CN112301051A - Method for improving soybean yield by GmUVR8 gene mutation and application thereof - Google Patents

Abstract

The invention provides a method for improving soybean yield by GmUVR8 gene mutation and application thereof; discloses amino acid sequences of 4 members GmUVR8a, B, c and d of soybean UV-B light receptor GmUVR8 gene family, and gene editing knockout is carried out in soybean; meanwhile, the edited soybean obtained by knocking out the four genes can obviously improve the yield-related plant agronomic characters, such as the number of branches, the number of main stem nodes, the number of single plant pods, the number of single plant grains and the weight of hundreds of grains, so that the yield of the soybean is improved; therefore, the gene mutation of GmUVR8 in soybean is an effective mode for promoting the yield increase of soybean, and has important production and theoretical research significance.

Description

Method for improving soybean yield by GmUVR8 gene mutation and application thereof

Technical Field

The invention relates to the field of plant genetic engineering, in particular to a method for improving soybean yield by GmUVR8 gene mutation and application thereof in improving the traits and yield of soybean and related plant types thereof.

Background

Soybeans, commonly known as soybeans, belong to annual herbaceous plants. The plant is originated from China, is one of important food crops and oil crops, is cultivated in all parts of China with long planting history, and is also widely cultivated in all parts of the world. Soybean oil is an important source of vegetable edible oil for human and animal nutrition and food processing. China is the main producing country and consuming country of soybean oil, but the autonomous supply of soybean in our country can not meet the consumption demand at all, and depends on import for a long time. Taking 2019 as an example, the yield of soybeans in China is 1965 ten thousand tons, the consumption is 10534 ten thousand tons, the import is 8851 ten thousand tons, and the import accounts for 84 percent of consumption. The downstream consumption mainly comprises 8856 ten thousand tons of squeezing consumption and 1311 ten thousand tons of edible consumption respectively, the squeezing consumption accounts for 84.07 percent, and the soybean is the first major source of edible oil in China (http:// www.chyxx.com). Along with economic development, the proportion of the soybeans in national economy is higher and higher, and the soybean protein has important significance for guaranteeing the food safety of China. The yield-related traits are important factors for determining high yield of the soybeans, such as increasing the number of branches and the number of main stem knots, correspondingly increasing the number of pods and seeds of a single plant, increasing the weight of hundreds of seeds of the single plant, further increasing the weight of seeds of the single plant, and finally achieving the increase of the yield of the soybeans. Therefore, the gene which can improve the traits related to the yield and increase the soybean yield is significant.

Ultraviolet light (UV) is an intrinsic component of the solar spectrum and can participate in regulating the growth and development of plants in a variety of ways and ways. Due to the existence of the atmosphere on the earth surface, the ozone layer in the atmosphere can completely absorb the UV-C with the wavelength of less than 280nm and most of the UV-B with the wavelength of 280-320nm, so that only a part of the UV-B and the UV-A with the wavelength of 320-400nm finally reach the ground. The influence on the plants (soybeans) is more obvious due to the short wavelength and high energy of the UV-B. As the ozone layer is increasingly destroyed, the amount of UV radiation received by the earth's surface is increasing. Studies in crops, especially soybeans, have shown that UV-B causes an increase in the number of empty pods and a significant reduction in yield in soybeans (Mazza et al, 2013; chimpango et al, 2007; Sullivan and Teramura, 1990). UVR8 is the only receptor for UV-B light found to date (Yin and Ulm, 2017). The UVR8 protein is well conserved in plant systems, homologous proteins of the UVR8 protein can be found in unicellular blue algae to higher plants, and four homologous genes exist in the UVR8 receptor protein of soybean, wherein the four homologous genes are respectively positioned at GmUVR8a, b, c and d. To date, there is no report demonstrating the function of GmUVR8, and thus improving soybean yield by manipulating GmUVR8 has profound practical significance.

Disclosure of Invention

The invention aims to provide a method for improving soybean yield by GmUVR8 gene mutation and application thereof in improving the traits and yield of soybeans and related plant types thereof.

In order to solve the technical problems, the invention adopts the following technical scheme:

a method for improving soybean yield by GmUVR8 gene mutation comprises the steps of mutating plant GmUVR8 gene family GmUVR8a, b, c and d by gene knockout, gene silencing or other means to obtain a GmUVR8 gene family mutant plant;

wherein the nucleic acid sequence of the GmUVR8a gene is shown as SEQ ID No. 1; the nucleic acid sequence of the GmUVR8b gene is shown as SEQ ID No. 2; the nucleic acid sequence of the GmUVR8c gene is shown as SEQ ID No. 3; the nucleic acid sequence of the GmUVR8d gene is shown as SEQ ID No. 4.

Furthermore, a gene knockout method is adopted to mutate the plant GmUVR8 gene family, and the method specifically comprises the following steps:

1) constructing a CRISPR/Cas9 gene knockout vector containing the sgRNA of the GmUVR8 gene;

2) introducing a CRISPR/Cas9 gene knockout vector containing GmUVR8 gene sgRNA into a receptor plant to obtain a transgenic plant with mutation of the GmUVR8 gene family;

3) progeny of the transgenic plants are screened for mutant plants of the GmUVR8 gene family that do not contain the CRISPR/Cas9 vector fragment.

The plant GmUVR8 gene family is mutated by a gene knockout method, and gene editing is mainly carried out on a host cell by using a CRISPR/Cas9 gene editing technology. In this technical system, Cas9 nuclease cleaves a DNA sequence complementary to the sgRNA recognition region under the sgRNA (single guide rna) guidance of GmUVR8 gene. When the GmUVR8 gene family is mutated at the same time, agrobacterium tumefaciens (GV3101) of a CRISPR/Cas9 gene editing vector containing sgRNA of different GmUVR8 gene family genes are mixed and transformed into host cells to obtain the GmUVR8 gene family mutant host.

The method for improving the yield of the soybeans by the GmUVR8 gene mutation can be applied to improving the yield and the characters of the soybeans and related plant types; the characters comprise the branch number of main stems, the knot number of main stems, the pod number of a single plant, the seed weight of a single plant and the weight of hundreds of seeds.

Has the advantages that:

the method provided by the invention can increase the branch number of the main stem, the pod number of a single plant, the seed number of the single plant, the seed weight of the single plant and the hundred-grain weight of the single plant in the yield characters of the soybean, and can promote the yield increase of the soybean. After gene mutation is carried out on the GmUVR8 gene family in soybeans, the branch number, the knot number, the pod number, the seed weight and the hundred-grain weight of a single plant of the main stem of the soybeans can be obviously increased, so that the yield of the soybeans is increased, and the yield increasing effect is obvious. Therefore, the plant type character obtained by gene mutation of GmUVR8 gene family in soybean is an ideal character for increasing the yield of soybean, and has important production and theoretical research significance.

Drawings

FIG. 1 is a schematic diagram of the whole plant types of the wild type and the Gmuvr8abcd mutant obtained by the present invention.

FIG. 2 shows the nucleotide information of the gene mutation site of the T4 generation strain Line H55 of the Gmuvr8abcd mutant.

FIG. 3 shows the branch number of main stem of Line H55 of Gmuvr8abcd mutant T4 generation strain and statistical results.

FIG. 4 shows the representation and statistical results of the knot number of main stem of Line H55 of T4 generation strain of Gmuvr8abcd mutant.

FIG. 5 shows the number of individual pods of Line H55 from the T4 generation strain of the Gmuvr8abcd mutant, and statistical results.

FIG. 6 is a graph showing the number of seeds of a T4 generation strain Line H55 of the Gmuvr8abcd mutant and statistical results.

FIG. 7 shows the statistics of seed weights of individual lines of Line H55 of T4 generation strain of Gmuvr8abcd mutant.

FIG. 8 shows the statistics of the single-strain hundred-grain weight of the T4 generation strain Line H55 of the Gmuvr8abcd mutant.

FIG. 9 shows the nucleotide information of the gene mutation site of the T4 generation strain Line H56 of the Gmuvr8abcd mutant.

FIG. 10 shows the branch number of main stem of Line H56 of Gmuvr8abcd mutant T4 generation strain and statistical results.

FIG. 11 shows the representation and statistical results of the knot number of main stem of Line H56 of T4 generation strain of Gmuvr8abcd mutant.

FIG. 12 shows the number of individual pods of Line H56 from the T4 generation strain of the Gmuvr8abcd mutant, and statistical results.

FIG. 13 is a graph showing the number of seeds per strain of Line H56 of the T4 generation strain of the Gmuvr8abcd mutant and statistical results.

FIG. 14 shows the statistics of seed weights of individual lines of Line H56 of T4 generation strain of Gmuvr8abcd mutant.

FIG. 15 shows the statistics of the single-strain hundred-grain weight of the T4 generation strain Line H56 of the Gmuvr8abcd mutant.

Detailed description of the invention

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental methods and apparatuses in the following examples are conventional methods and apparatuses unless otherwise specified. The test materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified. The determination of the mutant mutation sites in the following examples was determined by sequencing by conventional sequencing companies. In order to make the objects, technical solutions and advantages of the present invention more apparent, the following detailed description of the embodiments of the present invention is provided in connection with the specific embodiments. Examples of these preferred embodiments are illustrated in the specific examples.

It should be noted that, in order to avoid obscuring the technical solutions of the present invention with unnecessary details, only the technical solutions and/or processing steps closely related to the technical solutions of the present invention are shown in the embodiments, and other details that are not relevant are omitted.

In the examples, No. 6 Huachun was selected as the soybean cultivar. Huachun No. 6 is a soybean variety which is bred by agricultural college of southern China agricultural university and is bred by article Guizao No.1 multiplied by Brazil No. 8. The third meeting of the second national crop variety approval committee passes by 7 and 28 days in 2009, and the approval number is national approval bean 2009012.

Soybean CRISPR/Cas9 vector pGES 201: the description is as follows: bai M, Yuan J, Kuang H, et al.Generation of a multiple Mutagenesis ia poled CRISPR-Cas9 in Soybean [ J ]. Plant Biotechnology Journal,2019,18(3) ]: the public is available from horticulture center, the strait joint research institute, university of agriculture and forestry, fujian.

Example 1

Application of 4 gene mutations of GmUVR8 gene families (GmUVR8a, GmUVR8b, GmUVR8c and GmUVR8d) in improving soybean yield and related plant type traits.

The nucleic acid sequences of the encoding genes of the GmUVR8 gene families (GmUVR8a, GmUVR8b, GmUVR8c and GmUVR8d) are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO. 4.

Construction of CRISPR/Cas9 gene knockout vector of GmUVR8 gene family

1. sgRNA design of GmUVR8 gene family.

sgRNAs were designed by CRISPR-GE (http:// skl.scau.edu.cn/home /) on-line tool in the DNA regions of the target genes GmUVR8a, GmUVR8b, GmUVR8c, GmUVR8d, respectively. 2 sgRNAs were selected in which the GmUVR8a gene is located in the third exon (sgRNA-1 sequence: GATTTTGGAAGGTTGGGTCATGG and sgRNA-2 sequence: GATAAAGCAAATTGCCTGTGGG). sgRNA common to the three genes was selected for the GmUVR8b, GmUVR8c, and GmUVR8d genes (sgRNA-3 sequence: GAGGATGGACAGTTAGGCCATGG). Designing primer sequences with joints according to the selected three sgRNAs as follows:

sgRNA-1 Forward primer：ggattGATTTTGGAAGGTTGGGTCA

sgRNA-1 Reverse primer：aaacTGACCCAACCTTCCAAAATCa

sgRNA-2 Forward primer：ggattGGATAAAGCAAATTGCCTGT

sgRNA-2 Reverse primer：aaacACAGGCAATTTGCTTTATCCa

sgRNA-3 Forward primer：ggattGAGGATGGACAGTTAGGCCA

sgRNA-3 Reverse primer：aaacTGGCCTAACTGTCCATCCTCa

2. annealing oligonucleotides of sgRNA primers to double strands

Forward primer and Reverse primer oligonucleotides for sgRNA were diluted to 10 μ M. An annealing reaction system is prepared according to the following system:

reagent	Amount of the composition used	Final concentration
			Forward primer(10uM)	5ul	1uM
Reverse primer(10uM)	5ul	1uM
			NaCl(1M)	5ul	100mM
Tris-Cl(pH7.4)(1M)	2.5ul	50mM
			Sterile ddH2O	Up to50ul

Mixing the prepared annealing reaction system, placing the mixture on a PCR instrument after short-time centrifugation, and operating the following procedures:

95℃4min，RAMP 0.1℃/S，95℃to 16℃，Keep 16℃

the annealed double-stranded sgRNA can be used immediately or stored at-20 ℃ for a long period of time.

3. pGES201 vector enzyme digestion linearization

The 1ug pGES201 vector was digested with BsaI. After the digestion, the linearized vector was recovered by agarose gel. The recovered linearized vector is quantified, typically at a working concentration of 50-100 ng/ul.

4. Double-stranded sgRNA was ligated to the linearized pGES201 vector

Double-stranded sgRNA	1ul
		Linearized pGES201 vector (50-100 ng/. mu.l)	3ul
10x T4 DNA ligase Buffer	1ul
		T4 DNA ligase	0.5ul
Sterile ddH2O Up to 10ul	Ligation reaction at 16 ℃ for 2h or overnight

The ligation product is a CRISPR/Cas9 gene knockout vector with GmUVR8 gene sgRNA.

5. Transformation of Escherichia coli and Agrobacterium with ligation products

After 10ul of ligation product was added to 100ul of E.coli DH5 α competent, chemical transformation: placing a DH5 alpha competence sample mixed with a ligation product on ice for 30min, placing the mixture in a water bath at 42 ℃ for 90s, immediately placing the mixture on ice for 3min, adding 1ml of LB culture medium, placing the mixture in a shaking table at 37 ℃ and 200rpm, culturing for 1h, centrifuging at 4000rpm for 5min, removing supernatant, using the rest culture medium to resuspend bacteria liquid, coating the bacteria liquid on an LB culture dish containing kanamycin (30ug/ml) resistance, culturing in an incubator at 37 ℃ for about 24h, growing bacterial plaque, performing amplification culture, extracting plasmids by using a rapid plasmid small extraction kit (Tiangan, China), sequencing, and determining the sequence to be a positive cloning vector. We obtained three CRISPR/Cas9 positive cloning vectors: pGES 201-sgRNA-1; pGES 201-sgRNA-2; pGES 201-sgRNA-3.

pGES 201-sgRNA-1; pGES 201-sgRNA-2; pGES201-sgRNA-3 plasmid was chemically transformed into Agrobacterium GV 3101. Competent GV3101(100ul) was placed on ice, 1ug of plasmid (pGES 201-sgRNA-1; pGES 201-sgRNA-2; pGES201-sgRNA-3) was added, mixed well, placed on ice for 30min, placed in liquid nitrogen for quick freezing for 1min, quickly transferred to a 37 ℃ water bath for 5min, placed on ice for 3min, added with 1ml of YEB medium, and cultured on a shaker at 28 ℃ and 200rpm for 4 h. After centrifugation at 4000rpm for 5min to remove the supernatant, the suspension was resuspended in the remaining medium and plated on YEB plates containing three types of resistance, rifampicin (30ug/ml), gentamicin (30ug/ml) and kanamycin (30ug/ml), and incubated at 37 ℃ in an incubator for about 48 h. The growing single clone was identified with the clone pcr (pcr product size about 350 bp). Positive clones were used for stable transformation of soybean.

Cloning pcr identification primers:

forward primer on pGES201 vector:

pGES201 Forward primer：gtaaaacgacggccagt

reverse primers for each of the three sgrnas:

sgRNA-1 Reverse primer：aaacTGACCCAACCTTCCAAAATCa

sgRNA-2 Reverse primer：aaacACAGGCAATTTGCTTTATCCa

sgRNA-3 Reverse primer：aaacTGGCCTAACTGTCCATCCTCa

PCR amplification procedure: 3min at 95 ℃ for 30 s; annealing at 55 ℃ for 30 s; extension at 72 ℃ for 30s for a total of 30 cycles.

Second, stable transformation of soybean

Soybean cultivar Huachun No. 6 was used as a recipient material, and stable transformation was carried out by the cotyledonary node method (method references: Paz M, Martinez J C, Kalvig A B, et al, improved transgenic node method using an alternative expression from a selected Plant for the expression of Agrobacterium-mediated soybean transformation [ J ] Plant Cell Reports,2006,25 (3): 248-. To obtain plants with simultaneous mutations in the four genes GmUVR8a, GmUVR8b, GmUVR8c, GmUVR8d (methods in reference: Bai M, Yuan J, Kuang H, et al. Generation of a multiple Mutagenesis powder particle CRISPR-Cas9 in Soybean [ J ]. Plant Biotechnology Journal,2019,18 (3)), Agrobacterium GV3101 from pGES201-sgRNA-1 and pGES201-sgRNA-3 positive clones was subjected to 1: 1 and mixing. pGES201-sgRNA-1 was also subjected to 1: 1 and mixing. And infecting and transforming the mixed agrobacterium tumefaciens to the prepared soybeans.

Placing the soybeans infected by the agrobacterium into a dedifferentiation culture medium for culturing for 4 days, transferring the soybeans to a redifferentiation culture medium for culturing for 7 days, transferring the soybeans to a resistant redifferentiation culture medium containing Basta for culturing for 14 days, transferring the soybeans to a resistant redifferentiation culture medium containing phytohormone and Basta for culturing for 28 days, and transferring the soybeans to a root induction culture medium for culturing. The plants obtained were transferred to soil for growth and grown in a 1: 1000 dilution Basta is sprayed to screen positive seedlings.

Screening and identification of GmUVR8 gene family mutant

DNA of leaves of the positive seedlings is extracted and used as a template, and fragments of about 700bp upstream and downstream of sgRNA of four genes of GmUVR8a, GmUVR8b, GmUVR8c and GmUVR8d are obtained by a PCR method and sequenced. Marking the plants which have a sequencing result that a hybrid peak appears at the position of the sgRNA and editing occurs, wherein the plants are edited T1. After obtaining seeds of edited T1 generation, sequencing identification is carried out continuously (at the moment, the genes are also subjected to heterozygous editing), the edited plants are subjected to generation addition in a greenhouse, the greenhouse is at 25 ℃, under 14h illumination/10 h dark condition, sequencing identification is carried out on each generation until the T4 generation obtains plants of which GmUVR8a, GmUVR8b, GmUVR8c and GmUVR8d all have homozygous mutation, and vector fragments cannot be detected (transgenic fragments are removed). Stably transformed seeds of T4 generation homozygous mutation are used for plant type character determination and yield determination.

The sequencing primers for identification and editing of four genes, namely GmUVR8a, GmUVR8b, GmUVR8c and GmUVR8d, are distributed as follows:

GmUVR8a Forward primer：TCTCTCAGCACAAGGGGCTG

GmUVR8a Reverse primer：GACTGTTCCCTAAATCAAATGGGC

GmUVR8b Forward primer：CTTCTTCGTATCCATGTCCATGG

GmUVR8b Reverse primer：AGGTCAAATACTCCACCTTCATG

GmUVR8c Forward primer：CCATGGAATTGGAAGTCACCG

GmUVR8c Reverse primer：ATGAAGTGAGTCAACCGACATTC

GmUVR8d Forward primer：ATGTTGAAAGAGTCGCCGAGA

GmUVR8d Reverse primer：AGAGCATACTAACTAATTTGCCG

PCR amplification procedure: 30s at 95 deg.C for 3 min; annealing at 55 ℃ for 30 s; extension at 72 ℃ for 1min for a total of 30 cycles.

Fourth, yield-related traits (branch number of main stem, knot number of main stem, pod number of single plant, seed weight of single plant and hundred grain weight)

The soybean measured was a T4 generation homozygous mutant, planted in an outdoor soybean planting isolation region at the end of 4 months, and planted in a pot. The planting pots were 85cm long by 30cm wide by 30cm high. Four plants were grown per pot, 22 pots per strain, and 88 total plants per strain. And (4) counting the branch number of the main stem, the knot number of the main stem, the pod number of a single plant, the seed number of the single plant, the seed weight of the single plant and the weight of the hundred grains during harvesting. The main stem branch number refers to effective branches which grow on the main stem and have more than two sections and at least one section has a fruit pod; the node number of the main stem refers to the node number from the first node of the leaf trace of the son to the top of the plant; the number of individual pods refers to the number of pods on an individual plant that therefore contain one or more filled seeds. The number of seeds of a single plant is the number of seeds of the whole plant; the weight of each seed and the weight of each hundred grains are the total weight of one seed and the weight of one hundred grains taken out randomly (if the weight of each seed is less than one hundred grains, the weight is calculated according to a formula: the weight of each seed/the number of the seeds x 100), and the unit is gram. Statistical analysis of differences was performed using GraphPad Prism 7 analysis software, and t-test calculation (p): p <0.05 (); p <0.01(×); p <0.001(×); p <0.0001 (. multidot.).

Five results

1.GmUVR8 gene family mutant T4 generation strain Line H55

The nucleotide information of gene mutation sites of four genes, namely GmUVR8a, GmUVR8b, GmUVR8c and GmUVR8d, in T4 generation Line H55 of GmUVR8 gene family mutant is shown in figure 2, the main stem branch number is shown in figure 3, the main stem node number is shown in figure 4, the pod number of a single plant is shown in figure 5, the seed number of a single plant is shown in figure 6, the seed weight of a single plant is shown in figure 7 and the grain weight of a single plant is shown in figure 8.

The results show that compared with the recipient strain Huachun No. 6 (Huachun6), the GmUVR8 gene family mutant Line H55 has the advantages that the branch number of main stems is increased by 14.74%, the node number of the main stems is increased by 16.00%, the pod number of a single plant is increased by 10.81%, the seed number of the single plant is increased by 11.12%, the seed weight of the single plant is increased by 25.04% and the hundred grain weight of the single plant is increased by 14.78%.

2. GmUVR8 gene family mutant T4 generation strain Line H56

The nucleotide information of gene mutation sites of four genes, namely GmUVR8a, GmUVR8b, GmUVR8c and GmUVR8d, of a GmUVR8 gene family mutant T4 generation Line H56 is shown in figure 9, the number of main stem branches is shown in figure 10, the number of main stem nodes is shown in figure 11, the number of fruit pods of a single plant is shown in figure 12, the number of seeds of a single plant is shown in figure 13, the weight of seeds of a single plant is shown in figure 14 and the weight of seeds of a single plant is shown in figure 15.

The results show that compared with the recipient strain Huachun No. 6 (Huachun6), the GmUVR8 gene family mutant Line H56 has 21.09% increase of main stem branch number, 19.58% increase of main stem node number, 36.59% increase of single plant pod number, 28.42% increase of single plant seed number, 40.11% increase of single plant seed weight and 9.76% increase of single plant hundred weight.

References and cited experimental methods:

1.Mazza,C.A.,Gimenez,P.I.,Kantolic,A.G.,and Ballare,C.L.(2013).Beneficial effects of solar UV-B radiation on soybean yield mediated by reduced insect herbivory under field conditions.Physiol Plant 147,307-315.

2.Chimphango S.B.,Brown C.F.,Musil C.F.,Dakora F.D.(2007).Effects of UV-B radiation on seed yield of Glycine max and an assessment of F1 generation progeny for carryover effects.Physiol Plant.131,378-386.

3.Sullivan J.H.,Teramura A.H.(1990).Field Study of the Interaction between Solar Ultraviolet-B Radiation and Drought on Photosynthesis and Growth in Soybean.Plant Physiol.92,141-146.

4.Yin R.,Ulm R.(2017).How plants cope with UV-B:from perception to response.Curr Opin Plant Biol.37:42-48.

5.Paz M M,Martinez J C,Kalvig A B,et al.Improved cotyledonary node method using an alternative explant derived from mature seed for efficient Agrobacterium-mediated soybean transformation[J].Plant Cell Reports,2006,25(3)：248-248.

6.Bai M,Yuan J,Kuang H,et al.Generation of a Multiplex Mutagenesis Population via Pooled CRISPR-Cas9 in Soybean[J].Plant Biotechnology Journal,2019,18(3).

<110> Fujian agriculture and forestry university

Method for improving soybean yield by gene mutation of <120> GmUVR8 and application thereof

<160> 4

<210> 1

<211> 1449

<212> DNA

<213> Soybean (Glycine max (L.) Merr.)

<400> 1

atgaaatgtt attttgatgg acaatacagg ataagatgcg aaaaaacaac agagaaatca 60

aattctttca tcatcaatga tataaactcc ttgctcctct tgactcattc attcactccc 120

aatatgatgg aattggaagc caccgccgct acttccccac cttctcgcgt tctcctcatc 180

tccgcaggtg ccagccacac cgttgccctt ctctctggga atgttgtgtg ttcgtggggt 240

cgcggagagg acggacagtt aggccatggt gacaccgatg ataggccctt acccacgcag 300

ctcagtgcat tggatgccca acacattgat tctattgcct gtggagctga tcataccctt 360

gcgtattccg aatcacgcaa tgaactctat agttggggat ggggtgattt tggaaggttg 420

ggtcatggca attctagtga tttgctcatt cctcagccta ttatagcatt gcaaggtcta 480

aggataaagc aaattgcctg tggggatagc cactgtttgg cagttaccat ggaaggcgag 540

gttcagagtt gggggaggaa tcaaaatggt caacttggac ttggcaacac agaggattct 600

cttgtgccac aaaagattca agcgtttaag ggagttccta tcaaaatggt tgctgcaggt 660

gcagaacaca gtgtagctat tactgaaaat ggagaactgt atggatgggg ttggggccga 720

tatggaaatt tggggttggg agatagaaat gatcgctgga atcctgagaa agtttcttct 780

gttgattgtg acaagatggt catggttgct tgtggttggc ggcatacaat ttctgtttca 840

tcttctggtg gcatatacac atacgggtgg agcaaatatg gccagctagg acatggaaat 900

tttgaggatt ctcttgtgcc tcagaagctt caagccttga gtgataagtt aatctctcag 960

gtatcaggtg gttggaggca tagtatggca ctcacgtcta ctggactact atttggatgg 1020

ggttggaata agtttggaca ggttggagtc ggtgacaatc ttgatcactg ctctcctgtg 1080

caagtgaagt tcccccaaga tcagagagta gttcagatct catgtgggtg gaggcacaca 1140

attgctgtaa ctgaaaagga aaatgtattt tcttggggaa gaggcacaaa tgggcaactt 1200

gggcatgggg ataccattga ccggaattct ccaaagatta ttgaggcatt gagtgtggat 1260

ggatctgctg ggccgcacat agaatcctca aacactgatc tattgtcagg gaaaagtggc 1320

gtctccttat ctgagagata tgcagttgtg ccggacgaaa ctgtctcagg acaaactgct 1380

agttcaagca gtggagatag gcttgaaatt agtgtcccag aaagtgatgt caaacggctc 1440

cgtgtttga 1449

<210> 2

<211> 1314

<212> DNA

<213> Soybean (Glycine max (L.) Merr.)

<400> 2

atggaagatg aagtgatgag tgaagtggct gctccacctc gtcgtgttct tcttgtatcg 60

gctggtgcca gccacagtgt ggcacttctg agtggaaatg ttgtttgttc gtggggacga 120

ggagaggatg gacagttagg ccatggtgac actgatgatc gactatttcc tacaaaactg 180

agtgcattgg atggccaaga cataatatgt gttacttgtg gagctgatca tactatggca 240

cgttctgagt ctggcaggga tgtatatagt tggggatggg gtgactttgg aaggttgggt 300

catggtgatc atagtgactt gctcattcct catcccataa aagcattaca gggtctaatg 360

atacaacaaa ttgcctgtgg ggacagtcat tgtttggcag ttaccatgga cagccaggtg 420

ctgagttggg gacgcaatca aaatggtgaa cttggacttg gaaccgcaga ggactctctt 480

ctgccacaaa aaattcaaat ttttgaggaa atacctatca aaatggttgc tgctggtgct 540

gaacatagtg tagcaatcac taaagatggg aatttgtatg gatggggctg gggccgatat 600

ggaaacttgg gattgggtga cagaaacgat cgattgctgc ctgagaaagt gactgttgat 660

ggtgacaaga tggccatggt tgcttgtggc tggcggcaca caatatgtgt ttcatcttct 720

ggtggattat acacaaatgg atggggcaaa tacggccagc taggacatgg ggattttgag 780

gatcatcttg tgcctcgcaa ggttcaagcc ttgagtgata agttcatttc gcaggtatca 840

ggtgggtgga ggcatagtat ggcactcacg tctagtggac aacttttggg ctggggatgg 900

aataagttcg gacagattgg agttggtaac aattttgatt gttgctctcc catgcaagtg 960

aactttcccc atgatcagaa agtacaaatg atctcatgcg ggtggagaca cacgattgct 1020

gttactgaac gtgagaatgt atattcttgg ggaagaggag caaatggaca acttgggaat 1080

ggagaaacca tagaccgcaa tgttccaaca attattgagg ccttcagtgt tgatggatct 1140

tccggacagc acatagaatc ctcaaaacct tatccatcat cagggaaatc ctcgtcctcc 1200

atatcagaga gatatgcaat tgttccagat gaaactgcct cgggatcaca acctacaact 1260

tcagaagagg gaaataggca tgataccagt gtccctgaaa gtgatgtcaa ttga 1314

<210> 3

<211> 1425

<212> DNA

<213> Soybean (Glycine max (L.) Merr.)

<400> 3

atgctgcact cttcaagtct actctttctc tctccttcca ctggtcccat caatgttata 60

aacccttgcc cctctttctc ttctctcttc cctcccatta ccatggaatt ggaagtcacc 120

gccgctactt ctccaccttc tcgcgttctc ctcatctccg ccggtgccag ccacaccgtt 180

gcccttctct ctgggaatgt tgtgtgctcg tggggtcgcg gagaggatgg acagttaggc 240

catggtgaca ccgatgatag actcttaccc actcatctca gtgcattgga tgctcaacaa 300

attgattcta ttgcatgtgg agctgatcat acccttgcgt attccgaatc acgcaatgaa 360

ctctatagtt ggggatgggg tgattttgga aggttgggtc atggcaattc tagtgatttg 420

ctcattcctc agcctattat agcattgcaa ggtctaagga taaagcaaat tgcctgtggg 480

gatagccact gtttggcagt taccatggaa ggcgaggttc agagttgggg gaggaatcaa 540

aatggtcaac ttggacttgg cacctcggag gattctcttg tgccacaaaa gattcaaaca 600

tttcagggag tacctatcaa aatggttgct gcaggtgcag aacacagtgt agctattact 660

gaaaatggag aactgtatgg atggggttgg ggccgatatg gaaatttggg gttgggggat 720

agaaatgatc gctggattcc tgagaaagtt tcttctgttg attgtgacaa gatggtcatg 780

gttgcttgtg gttggcggca tacaatttct gtttcatctt tgggtggctt atacacatat 840

gggtggagca aatatggcca gttaggacat ggaaattttg aggattctct tgtgcctcaa 900

aagcttcaag ccttgagtga taagttaatc agtcaggtat cgggtggttg gaggcatagt 960

atggcactga cgtctactgg actactatat ggatggggtt ggaataagtt tggacaggtt 1020

ggagttggtg acaatgttga tcgttgctct cctgtgcaag tgaagttccc ccatgatcag 1080

aaagtagttc agatctcatg tgggtggaga cacacaattg ctgtaactga aaaggaaaat 1140

gtattttctt ggggaagagg cacaaatggg caacttgggc atggggatac cgttgaccgg 1200

aattctccaa agattattga ggcattgagt gtggatggat cttccgggcc gcacatagaa 1260

tcctcaaaca ctgatctatt gtcagggaaa agtggtgcct ccttatctga gagatatgca 1320

gttgttccgg atgaaactgt ctcaggacaa actgctagtt caagcagtgg agataggctt 1380

gatatcagtg tcccagaaag tgatgtcaaa cggatccgag tttga 1425

<210> 4

<211> 1017

<212> DNA

<213> Soybean (Glycine max (L.) Merr.)

<400> 4

atgttgaaag agtcgccgag acgaagaatc aaaaatataa ctggaaatgt tgtttgctcg 60

tgggggcgag tagaggatgg acagttaggc catggtgaca ctgatgatcg acttttgcct 120

acaaaactga gtgcattgga tggccaagac ataatatgtg ttacttgtgg agctgatcat 180

actatggcac gttctgagtc tggcagggat ggacgtaatc aaaatggtga acttggactt 240

ggaaccacag aggactctct tctgccacaa aaaattcaaa aatttgaggg aatacctatc 300

aaaatggttg ctgccggtgc tgaacatagt gtagcaatca ctgaagatgg gaatttgtat 360

ggatggggtt ggggccgata tggaaacttg ggattggatg gtagaaagta cgtcatccta 420

aacttgcttg gtgacaagat ggccatggtt gcttgtggct ggcggcatac aagatgtgtt 480

tcatcttctg gtggattata cacaactgga tggggcaaat acggccagct aggacatggg 540

aattttgagg atcatcttgt gcctcgcaag gttcaagcct tgagtgacaa gttcatttcg 600

caggacttct ttctggtatc aggtgggtgg aggcatagta tggcactcac gtctaattat 660

tgctctccca tgcaagtgaa ctttccccat gatcagaaag tacgtcagat ctcatgcggg 720

tggagacaca cgattgctgt tactgaacgt gagaatgtat attcttgggg aagaggagca 780

aatggacaac tttggaatgg agaaaccata gaccccaatg ttccaatgat tattaaggcc 840

ttcagtgttg atggatcttc cgggcagcac atagaatcct caaaacctta tccaacatca 900

gggaaatcct tgtcctccat atcaaagaga tatgcaattg ctccagatga aactgcctca 960

ggatcacagc ctactaattc agaaggggga gataggcatg ataccagtgt cccttaa 1017

Claims (4)

1. A method for improving soybean yield by GmUVR8 gene mutation is characterized in that plant GmUVR8 gene family GmUVR8a, b, c and d are mutated to obtain a GmUVR8 gene family mutant plant;

   wherein the nucleic acid sequence of the GmUVR8a gene is shown as SEQ ID No. 1; the nucleic acid sequence of the GmUVR8b gene is shown as SEQ ID No. 2; the nucleic acid sequence of the GmUVR8c gene is shown as SEQ ID No. 3; the nucleic acid sequence of the GmUVR8d gene is shown as SEQ ID No. 4.
2. 2. The method for improving soybean yield by mutation of GmUVR8 gene according to claim 1, wherein the method for obtaining the mutant plant of GmUVR8 gene family by mutating plant GmUVR8 gene family by gene knockout method comprises the following steps:

   1) constructing a CRISPR/Cas9 gene knockout vector containing the sgRNA of the GmUVR8 gene;

   2) introducing a CRISPR/Cas9 gene knockout vector containing GmUVR8 gene sgRNA into a receptor plant to obtain a transgenic plant with mutation of the GmUVR8 gene family;

   3) progeny of the transgenic plants are screened for mutant plants of the GmUVR8 gene family that do not contain the CRISPR/Cas9 vector fragment.
3. Application of the method for improving soybean yield by GmUVR8 gene mutation is characterized by being applied to improving the traits and yield of soybean and related plant types thereof.
4. 4. Use of the GmUVR8 gene mutation in a method for increasing soybean yield according to claim 3, wherein the traits comprise main stem branch number, main stem node number, pod number per plant, seed weight per plant and hundred grain weight per plant.

Images