CN106146634B - Plant disease-resistant protein B jMYB9 and its encoding gene and application - Google Patents

Abstract

The invention discloses a kind of leaf mustard ill-resistant proteinsBjMYB9 and its coding gene sequence and application, ill-resistant proteinBjIts amino acid sequence of MYB9 is as shown in SEQ ID NO:1, its nucleotide sequence of encoding gene is as shown in SEQ ID NO:2.By yeast one-hybrid technology screening to can be with leaf mustard disease-resistant geneBjCHI1Promoter BjC-P in fungal induction core element W-box-like-4 specific bond R2R3-MYB type transcription factor, be named asBjMYB9.Gel retardation assasy and tobacco transient expression experiment proveBjMYB9 can with W-box-like-4 specific bond and activate the promoter activity.BjMYB9Gene in leaf mustard rna expression obviously by the inducing expression of fungi, arabidopsis can be remarkably reinforced to the resistance of grape botrytis cinerea in the gene after model plant arabidopsis overexpression, provide experiment basis and genetic resources to disclose Mechanism of Disease Resistance and cultivating disease-resistant variety.

Description

Plant disease-resistant protein B jMYB9 and its encoding gene and application

Technical field

The invention belongs to field of biotechnology, it is related to a kind of plant disease-resistant protein B jMYB9 and its encoding gene and application.

Background technique

Botrytis cinerea (Botrytis cinerea) is used as most important plant fungal pathogen, can infect 200 Various plants, including nearly all vegetables and fruit crop, lead to the loss in the whole world 10,000,000,000 or even 100,000,000,000 dollars every year, To agricultural production cause huge economic loss (Dean et al., 2012；Lu et al.,2013；Weiberg et al., 2013)。

In order to defend pathogen infection, plant evolution goes out complicated defense mechanism to cope with the attack (Jones of pathogen and Dangl,2006；Lu et al.,2013).During defence, some plant genes are activated or induce, many Transcription factor (Transcription Factors, TFs) play the part of important role (Liu et al., 2013；Windram et al.,2012).WRKY and AP2/ERF gene family is the transcription factor (Hu that main plant defense Botrytis cinerea infects et al.,2012；Lai et al.,2008；Lu et al.,2013).Furthermore NAC family transcription factor can also adjust plant To the resistant function of Botrytis cinerea (Wang et al., 2009).Recent research indicate that: some myb transcription factors are in plant Also played in reply Botrytis cinerea infection processs important adjustment effect (Mengiste et al., 2003；Peng et al.,2011；Raffaele and Rivas,2013).

MYB albumen form plant in maximum transcription factor family, development of plants, secondary metabolism, hormone signal transduction, Play an important role (Katiyar et al., 2012) in terms of disease-resistant and abiotic stress.According to MYB structural domain in albumen The number of number of repetition, myb transcription factor family is divided into 4 subfamilies (R1-MYB, R2R3-MYB, 3R-MYB and 4R-MYB) (Dubos et al.,2010).R2R3-MYB subfamily includes two MYB structural domains, main to adjust the specific physiology function of plant Can such as to the immunization of pathogenic microorganism (Dubos et al., 2010；Stracke et al.,2001).Such as from rubber The R2R3-MYB gene HbMyb1 of glue (Hevea brasiliensis) is overexpressed in tobacco can enhance to grape grey mould The resistant function (Peng et al., 2011) of bacterium；Wheat (Triticum aestivum L.) R2R3-MYB gene TaPIMP1 Resistance of the tobacco to biotroph bacterial pathogens (Ralstonia solanacearum) can be enhanced by being overexpressed in tobacco Effect, can also enhance resistance (the Liu et of double of biotroph fungal pathogens of wheat (Bipolaris sorokiniana) al.,2011；Zhang et al.,2012)；Rice (Oryza sativa spp.japonica) R2R3-MYB gene OsJaMyb can respond (Lee et al., 2001) to infecting for rice blast (Magnaportheoryzae).Furthermore AtMYB30 studies more deep R2R3-MYB gene as arabidopsis, participates in the immunological regulation to pathogenic microorganism (Raffaele and Rivas,2013).Some other R2R3-MYB gene from arabidopsis such as AtMYB108 (Mengiste Et al., 2003), AtMYB72 (Segarra et al., 2009), AtMYB60 and AtMYB96 (Seo and Park, 2010； Seo et al., 2009) plant is also assisted in adjust the resistance of pathogen.

Although outstanding role of the R2R3-MYB transcription factor in terms of plant defense against pathogens, these protein and target Interaction details between gene is still not very clear (Prouse and Campbell, 2013).It studies on a molecular scale The research report of R2R3-MYB protein function is occurring, and some R2R3-MYB albumen can be integrated to AC element (ACC (A/T) On ACC (A/C/T), and then activate the transcription (Prouse and Campbell, 2012) of target gene.Such as pine tree (Pinus Taeda) MYB1 and MYB4 (Patzlaff et al., 2003a, 2003b) and eucalyptus (Eucalyptus grandis) MYB2 It can be integrated on the AC element of Lignin biosynthesis gene promoter (Goicoechea et al., 2005).

Understanding plant defense mechanism will be helpful to researcher and be improved work using crop resistance mechanism on a molecular scale Object.Based on the research before us: BjCHI1 promoter BjC-P is more stress-inducible promoters (Wu et al., 2009)； W-box-like-4 element (GTAGTGACTCAT) is that promoter response Botrytis cinerea (Botrytis cinerea) is invaded The core element (Gao et al., 2014) of dye, in order to further analyze BjC-P mediated plant to the molecule machine of fungus resistant System, we are separated to a R2R3-MYB transcription factor from leaf mustard (Botrytis cinerea) by yeast one-hybrid technology BjMYB9.In vitro and in vivo experiment shows that BjMYB9 can be which can specifically bind on the W-box-like-4 element of BjC-P.This The outer transgenic arabidopsis for being overexpressed BjMYB9 enhances the resistance to Botrytis cinerea.However there are no people's reports so far MYB albumen can specifically be integrated to a W-box element and then adjust plant to the defense reaction of disease fungus.

Summary of the invention

The object of the present invention is to provide a kind of plant disease-resistant protein and its encoding gene nucleotide sequences.

Protein source provided by the present invention is a kind of R2R3-MYB nuclear transcription factor from leaf mustard (Brassica juncea) Sub- albumen, is named as BjMYB9, can W-box-like element (GTAGTGACTCAT) in specific bond target gene promoters, And then the defense reaction that mediated plant infects grape grey mould fungal pathogens.

It is the amino acid sequence of BjMYB9 shown in SEQ ID NO:1, is made of 220 amino acid residues, in sequence table 13rd amino acid to 19 amino acids, the 79th amino acid to 84 amino acids are amino acid where 2 MYB structural domains of BjMYB9 Residue.

In order to make BjMYB9 convenient for purifying or Molecular Detection, can shown in SEQ ID NO:1 amino acid sequence form The amino terminal or carboxyl terminal of protein connect label as shown in the table.

The sequence of label is as follows:

The nucleic acid molecules of encoding said proteins BjMYB9 also belong to protection scope of the present invention.

The nucleic acid molecules can be DNA, such as cDNA, genomic DNA；It is also possible to RNA, such as mRNA.

The cDNA molecule of BjMYB9 shown in SEQ ID NO:2 is made of 663 nucleotide, and open reading frame is entire Sequence shown in SEQ ID NO:2 encodes protein (BjMYB9) shown in SEQ ID NO:1.

Recombinant vector, recombinant bacterium containing the nucleic acid molecules also belong to protection scope of the present invention.

The recombinant expression carrier include for eukaryotic expression BjMYB9 binary vector pCAMBIA1307-BjMYB9 and Carrier pET-28a-BjMYB9 for prokaryotic expression His-BjMYB9 fusion protein.Recombinant bacterium is to contain pCAMBIA1307- The bacillus coli DH 5 alpha and Agrobacterium EHA105 of BjMYB9 plasmid and the bacillus coli DH 5 alpha containing pET-28a-BjMYB9.? It is inserted into the BjMYB9 gene between multiple cloning sites BamH I and the Sal I of pCAMBIA1307 carrier, obtains BjMYB9 plant Recombinant expression pCAMBIA1307-BjMYB9.Institute is inserted between pET-28a vector multiple cloning site EcoR I and Sal I It states BjMYB9 gene and obtains the albumen pronucleus expression recombinant plasmid pET-28a-BjMYB9 of BjMYB9.

The application of the BjMYB9 albumen or the nucleic acid molecules in regulation disease resistance of plant also belongs to guarantor of the invention Protect range.In the present invention, the regulation plant disease-resistant is embodied as improving plant to the resistance of Botrytis cinerea.

It is a further object to provide a kind of methods for cultivating disease resistant transgenic plants.

The BjMYB9 gene can specifically be imported in purpose plant by the recombinant expression carrier, be carried described The recombinant expression carrier of BjMYB9 gene can convert purpose plant by conventional biology methods such as mediated by agriculture bacillus, obtain disease-resistant Property transgenic plant.The purpose plant is either dicotyledon is also possible to monocotyledon.In implementation of the invention In example, the plant is specially dicotyledon Columbia ecotype arabidopsis Col-0.

The BjMYB9 also belongs to protection scope of the present invention as the application of transcription factor.BjMYB9 energy and W-box- Like cis-acting elements (GTAGTGACTCAT) combines, and has the function of activation.

BjMYB9 provided by the present invention can be expressed under the inductivity of Botrytis cinerea, can be with specific bond W- Box-like cis element (GTAGTGACTCA, core sequence TGAC) is by yeast one-hybrid technology screening to can be with Fungal induction core element W-box-like-4 in the promoter BjC-P of leaf mustard chitinase gene BjCHI1 (GTAGTGACTCA) the R2R3-MYB type transcription factor of specific bond.Further gel retardation assasy and tobacco transient expression are real Verify bright BjMYB9 can with W-box-like-4 specific bond and activate the promoter activity.BjMYB9 gene is in leaf mustard For rna expression obviously by the inducing expression of fungi, which can be remarkably reinforced quasi- south after model plant arabidopsis overexpression Plant can be improved to the disease resistance of Botrytis cinerea, to disclose Mechanism of Disease Resistance to the resistance of grape botrytis cinerea in mustard And it cultivates disease-resistant variety and provides experiment basis and genetic resources.BjMYB9 of the invention will improve plant pathogenic fungi grape It plays an important role in the resistance breeding of botrytis cinerea.First demonstration that R2R3-MYB protein can be with W-box-like Element interaction, and then mechanism of action of the mediated plant to the defense reaction of fungal infection, between W-box element and interaction albumen New annotation is provided, also will can enhance plant for cultivation and provide new thinking to the resistant variety of biotroph venereal disease opportunistic pathogen And genetic resources.

Detailed description of the invention

Fig. 1 is yeast one-hybrid bait Bait and Bait-m sequence diagram and the signal of Bait and Prey carrier structure Figure.(A) wild type decoy segments Bait and its mutant segment Bait-m sequence diagram.Decoy segments Bait and Bait-m sequence List intention: BjC-P promoter fragment -700~-621 (white edge is shown) and -409~-371 (grey frame is shown) are fused to bait Sequence, the number above frame show the nucleotide position of BjC-P promoter fragment, W-box-like-4 element and its mutant sequence Column are shown, and core sequence TGAC and its mutant nucleotide sequence GCAA are shown with runic；(B) bait and Prey carrier structure schematic diagram: Bait and Bait-m segment is respectively inserted into AbA on pBait-AbAi carrier^rThe upstream of reporter gene, leaf mustard cDNAs are inserted in The position pGADT7 carrier S fi I, GAL4AD downstream of gene, reporter gene LEU2 upstream region of gene are built into B. juncea cDNA library.

The yeast one-hybrid that Fig. 2 is BjMYB9 screens.Yeast one-hybrid technology screening and W-box-like-4 element interaction Protein factor, in which: (A) determines yeast reporting bacterial strain Y1Hgold [pBait- by SD/-Ura/AbA deficiency culture medium AbAi] and Y1Hgold [pBait-m-AbAi] the most suitable inhibition self-activation concentration of Aureobasidin A (AbA). Aureobasidin A (AbA) is a kind of cyclic ester peptide antibiotic, and the AbA of low concentration is able to suppress the growth of yeast Y1HGold；But Contain AbA resistant gene (AUR1-C) in bait yeast, when prey protein and decoy segments interaction, GAL4AD will be activated The expression of AUR1-C gene, bait yeast can obtain the resistance of AbA.In order to ensure prey protein comes from cDNA library, and Non-yeast intrinsic protein will be tested strictly before screening cDNA library and inhibit bait yeast strain Y1HGold [pBait1- AbAi], the most suitable AbA concentration of Y1HGold [pBait1-m-AbAi] self-activation, reporting bacterial strain Y1Hgold [pBait- as the result is shown AbAi] and Y1Hgold [pBait-m-AbAi] the most suitable inhibition concentration of AbA be 550ng/ml；(B) yeast one-hybrid technology Y1H Screen B. juncea cDNA library: pGADT7-BjcDNAs plasmid transformed yeast reporting bacterial strain Y1Hgold [pBait-AbAi] then exists SD/-Leu culture medium (SD/-Leu/+AbA containing 550ng/ml AbA⁵⁵⁰) on screen, utilize be free of AbA culture medium SD/- Leu verifies yeast conversion efficiency as control, and arrow indicates the positive colony filtered out；(C) BjMYB9 and W-box-like-4 Element interaction, but with the W-box-like-4 of mutation not interaction.It is isolated from the positive colony (as shown in Figure 2 B) filtered out Plasmid pGADT7-BjMYB9 distinguishes transformed yeast reporting bacterial strain Y1Hgold [pBait-AbAi] and Y1Hgold [pBait- again M-AbAi], then respectively in SD/-Leu/+AbA⁵⁵⁰It is screened on culture medium, as a result pGADT7-BjMYB9 plasmid transformed yeast report It can be in SD/-Leu/+AbA after announcement bacterial strain Y1H gold [pBait-AbAi]⁵⁵⁰The clone of health is grown on culture medium, still PGADT7-BjMYB9 untransformed mutants yeast reporting bacterial strain Y1Hgold [pBait-m-AbAi] cannot grow the clone of health.It is empty Plasmid pGADT7 is used to verify as the negative control for screening positive interaction clone, not antibiotic SD/-Leu plate screening Transformation efficiency.

Fig. 3 is real time fluorescent quantitative (Real-time) the PCR map of BjMYB9 by Fungal elicitor inducing expression.With 200 The Fungal elicitor (hexa-Nacetyl-chitohexaose) of μ g/ml handles leaf mustard (Brassica juncea) seedling leaf Then face, freshness protection package moisturizing 12h divide 24,48 and 72h to take blade, quick-frozen to be used to extract RNA and real time fluorescent quantitative in liquid nitrogen PCR (qRT-PCR) analysis, detection BjMYB9 are horizontal in the rna expression at these time points.The rna expression level conduct pair of 0h According to non-Fungal elicitor processing.Select leaf mustard housekeeping gene BjActin as internal reference (sequence is shown in Table 1).Data are shown as average Value ± SD, number of repetition are 3 times (n=3).Inducing expression of the BjMYB9 by Fungal elicitor is reached in 48hRNA expression To highest, begin to decline again later.

Fig. 4 is T₃For BjMYB9 transgenic arabidopsis and wildtype Arabidopsis thaliana to Botrytis cinerea (Botrytis Cinerea) disease-resistant phenotype.(A) wildtype Arabidopsis thaliana Col-0 (WT) and 3 BjMYB9 are overexpressed transgenic arabidopsis strain (# 1, #2, #6) sense/disease-resistant phenotype after inoculation light grey and pinkish sick (Botrytis cinerea) 3 weeks.；(B) qRT-PCR detection is wild Raw type arabidopsis Col-0 (WT) and 3 BjMYB9 are overexpressed transgenic arabidopsis strain (#1, #2, #6) light grey and pinkish after inoculation The biomass of mildew；(C) qRT-PCR analysis BjMYB9 intends mustard inoculation grape grey mould (Botrytis cinerea) in transgenosis The rna expression of front and back.Expression of the BjMYB9 in wildtype Arabidopsis thaliana Col-0 (WT) is as reference.BjMYB9 mistake as the result is shown Express transgenic arabidopsis enhances the resistance to Botrytis cinerea.

Fig. 5 is the In-vitro specificity Binding experiment of His-BjMYB9 fusion protein and W-box-like-4 element.Gel resistance The external interaction of stagnant experiment (EMSA) detection BjMYB9 and W-box-like element: (A) probe W4, W4 mutant W4d's and W5 Nucleotide sequence, W4 contain W-box-like-4 element, and W4d contains the W-box-like-4 of mutation, core element sequence TGAC Missing, with (--- -) show, W5 contains W-box-like-5 element, these element sequences use runic and underscore prominent aobvious Show.The wherein W-box-like-5 element in W5 and W-box-like-4 element only 1 base (C is shown with capitalization and italic) Difference；(B) gel retardation assasy between His-BjMYB9 fusion protein and W4 and W4d (EMSA), each association reaction are equal With the His-BjMYB9 fusion protein and biotinylated probe of equivalent, the cold spy of unmarked biotin in competitive binding experiment Needle is respectively 50 and 200 times of thermal probe (label biotin), the band such as figure left arrow institute of bonding probes and free probe Show；(C) gel retardation assasy between His-BjMYB9 fusion protein and W4 and W5 (EMSA), each association reaction use equivalent Probe, concentration increases His-BjMYB9 fusion protein in gradient.

Fig. 6 is the internal specific binding assays of His-BjMYB9 fusion protein and W-box-like-4 element.(A)BjC- P, GUS expression plasmid P16, P53 and BjMYB9 are overexpressed plasmid construct schematic diagram.Light gray frame represents BjC-P and its deletion fragment, Number above frame represents the position relative to BjCHI1 transcription initiation site nucleotide.Dark-grey frame generation containing textured small frame Table contains the gus gene of introne (introne is shown with textured frame).Small white edge in P53 represents W-box-like-4 TGAC base deletion in element；(B) GUS histochemical stain, round dotted line frame represent the region of injection, and the plasmid of injection is such as As shown in the figure；(C) GUS active fluoro quantitative analysis of the P16 and P53 after tobacco leaf transient expression: tobacco leaf co-injection P16 and pBjMYB9, pBI121-LUCint and P53 and pBjMYB9, pBI121-LUCint, GUS activity are equal by LUC activity One changes.Column diagram representative induced by pBjMYB9 after with the GUS activity ratio before induction, experiment is repeated 3 times, and figure is that average value adds Subtract standard error.BjMYB9 is by combining W-box-like-4 element to activate BjC-P activity as the result is shown.

Specific embodiment

Come that the present invention is furture elucidated below by the detailed description of specific embodiment, but is not to limit of the invention System, only illustrates.

Experimental method used in following embodiments is conventional method unless otherwise specified, material used, reagent Deng being commercially available unless otherwise specified.

The molecular cloning of embodiment 1, BjMYB9

One, plant and growth conditions

Plant Arabidopsis thaliana Arabidopsis thaliana (L.) (environmental Col-0), real name cigarette Nicotiana.benthamiana and leaf mustard Brassica juncea is small in 22 DEG C of (light)/19 DEG C (dark) and illumination/8 16h When dark cycle under the conditions of grow.Arabidopsis is used for stable genetic transformation, and real name cigarette Nicotiana.benthamiana is used to Transient expression, leaf mustard Brassica juncea are used to construction cDNA library and endogenous gene expression analysis experiment.

The transcription factor of two, yeast one-hybrid experiment screenings and W-box-like-4 element interaction

With the Fungal elicitor (hexa-Nacetyl-chitohexaose) of 200 μ g/ml (Raventos et al., 1995) foliage spray handles leaf mustard seedling, and 12,24,48 and 72h takes blade quick-frozen in liquid nitrogen after processing, will be different Taken leaf sample mixed and extracted total serum IgE period, for constructing B. juncea cDNA library.Construction cDNA library used carrier is PGADT7 (Clontech Laboratories, Inc., a Takara Bio Company), bait carrier pAbAi (Clontech Laboratories,Inc.,a Takara Bio Company).Leaf mustard cDNA is inserted in pGADT7 carrier S fi I site, is located at GAL4AD downstream of gene, and reporter gene LEU2 upstream region of gene is built into B. juncea cDNA library plasmid (referring to figure 1).Wild type decoy segments Bait is the section (- 700 that BjC-P contains fungal induction core element sequence (GTAGTGACTCAT) ~-621) segment made of being connected with the section (- 409~-371) of conjunction with which effect, length are 125bp (referring to Fig. 1).It is prominent Variant decoy segments are Bait-m, the conservative base TGAC of fungal induction core element sequence (GTAGTGACTCAT) in Bait GCAA is sported, other sequences and wild type Bait sequence are completely the same (referring to Fig. 1).Bait nucleotides sequence is classified as 5 '-CTCT GCTAGAGATAGTGTGGCCCAGCTAGTGAGTAGTGACTCATGAGGTAGAGAGAGGGTGGTCCATCATATATCGTGTT GCATGCGCTAGAGAGAGGGTGGTCCAGCTATCGTGTAGAAATATT-3 ', Bait-m nucleotides sequence are classified as 5 '-CTCTGC TAGAGATAGTGTGGCCCAGCTAGTGAGTAGGCAATCATGAGGTAGAGAGAGGGTGGTCCATCATATATCGTGTTGC ATGCGCTAGAGAGAGGGTGGTCCAGCTATCGTGTAGA AATATT-3′.Bait and Bait-m respectively with plasmid P16 and P54 (Gao et al., 2014) is that template is expanded, and amplification primers are shown in Table 1.Primer pair pAbAi-Seq1/pAbAi- Seq2 (being shown in Table 1) is used to verify whether pBait-AbAi carrier is integrated into Yeast genome.Primer pair PGADT7-F/ PGADT7-R (being shown in Table 1) is used to identify the positive colony that yeast one-hybrid (Y1H) filters out.

Yeast strain is Y1HGold, and yeast one-hybrid method is operated in strict accordance with the laboratory manual of Clontech company (Matchmaker Gold Yeast One-Hybrid Library Screening System User Manual).As a result It is as shown in Figure 2: by SD/-Ura/AbA deficiency culture medium determine yeast reporting bacterial strain Y1Hgold [pBait-AbAi] and The most suitable inhibition self-activation concentration of the Aureobasidin A (AbA) of Y1Hgold [pBait-m-AbAi] is 550ng/ml (referring to figure 2A).PGADT7-BjcDNAs plasmid transformed yeast reporting bacterial strain Y1Hgold [pBait-AbAi], is then containing 550ng/ml (SD/-Leu/+AbA on the SD/-Leu culture medium of AbA⁵⁵⁰) screening, using without AbA culture medium SD/-Leu as compare, Verify yeast conversion efficiency.As shown in Figure 2 B, in the culture medium SD/-Leu for being free of AbA, clonal growth is normal and clone's number compared with It is more, illustrate that transformation efficiency is normal.(the SD/-Leu/+AbA on the SD/-Leu culture medium containing 550ng/ml AbA⁵⁵⁰) growth have A certain number of clones indicate the positive colony filtered out as shown by arrows.Fig. 2 C is shown to be obtained by yeast one-hybrid technology With the R2R3-MYB type transcription factor BjMYB9 of W-box-like-4 element specific bond.The nucleotide sequence of the gene such as SEQ Shown in ID NO:2, open reading frame is the entire sequence of sequence 2.BjMYB9 gene coded sequence is as shown in SEQ ID NO:1 Protein (is named as BjMYB9 albumen), and BjMYB9 albumen is made of 220 amino acid residues, has 2 conservative R2R3- MYB structural domain.

Table 1 is used in the primer in BjMYB9 research

Embodiment 2, real-time fluorescence quantitative PCR analyze the rna expression after BjMYB9 gene is induced by Fungal elicitor

One, material processing

200 μ g/ml Fungal elicitor (hexa-Nacetyl- of leaf mustard (Brassica juncea) seedling leaves Chitohexaose) sprinkling is handled, after treatment 24,48,72h and (untreated) sampling of control 0h, the quick-frozen grinding in liquid nitrogen, At the DNAase for extracting leaf mustard total serum IgE using the plant total RNA extraction reagent box of TIANGEN company, and being polluted with no RNAase Reason removes the pollution of genomic DNA in RNA.And the first chain of cDNA is synthesized with TIANGEN company RNA reverse transcription reagent box.Reversion It records the first chain of product cDNA and is used as Real-time PCR Analysis.

Two, real-time fluorescence quantitative PCRs (qRT-PCR)

Real-time quantitative PCR is quickly real with SYBR Green Premix (Tiangeng company, Beijing, China) and ABI 7500 When quantitative PCR apparatus (Applied Biosystems, Foster city, CA, USA) carry out, specific steps make referring to kit With the operating instruction of explanation and real-time PCR.Leaf mustard housekeeping gene BjActin (primer sequence is shown in Table 1) is used as internal reference base Cause carries out level correction to the PCR product of different samples by its expression in different sample rooms.To the reality of all samples When quantitative PCR product all carry out solubility curve analysis, with ensure reaction product be a species specific product.With 2^-ΔΔCtMethod (Livak and Schmittgen, 2001) divides rna expression of the BjMYB9 before and after leaf mustard is inoculated with Botrytis cinerea Analysis, detection are shown in Table 1 with primer pair BjMYB9F3/BjMYB9R2 and BjActin-F/BjActin-R sequence.BjMYB9 is swashed by fungi Rna expression result after hair induction in leaf mustard is shown in Fig. 3.

Fig. 3 the result shows that: after leaf mustard is induced by Fungal elicitor, the expression of endogenous gene BjMYB9 is obviously induced, 48 hours expressions are being induced to reach highest, expression is begun to decline later.

The anti-grape grey mould Phenotypic examination of embodiment 3, BjMYB9

Genetic transformation of one .BjMYB9 to arabidopsis Col-0

BjMYB9 cDNA is expanded with primer pair BjMYB9-F2/BjMYB9-R (sequence is shown in Table 1), and sequencing is correct and clones Into pCAMBIA1307 carrier B amH I and Sal I site, the plasmid pCAMBIA1307-BjMYB9 of 35S promoter driving is obtained. With flower top method and pass through 105 mediated transformation arabidopsis of Agrobacterium EHA (Clough and Bent, 1998).The positive turns base It is detected because of strain with primer BjMYB9-F2/BjMYB9-R and by PCR.3 independent T2 are containing for positive transgenic strain There is the MS culture medium of 40 μ g/ml hygromycin to screen again, after be transplanted in soil, Botrytis cinerea inoculation is carried out when about 4 weeks big Processing.

The culture of two, Botrytis cinereas (B.cinerea) and the inoculation of arabidopsis is handled

Botrytis cinerea (B.cinerea) potato culture medium (potato 200g/l, glucose 20g/l, agar 15g/l, 1.5% dextrose, pH 6.0), it cultivates 10 days under the conditions of 22 DEG C.The sterile ddH of the spore of Botrytis cinerea₂O suspends, then It is filtered with 2 layers of sterile gauze, and with sterile ddH₂O is diluted to 5 × 10⁵A cells/ml, for being inoculated with arabidopsis.It is 4 weeks big Arabidopsis carries out grape grey mould spray inoculation, sterile ddH₂O spray inoculation is as control.

Inoculation result is shown in Fig. 4 A.Known by Fig. 4 A: after inoculation Botrytis cinerea, the blade of wildtype Arabidopsis thaliana is done mostly It is withered, and the blade of BjMYB9 transgenic arabidopsis still shows bud green mostly, especially No. 2 strain blades keep complete green substantially.

The rna expression of three .BjMYB9, BcITS before and after BjMYB9 transgenic arabidopsis strain is inoculated with Botrytis cinerea Analysis

QRT-PCR method detects BjMYB9, and BcITS connects in BjMYB9 transgenic arabidopsis strain and wildtype Arabidopsis thaliana Rna expression before and after kind Botrytis cinerea, detection method is the same as the qRT-PCR method in embodiment 2.Arabidopsis housekeeping gene Atactin gene (primer sequence is shown in Table 1) is used as reference gene, detection primer pair BjMYB9F3/BjMYB9R2 and BcITS- F/BcITS-R sequence is shown in Table 1.Testing result is shown in Fig. 4 B and Fig. 4 C.

Fig. 4 B the result shows that: wildtype Arabidopsis thaliana Col-0 and BjMYB9 be overexpressed transgenic arabidopsis strain be inoculated with grape After ash arrhizus bacteria, BcITS is substantially reduced in the expression quantity that BjMYB9 is overexpressed in transgenic arabidopsis strain compared with wild type, explanation Botrytis cinerea is overexpressed increment in transgenic arabidopsis strain in BjMYB9 and is significantly lower than wild type, further illustrates Resistant function of the BjMYB9 to Botrytis cinerea.Fig. 4 C the result shows that: expression quantity of the BjMYB9 in its transgenic arabidopsis It is remarkably reinforced compared with wild type, expression quantity further enhances after being inoculated with Botrytis cinerea.

The vitro binding assay of embodiment 4, His-BjMYB9 and W-box-like-4 element

One .His-BjMYB9 is in expression in escherichia coli

BjMYB9 is expanded by primer pair BjMYB9-F1/BjMYB9-R (being shown in Table 1), is then built into protein expression vector PET-28a (+) EcoR I and Sal I site obtains prokaryotic expression carrier pET-28a-BjMYB9.By pET-28a-BjMYB9 heat It hits and is transformed into the protein induced expression of coli strain E.coli Rosetta (DE3) progress.Contain pET- under the conditions of 37 degree The concentration of the DE3 bacterium of 28a-BjMYB9 plasmid shake to OD600 be 0.8 when, switch to 16 degree, with 0.6mM isopropyl-D- Thiogalactoside (IPTG) low temperature induction is overnight.Cell is harvested, then (contains 50mM biphosphate with lysis buffer Sodium, 300mM sodium chloride and 10mM imidazoles, pH 8.0) suspend simultaneously sonicated cells, after high speed centrifugation, crack supernatant Ni²⁺Parent (Ni-NTA, QIAGEN) is combined with pearl, method is according to product description.The His-BjMYB9 fusion protein of purifying is real for EMSA It tests.

Two, gel retardation assasies (EMSA)

Gel retardation assasy (EMSA) method referring to article description (Wang et al., 2014), slightly adjusts substantially.For The binding site of identification BjMYB9 synthesizes the complementary 5 ' end labels or non-containing W-box-like-4 element and its mutant Mark biotin BjC-P oligonucleotides it is single-stranded, and anneal obtain Double stranded oligonucleotide acid fragment W4, W4d (mutant of W4) and W5.Oligonucleotide sequence is single-stranded as follows: W4F (5 '-gcccagctagtgagtagtgactcatgaggtagagagaggg-3 '), W4R (5 '-ccctctctctacctcatgagtcactactcactagctgggc-3), W4RBio (5 '-ccctctctctacctc Atgagtcactactcactagctgggc-3 ', 5 '-biotin-labeled), W4d-F (5 '-gcccagctagtgagtagtc Atgaggtagagagaggg-3 '), W4d-R (5 '-ccctctctctacctcatgactactcactagctgggc-3 '), W4dRBio (5 '-ccctctctctacctcatgactactcactagctgggc-3 ', 5 '-biotin-labeled), W5F (5 '- Agggtggtccctctagtgactcatgagctagagagagggt-3 '), W5R (5 '-accctctctctagctcatgagtca Ctagagggaccaccct-3 '), W5RBio (5 '-accctctctctagctcatgagtcactagagggaccaccct-3 ', 5′-biotin-labeled).EMSA combination anchor is 10mM Tris hydrochloric acid (pH 7.5), 50mM sodium chloride, 1mM second two Amine tetraacethyl sodium (pH 7.5), 2mM dithiothreitol (DTT), 30% glycerol, 1mM magnesium chloride, 0.01% bovine serum albumin(BSA) (BSA), 0.1mg/ml milt DNA, 40fmol biotinylated DNA, 0-8pmol non-marked DNA, 15fmol His fusion protein.First exist Room temperature carries out competitive binding reaction in 30 minutes, then carries out the association reaction of 30 minutes biotinylated probes again.It Afterwards with 8% native gel electrophoresis, turn nylon membrane, is existed with crosslinking instrument (CL-1000Ultraviolet Crosslinker) 120mJ/cm²Under the conditions of be crosslinked 1 minute.Immunostaining is in strict accordance with Light ShiftR Chemiluminescent EMSA Kit kit specification carries out (Pierce, Rockford, IL, USA).

EMSA result is shown in Fig. 5, Fig. 5 B as the result is shown: BjMYB9 can not have with W4 specific bond with the mutant W4d of W4 There is combination；Fig. 5 C is as the result is shown: BjMYB9 can be in conjunction with W4, and with the gradually increasing of His-BjMYB9 protein content It is more, also enhance in conjunction with band concentration, but there is no any combination with W5.This result shows that BjMYB9 can in vitro with W- Box-like-4 element specific bond.

The internal specific binding assays of embodiment 5, His-BjMYB9 and W-box-like-4 element

The transient expression experiment of tobacco leaf:

The 6th blade of tobacco is injected when being fully deployed.The agrobacterium strains of the pBjMYB9 containing positive plasmid will be obtained EHA105, the promoter plasmid p16 bacterial strain of the core element containing fungal induction, the mutant plasmid of core element containing fungal induction p53 The internal standard carrier p57 bacterial strain (Gao et al., 2014) of bacterial strain and the gene containing LUC, culture containing kanamycins (50 μ g/ml) and On the LB culture medium of rifampin (30 μ g/ml), 28 DEG C grow 2 days, with MMA buffer (10mM magnesium chloride, 1mM 2- (N- morpholine) Ethanesulfonic acid (MES), 5.5,100 μM of acetosyringones of pH) it suspends, adjusting bacteria concentration OD600 is to be incubated in 1.5,28 DEG C of incubators 3 hours.Bacterium solution pBjMYB9, internal standard carrier p57 bacterium solution and p16 bacterium solution or p53 bacterium solution are by 1: 1: 1 mixing.Syringe needle is removed with 1mL Bacterium solution injection is grown in about 6 weeks the 5th and 6 leaf of Ben Shi cigarette, a piece of leaf sample is taken to carry out GUS after 48 hours by plastic injector Histochemical stain is decolourized with graded ethanol once dyeing terminates reaction, as a result sees Fig. 6 B.

Fig. 6 A shows that the promoter BjC-P of leaf mustard chitinase BjCHI1 and the GUS of its deleted segment building express matter Grain P16, P53 and BjMYB9 expression plasmid pBjMYB9 structural schematic diagram.Wherein in P16 containing W-box-like-4 element (- 668~-657), and P53 be by W-box-like-4 element core sequence TGAC missing.

Fig. 6 B is as the result is shown: after pBjMYB9 plasmid and P16 hybrid injection, can activate the gus gene table in P16 plasmid It reaches, but individually injects and expressed without GUS with the co-injection of P53 plasmid and P16, P53 and pBjMYB9.And P53 is compared with P16, only W-box-like-4 element mutations, illustrate BjMYB9 can in vivo with W-box-like-4 specific bond.

Symmetrical another leaf sample extracts total protein with protein extract (CCLR, Promega, Madison, WI, USA), Centrifugation draws 20 μ l protein extracts and adds 480 μ l GUS reaction solution (phosphate buffer of 0.1mol/l pH 7.0,0.5mol/ L sodium ethylene diamine tetracetate pH 8.0,0.1%Triton X-100,10mmol L -1 β mercaptoethanol, 0.1% lauroyl flesh ammonia Sour sodium, 1mmol/l 4-methyl umbelliferone-beta-D- glucuronic acid acid anhydride) mixing, 100 μ l of reaction mixture is drawn rapidly to be added To 900 μ l reaction terminating liquid (200mmol/l Na₂CO₃) in, remaining reaction solution is put in 37 DEG C of water-baths and is reacted, after 30min It takes out, quickly 100 μ l reaction solutions of absorption, which are added in 900 μ l reaction terminating liquids, mixes, with HITACHI F-4600FLUO- RESCENCE SPECTROPHOTOMETER instrument surveys 0min, 30min GUS activity.According to Promega company Luciferase The specification of Assay System, 20 μ l protein extracts add 100 μ l luciferase reaction (Luciferase Assay Reagent, Promega, Madison, WI, USA) mix, with 941 instrument of TriStar LB survey LUC activity (Gao et al., 2014), as a result see Fig. 6 C.

Fig. 6 C is as the result is shown: it is obvious individually to inject the active ratio of GUS with P16 for GUS activity after P16 and BjMYB9 co-injection Higher than P53, further illustrate that BjMYB9 and then can activate the promoter of BjC-P with specific bond in W-box-like-4 body Activity.

<110>Institute of Crop Science, Chinese Academy of Agricultural Science

<120>plant disease-resistant albumenBjMYB9 and its encoding gene and application

<160> 2

<210> 1

<211> 220

<212>amino acid

<400> 1

MetGlyValLysGlyLeuThrLeuTyrHisLeuLysSerHisLeuGlnLysPheArgLeuGlyArgGl nAlaCysLysGluSerThrGluAsnSerLysAspAlaSerCysValGlyGluSerGlnAspThrGlySerSerSer SerSerSerLeuArgMetAlaAlaGlnGluGlnAsnGluGlyTyrGlnValThrGluAlaLeuArgAlaGlnMETG luValGlnArgArgLeuHisGluGlnLeuGluTyrGlyGlnValGlnArgArgLeuGlnLeuArgIleGluAlaGl nGlyLysTyrLeuGlnSerIleLeuGluLysAlaCysGlnAlaPheAspAspGlnAlaAlaAlaPheValGlyLeu GluAlaAlaArgGluGluLeuSerGluLeuAlaIleLysValSerGlnGlyThrAlaValProPheLeuAspAlaT hrLysMetMetMetMetProSerLeuSerGluLeuGluValAlaIleAspThrLysAsnAsnIleThrThrAsnCy sSerValGluSerSerLeuThrSerAsnThrAsnGlySerSerValSerAlaAlaSerMetLysLysArgHisArg GlyAspAspValGlyLeuGlyTyrGluAlaGlyTrpIleValProSerSerThrIleGly

<210> 2

<211> 663

<212> DNA

<400> 2

ATGGGAGTGAAAGGCCTCACCCTCTACCACCTCAAATCACATCTCCAGAAATTCCGGCTAGGGAGGCAA GCTTGTAAAGAATCAACTGAGAACTCCAAGGATGCTTCTTGTGTTGGGGAGAGTCAGGACACAGGTTCATCTTCATC GTCATCACTGAGAATGGCAGCGCAGGAGCAGAACGAGGGTTACCAAGTCACTGAAGCTCTACGCGCTCAAATGGAAG TCCAAAGAAGACTACACGAGCAATTGGAGTATGGGCAGGTACAACGGAGACTCCAGCTGAGGATAGAGGCACAAGGA AAGTACTTACAATCGATCCTTGAGAAAGCTTGCCAGGCCTTTGACGACCAAGCTGCTGCTTTTGTTGGGCTCGAGGC AGCTAGGGAAGAGCTATCAGAGCTAGCCATCAAAGTGTCTCAAGGAACAGCAGTCCCGTTCTTAGATGCAACAAAGA TGATGATGATGCCATCTTTGTCTGAGCTTGAAGTAGCGATAGACACCAAAAACAACATCACAACCAACTGTTCGGTT GAAAGCTCTCTGACTTCCAACACCAATGGGAGCTCGGTTTCTGCTGCATCGATGAAGAAGCGGCATCGTGGAGACGA TGTAGGCCTAGGGTACGAGGCAGGGTGGATTGTGCCTAGTAGTACCATTGGATAA

Claims (10)

1. a kind of leaf mustard ill-resistant proteinBjMYB9, which is characterized in that its amino acid sequence is as shown in SEQ ID NO:1.

2. ill-resistant protein as described in claim 1BjThe encoding gene of MYB9.

3. gene as claimed in claim 2, which is characterized in that its nucleotide sequence is as shown in SEQ ID NO:2.

4. the recombinant vector comprising gene described in Claims 2 or 3.

5. the recombinant bacterium comprising gene described in Claims 2 or 3.

6. gene described in Claims 2 or 3 is regulating and controlling the application in disease resistance of the plant to Botrytis cinerea.

7. a kind of method for cultivating disease resistant transgenic plants, it is characterised in that: by channel genes described in claim 2 or 3 Into plant, screening obtains the plant that disease resistance improves, and the disease resistance refers to anti-Botrytis cinerea.

8. the method for claim 7, which is characterized in that the plant is crops.

9. method according to claim 8, which is characterized in that the crops are leaf mustard.

10. ill-resistant protein as described in claim 1BjApplication of the MYB9 as transcription factor, it is characterised in that energy and W-box- Like-4 element (GTAGTGACTCAT) specific bond, the activity of activation target gene.