression carrier pMAL-C2X, after abduction delivering purifying, vitro detection splits the activity of albumen.

In the present invention, by containing a pair in the same way the fusion gene loxP-nos-loxP of recognition site loxp be implemented on pCAMBIA1305.1 and obtain intermediate carrier pCA-LoxP, for skeleton, different fractionation albumen is built with this carrier, obtain all plant expression vectors containing Cre/loxp system of the present invention.

In another specific embodiments of the present invention, by the genetic transformation transformation of tobacco that all plant expression vectors are mediated by Agrobacterium rhizogenes, obtain Transgenic Tobacco hairly root, the restructuring of the Cre/loxp system transformed by GUS tissue staining and PCR Molecular Detection is active.

In the present invention, external Protein Assav proves that NCre and CCre of fractionation albumen has the activity of complete Cre albumen when mixing.

In the present invention, is found recover to recombinate active when N end and C end (i.e. NCre and CCre) are at same vegetable cell and delete after the system converting tobacco of Cre/loxp that fractionation albumen NCre and CCre is built respectively, otherwise then can not.This point is consistent with external Protein Assav result.

Accompanying drawing explanation

Fig. 1: recombinase Cre is split as N end (NCre) and C holds the model of (CCre) and each several part to merge NLS.

Fig. 2: recombinant protein c re and split the external evoked expression of albumen NCre, CCre, purifying and Activity determination result.

Wherein A: split Expression and purification on the expression vector pMAL-C2X containing maltose binding protein tag MBP of albumen NCre, CCre and the complete Expression and purification of recombinant protein c re on pET-28a carrier (wherein 1,2,7 are respectively the induction splitting albumen NCre, do not induce, purifying; 3,4,8 are respectively the induction splitting PROTEIN C Cre, do not induce, purifying; 5,6,9 is the induction of maltose binding protein tag MBP, does not induce, purifying; 10,11,12 inductions being respectively complete recombinant protein c re, do not induce, purifying); B: the external activity of purifying protein detects, using the carrier pLoxp-ccre629 containing recognition site loxp as reaction substrate, Control: plasmid control; H+B:Hind III and EcoR I enzyme are cut; N:NCre enzyme is cut; C:CCre enzyme is cut; N+C:NCre and CCre enzyme is cut; Cre:Cre proteolytic cleavage; MBP:MBP proteolytic cleavage contrasts.

Fig. 3: the GUS tissue staining of transgenic hairy root.

Wherein a is for turning pCA-LoxP strain; B is for turning pCA-NCre strain; C is for turning pCA-nNCre strain; D is for turning pCA-CCre strain; E is for turning pCA-nCCre strain; F is for turning pCAMBIA1305.1 strain; G is for turning pCA-Cre strain; H is for turning pCA-nCre strain; I is for turning pCA-CCre-nNCre strain; J is for turning pCA-nCCre-nNCre strain.

Fig. 4: deletion efficiency statistic analysis result.

Fig. 5: the PCR Molecular Detection of transgenic hairy root.

Wherein A: with transgenic line pCAMBIA1305.1, pCA-LoxP, pCA-Cre, pCA-nCre, pCA-CCre-nNCre, pCA-nCCre-nNCre tobacco hairly root genomic dna for template, the PCR carrying out deleting front and back with sequencing primer pCA-F and pCA-R detects; N: negative (before deletion); P: positive (after deleting); B: to turn the hairly root genomic dna of the different strains of pCA-NCre, pCA-nNCre, pCA-CCre, pCA-nCCre for template, carry out PCR detection with sequencing primer pCA-F and pCA-R.

Fig. 6: sequencing analysis result.

Embodiment

The present invention's test materials used is commercially available purchase product if no special instructions.

The fractionation of [embodiment 1] recombinase Cre

According to the research of the people such as Johannes Hirrlinger, by complete recombinase Cre from splitting between the 59th and 60 amino acid, called after NCre and CCre respectively, simultaneously fusion nucleus signal for locating NLS(Fig. 1 before each splits fragment).

[embodiment 2] splits the external evoked expression of albumen NCre, CCre and complete recombiant protein Cre, purifying and Activity determination

Prokaryotic expression vector construction

The upstream primer of design amplification NCre: 5 '-CG gAATTCaTGTCCAATTTACTGACCGTAC-3 ', underscore is EcoRI recognition site, downstream primer: 5 '-CCC aAGCTTcTAATTCAACTTGCACCATGCC-3 ', underscore is HindIII recognition site; The upstream primer of amplification CCre: 5 '-CG gAATTCaTGAACCGGAAATGGTTTCCCG-3 ', underscore is EcoRI recognition site, downstream primer: 5 '-CCC aAGCTTcTAATCGCCATCTTCCAGCA-3 ', underscore is HindIII recognition site, contains Cre gene with pET-Cre() be template, the system 50 μ l of pcr amplification NCre and CCre:

Amplification condition is: 94 DEG C of denaturation 5min; (94 DEG C of sex change 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 70s) 30 circulations; 72 DEG C extend 10min.

Add A after being reclaimed by amplified fragments glue and be connected to carrier pCXSN(Songbiao Chen etc.) on, with EcoR I and Hind III pair of enzyme by NCre and CCre from after intermediate carrier pCXSN cuts, being inserted into the corresponding site of prokaryotic expression carrier pMAL-C2X, obtaining the prokaryotic expression carrier containing splitting fragment NCre and CCre of the present invention.The expression vector pET28a-Cre of the Cre containing total length is this experiment preservation carrier.

Heat shock method is adopted to be transformed in E. coli expression strains BL21 by each expression vector.

External evoked expression and purifying

Adopt IPTG induction to cut the correct recon of order-checking qualification through enzyme, method is as follows:

(1) get-80 DEG C of expression bacterium bacterial classifications preserved, dip a small amount of bacterium liquid with transfering loop and add corresponding microbiotic at solid medium LB() upper line, cultivate for 37 DEG C and wait to grow single bacterium colony;

(2) picking list bacterium colony is in 180rpm in 50mL LB liquid nutrient medium (adding corresponding microbiotic), and 37 DEG C of shaking culture are spent the night;

(3) getting 2mL mono-living bacterial liquid is inoculated in 200mL LB liquid nutrient medium (adding corresponding microbiotic), and 37 DEG C of shaking culture are to bacterium liquid OD ₆₀₀≈ 0.4 ~ 0.6;

(4) add the IPTG (final concentration 0.1mg/L.) 25 DEG C that 400 μ L configuration concentrations are 100mM, 180rpm abduction delivering 4-5h, establishes simultaneously and does not add IPTG in contrast;

(5) get 1ml bacterium liquid, 4 DEG C, 5000rpm, centrifugal 10min receives thalline thalline, abandons supernatant;

(6) add and be resuspended on ice in 1mL PBS Buffer, ultrasonic disruption to liquid becomes clear, 4 DEG C, 10000rpm, centrifugal 10min;

(7) collect supernatant liquor, the ratio sample loading buffer of 1:5, boils 10min sex change by volume, of short duration centrifugal;

(8) the sample 20 μ l before getting induction respectively and after induction carries out SDS-PAGE electrophoretic analysis (9-12%).

The purification step of albumen is as follows:

(1) getting the centrifuge tube of 2mL, add the column chromatography liquid of 200 μ l, then add the PBSBuffer of 1.5mL, put upside down mixing for several times, leaving standstill several minutes to precipitating completely, also can be centrifugal to precipitation, remove supernatant;

(2) repeating step (1) 3-4 time;

(3) get 2 pipe kind daughter bacteria smudge cellses, the same above-mentioned steps of method (6), get supernatant and join centrifuge tube in (2), be placed on ice, earthquake shaking table shakes 90min;

(4) supernatant is removed, with PBS Buffer rinsing 3-4 time, each 10min, period shakes on shaking table;

(5) add the imidazoles wash-out 45min of the 200mmol/L of 300 μ l, leave standstill to precipitation, get supernatant liquor and add glycerine in the ratio of 1:1 ,-80 DEG C of preservations after packing.

Induction purification result is shown in Fig. 2-A.

Activity determination

In order to detect the recombinant protein N Cre of purifying, the activity of CCre and Cre, using the plasmid pLoxp-ccre629 containing a pair recognition site loxp in the same way as reaction substrate, carry out endonuclease reaction 1h with above purifying protein at 37 DEG C, system is as follows:

Above-mentioned reaction product is carried out DNA electrophoresis, the activity (Fig. 2-B) after splitting Protein reconstitution can be detected.

[embodiment 3] plant expression vector construction

1 containing the acquisition of recognition site loxP-nos-loxP

In order to be building up on carrier pCAMBIA1305.1 by a pair recognition site loxp in the same way, the present invention adopts synthetic to merge fragment loxP-nos-loxP, and sequence is as follows: 5 '-CG gGATCCgCATAACTTCGTATAATGTATGCTATACGAAGTTAT aGATCTtCCGTTCAAACATTTGGCAATAAAGTTTCTTAAGATTGAATCCTGTTGCCGGTCTT GCGATGATTATCATATAATTTCTGTTGAATTACGTTAAGCATGTAATAATTAACAT GTAATGCATGACGTTATTTATGAGATGGGTTTTTATGATTAGAGTCCCGCAATTAT ACATTTAATACGCGATAGAAAACAAAATATAGCGCGCAAACTAGGATAAATTATCG CGCGCGGTGTCATCTATGTTACTAGATCGGGATAACTTCGTATAATGTATGCTATA CGAAGTTAT gGA tCCcG-3 ', underscore is respectively BamH I, BglII, BamH I recognition site.Used BamH I from being connected to after pES carrier cuts on carrier pCAMBIA1305.1 that Bgl II enzyme cuts, the positive colony of acquisition carries out sequence verification, and the plasmid called after pCA-LoxP checking order correct, this carrier comprises multiple clone site and gus reporter gene.

2 containing the structure of plant expression vector of Cre/loxp system

Cut carrier pCA-LoxP with Bgl II enzyme, the fragment NCre reclaimed with glue after BamH I/BglII double digestion and nNCre is connected respectively on carrier, obtain carrier pCA-NCre and pCA-nNCre.To fragment 35S-CCre-nos and 35S-NLS-CCre-nos EcoR I and Hind III be merged from the multiple clone site being connected to pCA-nNCre after carrier pCXSN cuts again, thus obtain carrier pCA-CCre-nNCre and pCA-nCCre-nNCre.Merge fragment 35S-CCrenos and 35SNLS-CCrenos EcoR I and Hind III simultaneously and obtain carrier pCA-CCre and pCA-nCCre from being connected to pCA-LoxP after carrier pCXSN cuts.

Frozen-thawed method is adopted to be transformed in Agrobacterium rhizogenes C58C1 each recombinant plasmid.

The acquisition of [embodiment 4] transgene tobacco hairly root

The succeeding transfer culture of tobacco aseptic seedling

Tobacco aseptic seedling is cut the stem section of band leaf bud, be inoculated on MS subculture medium, illumination cultivation at 25 DEG C, subculture growth 2 ~ 3 weeks tobacco aseptic seedling can be used for genetic transformation.

The cultivation of Agrobacterium rhizogenes and activation

Get-80 DEG C of Agrobacterium bacterial classifications preserved, a small amount of bacterium liquid is dipped in the upper line of solid medium (YEP+50mg/L Kan (kantlex)+40mg/LRif) with transfering loop, after growing single bacterium colony, picking list bacterium colony in 10mL Agrobacterium liquid nutrient medium (YEP+50mg/L Kan (kantlex)+40mg/LRif) in 180rpm, 28 DEG C of shaking culture 16 ~ 24h.Getting 400 μ L mono-living bacterial liquids is inoculated in the identical agrobacterium liquid substratum of 50mL, 28 ± 1.0 DEG C, and 180rpm shaken overnight is cultivated, and reaches logarithmic growth (OD to bacterium liquid ₆₀₀≈ 0.6 ~ 0.8).Be transferred in an aseptic environment by two living bacterial liquids in 50mL centrifuge tube, under room temperature, the centrifugal 10min of 4000rpm, abandons supernatant.Finally use the resuspended thalline of 50mL MS+100 μM AS (Syringylethanone) liquid nutrient medium, at 28 ± 1.0 DEG C, 180 ~ 200rpm shaking culture, 1 ~ 2h, as bacterium liquid OD ₆₀₀≈ about 0.5, infects tobacco.

Transformation of tobacco

Choose the tobacco aseptic seedling of young tender stalwartness the 3rd is explant to the healthy and strong leaflet tablet of fourth round, removes its vein and leaf margin, is cut into about 1cm ²vanelets, the resuspended bacterium liquid of Agrobacterium rhizogenes C58C1 put into by blade containing split system recombinant plasmid soaks 10min, jiggles once, on aseptic filter paper, then blot unnecessary bacterium liquid every 2min.The leaf explant blotted is inoculated on the MS Dual culture base containing 100 μm of ol/L Syringylethanones (AS), in view of Agrobacterium rhizogenes self can synthesize the required hormone of its growth, therefore does not need to add exogenous hormone.Dual culture two days under 25 DEG C of light culture conditions, proceeds on MS Selective agar medium afterwards, and vacuum side of blade is downward, in edge press-in substratum, and light culture at 25 DEG C, every 5 ~ 7 days replaced medium, the generation of about two weeks visible hairly root.After hairly root grows, blade is carried out a point dish, often coil the number of blade and be advisable with 2 ~ 3.When growth of hair root to 2 ~ 3cm, can be used for tissue detection or enlarged culturing, analyze for next step.During hairly root enlarged culturing, adopt 1/2MS liquid nutrient medium, wherein add 400mg/L cephamycin and 10mg/L Totomycin.

The deletion efficiency analysis of [embodiment 5] transgene tobacco hairly root and PCR Molecular Detection

GUS tissue staining

For transforming agrobacterium rhizogenes C58C1 strain, when growth of hair root is to about 1cm, the tip of a root cutting hairly root with blade is placed in the GUS staining fluid configured, 37 DEG C of incubated overnight, observes hairly root color and whether shows blueness (Fig. 3).

Deletion efficiency is analyzed

When growth of hair root is to 2-3cm, clip root tip divides and carries out GUS tissue staining.Screen owing to adding antibiotic hygromycin (Hyg) in solid medium, therefore false positive appearance can be got rid of.Coloration result display blueness is considered as deleting, and namely recombinase has activity, on the contrary then non-activity.On leaf dish, the hairly root of each vegetative point is a mono-clonal, therefore when detecting deletion efficiency, each transgenic line clip 30-50 the independent hairly root tip of a root, in triplicate, carries out GUS dyeing, add up blue hairly root proportion, be i.e. deletion efficiency (Fig. 4).

GUS tissue staining is carried out to multiple clones of the transgenic hairy root of different carriers, the quantity of positive colony is added up, obtains table one:

The transgenic hairy root GUS tissue staining detection statistics result of table 1. different carriers

PCR detects

Improved method of CTAB is adopted to extract the genomic dna of transgenic hairy root.Method is as follows:

(1) some 10mL sterile centrifugation tube are prepared.Often pipe adds 1.5mL CTAB and 90uL β – mercaptoethanol, 65 DEG C of water-bath preheatings.

(2) get the fresh blade of about 0.3g transgenosis or hairly root (paper using blots superfluous water before), liquid nitrogen flash freezer is milled fully in mortar, proceeds in the CTAB extract of above-mentioned preheating, and vortex mixes.

(3) in 65 DEG C of water-bath 45min, interval, midway (softly) vibration three mixings, take out cooling.

(4) add 1.5mL Lv Fang ︰ primary isoamyl alcohol (24 ︰ 1) after being cooled to room temperature, after gentle inversion mixing, keep flat emulsification 10min.In 18 DEG C, 10000rpm/min, centrifugal 10min.

(5) draw supernatant in another 10mL centrifuge tube, add equal-volume Lv Fang ︰ primary isoamyl alcohol (24 ︰ 1), after gentle inversion mixing, keep flat emulsification 10min; Then 18 DEG C, 10000rpm, centrifugal 10min.

(6) get supernatant in another 10mL centrifuge tube, add the Virahol of equal-volume-20 DEG C of precoolings, putting upside down mixing can see white flock precipitate, and amount less can be of short duration centrifugal.

(7) rifle head sucking-off flocks, with 500uL75%(V/V) ethanol rinse twice, 500uL dehydrated alcohol post rinse once, blot ethanol.Dry in 37 DEG C of thermostat containers.

(8) with 25 ~ 50 μ L sterilized water dissolution precipitations, transgenic plant genomic dna crude extract is obtained.

(9) in DNA crude extract, about 1 μ LRNase is added, in 37 DEG C of enzymolysis RNA1h.

(10) DNA sample ,-20 DEG C save backup.

Reacted constituent removing template DNA is the genomic dna of hairly root, and upstream primer is pCa-F:5 '-gatgacgcacaatcccactatcc-3 ', and downstream primer is that pCa-R:5 '-gtacagactagttcgtcggttctg-3 ' is outer, and each composition is as follows:

Reaction parameter: 94 DEG C, 5min; 94 DEG C, 45sec; 58 DEG C, 30sec; 72 DEG C, 1min, 35 circulations.72 DEG C are continued to extend 10min(Fig. 5).

Sequencing analysis

Detect the above pair of primers of product to the PCR showing active strain after fractionation Protein reconstitution to check order, result is consistent with PCR result, illustrates that splitting albumen has activity (Fig. 6).

Above detailed description of the invention does not limit the present invention, and those skilled in the art can make various change and distortion according to the present invention, and these change and are out of shape the scope that all should belong to claims of the present invention.

Claims (3)

1. transform a method of recombinase Cre, it is characterized in that, it comprises the following steps:

(1) by recombinant protein c re resolution between the 59th and 60 amino acid be non-activity N end (NCre) and C hold (CCre) two portions, each fractionation fragment before fusion nucleus signal for locating NLS;

(2) be building up on prokaryotic expression carrier pMAL-C2X by fractionation albumen NCre and CCre, after abduction delivering purifying, vitro detection splits the activity of albumen;

(3) by containing a pair in the same way the fusion gene loxP-nos-loxP of recognition site loxp be implemented on pCAMBIA1305.1 and obtain intermediate carrier pCA-LoxP, for skeleton, fractionation albumen NCre and CCre is built with this carrier, obtain the plant expression vector containing Cre/loxp system;

(4) by the genetic transformation transformation mode plant tobacco that the plant expression vector of structure is mediated by Agrobacterium rhizogenes, obtain transgenic hairy root, the restructuring of the Cre/loxp system transformed by GUS tissue staining and PCR Molecular Detection is active;

In above step, the described fusion gene loxP-nos-loxP containing a pair recognition site loxp in the same way obtains like this: adopt synthetic to merge fragment loxP-nos-loxP, sequence is as follows: 5 '-CG gGATCCgcataacttcgtataatgtatgctatacgaagttat aGATCTtCcgttcaaacatttggcaataaagtttcttaagattgaatcctgttgccggtctt gcgatgattatcatataatttctgttgaattacgttaagcatgtaataattaacat gtaatgcatgacgttatttatgagatgggtttttatgattagagtcccgcaattat acatttaatacgcgatagaaaacaaaatatagcgcgcaaactaggataaattatcg cgcgcggtgtcatctatgttactagatcgggataacttcgtataatgtatgctata cgaagttat gGATCCcG-3 ', underscore is respectively BamH I, Bgl II, BamH I recognition site, used BamH I from being connected to after pES carrier cuts on carrier pCAMBIA1305.1 that Bgl II enzyme cuts, the positive colony obtained carries out sequence verification, the plasmid called after pCA-LoxP checking order correct, this carrier comprises multiple clone site and gus reporter gene;

The construction process of the described plant expression vector containing Cre/loxp system is as follows: cut carrier pCA-LoxP with Bgl II enzyme, the fragment NCre reclaimed with glue after BamH I/Bgl II double digestion and nNCre is connected respectively on carrier, obtains carrier pCA-NCre and pCA-nNCre; To fragment 35S-CCre-nos and 35S-NLS-CCre-nos EcoR I and Hind III be merged from the multiple clone site being connected to pCA-nNCre after carrier pCXSN cuts again, thus obtain carrier pca-CCre-nNCre and pca-nCCre-nNCre.

2. the method for transformation recombinase Cre according to claim 1, is characterized in that, external Protein Assav proves that NCre and CCre of fractionation albumen has the activity of complete Cre albumen when mixing.

3. the method for transformation recombinase Cre according to claim 1 and 2, it is characterized in that, is found recover to recombinate active when N end and C end (i.e. NCre and CCre) are at same vegetable cell and delete after the system converting model plant tobacco of Cre/loxp that fractionation albumen NCre and CCre is built respectively, otherwise then can not.