CN113968899B - Preparation method of long-fruit tomato material - Google Patents

Abstract

The application discloses a preparation method of a long-fruit tomato material. The application provides a protein which is obtained from tomatoes and named as SlFS8.1 protein and is shown as a sequence 1 in a sequence table. The gene for coding the SlFS8.1 protein is named as the SlFS8.1 gene and also belongs to the protection scope of the application. The application also provides a plant breeding method, which comprises the following steps: and carrying out gene editing on the SlFS8.1 gene in the plant, thereby obtaining the plant with long fruits. The application has important application and popularization value for breeding long-fruit tomatoes.

Description

Preparation method of long-fruit tomato material

Technical Field

The application belongs to the technical field of agricultural biology, and relates to a preparation method of a long-fruit tomato material.

Background

Tomatoes are a vegetable and fruit crop which is widely planted worldwide and are deeply favored by consumers. The fruit shape of tomatoes is an important economic trait. Most of the current fresh tomato fruits are round, long-fruit tomatoes are fewer, and the long-fruit tomatoes are pressure-resistant and special in shape, so that the tomato fruits are one of important directions for improving the tomato fruits.

Technically, tomato variety cultivation mainly utilizes traditional means of hybridization and backcrossing to improve tomato fruit shape, and the method has long period, generally needs 5-10 years, and is limited by factors such as linkage encumbrance and the like.

Disclosure of Invention

The application aims to provide a preparation method of a long-fruit tomato material.

The present application provides a protein, designated as slfs8.1 protein, obtained from tomato, as follows (a 1) or (a 2) or (a 3):

(a1) Protein shown in a sequence 1 in a sequence table;

(a2) Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues for the protein shown in the sequence 1 in the sequence table and is related to tomato fruit shape and is derived from the protein;

(a3) A protein derived from tomato and having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the amino acid sequence defined in (a 1) and being associated with tomato fruit shape.

The tomato fruit shape is round and/or long.

The gene for coding the SlFS8.1 protein is named as the SlFS8.1 gene and also belongs to the protection scope of the application.

The slfs8.1 gene is specifically (b 1) or (b 2) or (b 3) or (b 4) as follows:

(b1) A DNA molecule with a coding region shown as a sequence 2 in a sequence table;

(b2) DNA molecules shown in a sequence 3 in a sequence table;

(b3) A DNA molecule derived from tomato and having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with (b 1) or (b 2) and encoding said protein;

(b4) A DNA molecule which hybridizes under stringent conditions to the nucleotide sequence defined in (b 1) or (b 2) and which encodes said protein.

The stringent conditions may be as follows: 50℃in 7% Sodium Dodecyl Sulfate (SDS), 0.5M NaPO ₄ And 1mM EDTAHybridization in mixed solution, rinsing in 2 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.5 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 50 ℃; the method can also be as follows: 50℃in 7% SDS, 0.5M NaPO ₄ Hybridization with 1mM EDTA, rinsing in 0.1 XSSC, 0.1% SDS at 65 ℃; the method can also be as follows: hybridization was performed in a solution of 6 XSSC, 0.5% SDS at 65℃and then washed once with 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS; the method can also be as follows: hybridization and washing the membrane 2 times at 68℃in a solution of 2 XSSC, 0.1% SDS for 5min each time, and hybridization and washing the membrane 2 times at 68℃in a solution of 0.5 XSSC, 0.1% SDS for 15min each time; the method can also be as follows: hybridization and washing of membranes were performed at 65℃in 0.1 XSSPE (or 0.1 XSSC), 0.1% SDS solution.

Expression cassettes, recombinant vectors or recombinant microorganisms containing the slfs8.1 gene are all within the scope of the application.

The application also protects the application of the SlFS8.1 protein, which is (c 1) or (c 2) as follows:

(c1) Regulating and controlling the fruit shape of the plant;

(c2) Regulating the shape of tomato.

The tomato shape is round and/or long.

The application also provides a plant breeding method, which comprises the following steps: and carrying out gene editing on the SlFS8.1 gene in the plant, thereby obtaining the plant with long fruits. The plant may be a plant of the Solanaceae family. The plant may be a Lycopersicon plant. The plant is a plant with round fruits. The plant may specifically be tomato variety AC. The gene editing is specifically achieved by means of Cas9 technology. The target sequence binding region in the sgRNA is shown as nucleotide numbers 2-21 in sequence 4 of the sequence table. The sgRNA is specifically shown as a sequence 4 in a sequence table.

The application also provides a plant breeding method, which comprises the following steps: inhibiting the expression of the SlFS8.1 gene in the plant, thereby obtaining the plant with long fruits. The plant may be a plant of the Solanaceae family. The plant may be a Lycopersicon plant. The plant is a plant with round fruits. The plant may specifically be tomato variety AC.

The application also provides a plant breeding method, which comprises the following steps: reducing the content and/or activity of the SlFS8.1 protein in the plant, thereby obtaining the plant with long fruits. The plant may be a plant of the Solanaceae family. The plant may be a Lycopersicon plant. The plant is a plant with round fruits. The plant may specifically be tomato variety AC.

The application also provides a method for preparing a gene editing plant, comprising the following steps: introducing recombinant plasmid into the receptor plant to obtain transgenic plant, and screening from the transgenic plant to obtain gene editing plant; the recombinant plasmid is provided with a coding gene of Cas9 protein and a coding gene of sgRNA; the target sequence of the sgRNA is positioned in the SlFS8.1 gene; the fruit shape of the gene editing plant is a long fruit shape. The plant may be a plant of the Solanaceae family. The plant may be a Lycopersicon plant. The plant is a plant with round fruits. The plant may specifically be tomato variety AC. The target sequence binding region in the sgRNA is shown as nucleotide numbers 2-21 in sequence 4 of the sequence table. The sgRNA is specifically shown as a sequence 4 in a sequence table. The recombinant plasmid can be specifically obtained by inserting the coding DNA of the target sequence binding region into the BsaI enzyme cutting site of the CRISPR/Cas9 vector.

The application also provides a method for preparing a gene editing plant, comprising the following steps: introducing a recombinant plasmid expressing the sgRNA gene and a recombinant plasmid expressing the Cas9 gene into a receptor plant to obtain a transgenic plant, and screening the transgenic plant to obtain a gene editing plant; the target sequence of the sgRNA is positioned in the SlFS8.1 gene; the fruit shape of the gene editing plant is a long fruit shape. The plant may be a plant of the Solanaceae family. The plant may be a Lycopersicon plant. The plant is a plant with round fruits. The plant may specifically be tomato variety AC. The target sequence binding region in the sgRNA is shown as nucleotide numbers 2-21 in sequence 4 of the sequence table. The sgRNA is specifically shown as a sequence 4 in a sequence table.

The application utilizes the CRISPR/Cas9 method to carry out gene editing on the SlFS8.1 gene of the round-fruit tomato, thus obtaining the long-fruit tomato. The application can obtain a new variety of plant with changed fruit type within 1 year, and the traditional breeding method needs continuous backcross and selfing, at least 3-4 years, and the method has simple operation and low cost, and greatly quickens the breeding process. The application has important application and popularization value for breeding long-fruit tomatoes.

Drawings

FIG. 1 is a photograph of the fruit of the test plant (1 cm length in right lower corner).

Figure 2 is a statistical data of aspect ratio of the fruits of the test plants (asterisks indicate significant differences in aspect ratio of fruits of plants edited using the t-test gene from wild type).

Detailed Description

The following examples facilitate a better understanding of the present application, but are not intended to limit the same. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the examples described below, unless otherwise specified, were purchased from conventional biochemical reagent stores. The quantitative tests in the following examples were all set up in triplicate and the results averaged.

CRISPR/Cas9 vector: i.e., pTX041 in document "Deng et al Efficient generation of pink-fruited tomatoes using CRISPR/Cas9 system, journal of Genetics and Genomics 45 (2018) 51-54".

Tomato variety AC, also known as tomato variety Ailsa Craig, also known as wild tomato, is derived from the American tomato genetic resource center (TGRC, http:// TGRC. Ucdavis. Edu /), accession number LA2838A.

A novel protein is found from tomatoes and named as SlFS8.1 protein, and is shown as a sequence 1 in a sequence table. In tomato, the gene encoding the SlFS8.1 protein is named as the SlFS8.1 gene, an open reading frame in cDNA is shown as a sequence 2 of a sequence table, and a part from a start codon to a stop codon in genomic DNA is shown as a sequence 3 of the sequence table (exons 1-392 and 502-1057 in the sequence 3).

Fruits with aspect ratios greater than 1 are defined as long fruits. Fruits with aspect ratio less than or equal to 1 are defined as round fruits. Aspect ratio refers to the ratio of length to width. Length refers to the longest diameter of the fruit perpendicular to the pedicel portion. Width refers to the longest diameter of the fruit parallel to the pedicel portion.

Example 1 tomato SlFS8.1 Gene editing Using CRISPR/Cas9 method to obtain Long fruit tomato

1. Construction of recombinant vectors

1. Two single-stranded DNA molecules are prepared separately and then annealed together to obtain a double-stranded DNA molecule having sticky ends at both ends.

The nucleotide sequences of the two single stranded DNA molecules are respectively as follows:

5’-TTTGAGTAGATCAGTCTCAGACGG-3’；

5’-AAACCCGTCTGAGACTGATCTACT-3’。

2. and taking the CRISPR/Cas9 vector, and carrying out enzyme digestion by using restriction enzyme BsaI to recover a vector framework.

3. And (3) connecting the double-stranded DNA molecules with the sticky ends at the two ends obtained in the step (1) with the vector skeleton obtained in the step (2) to obtain the recombinant plasmid. The recombinant plasmid has been subjected to sequencing verification. The recombinant plasmid expresses sgRNA shown in a sequence 4 in a sequence table. The target sequence binding region in the sgRNA is shown as nucleotide numbers 2-21 in sequence 4 of a sequence table.

2. Preparation of Gene editing plants

1. And (3) taking the recombinant plasmid prepared in the step (A), and introducing the recombinant plasmid into agrobacterium LBA4404 to obtain the recombinant agrobacterium.

2. And (3) taking the recombinant agrobacterium obtained in the step (1), and carrying out genetic transformation on the wild tomato by using an agrobacterium-mediated method to obtain a T0 generation plant.

(1) Selecting full and large tomato seeds, soaking the tomato seeds in 75% ethanol water solution for 2min, then soaking the tomato seeds in 10% NaClO water solution for 10min, washing the tomato seeds with sterile water for 7 times, and sowing the tomato seeds in a seed growth medium and culturing the tomato seeds for 8 days. Taking cotyledons, cutting the cotyledons into small blocks under aseptic conditions, inoculating the cotyledon blocks into a preculture medium and culturing for 2 days, and taking the cotyledon blocks as explants.

Seed growth medium: 2.2g of MS salt, 30g of sucrose and water are mixed, the volume is fixed to 1L by using water, the pH is adjusted to between 5.8 and 6.0 by using 1mol/L KOH, agar is added to ensure that the concentration is 0.8 percent, and the mixture is sterilized under high pressure.

Pre-culture medium: 4.4g of MS salt, 1.0mg of Zeatin (Zeatin) and 30g of sucrose are dissolved in water, the volume is fixed to 1L with water, the pH is adjusted to between 5.8 and 6.0 with 1mol/L KOH, agar is added to bring the concentration to 0.8%, and the mixture is autoclaved.

(2) Taking the recombinant agrobacterium obtained in the step 1, and re-suspending the recombinant agrobacterium with 50mL of liquid MS culture medium to obtain OD _600nm The bacterial suspension with the concentration of being=0.4 is added with 50 mu L of 0.074mol/L acetosyringone water solution, and the bacterial suspension is the infection liquid.

Liquid MS medium: mixing 4.4g of MS salt, 30g of sucrose and water, fixing the volume to 1L by using water, adjusting the pH to between 5.8 and 6.0 by using 1mol/L KOH, and sterilizing under high pressure.

(3) Immersing the explant obtained in the step (1) in the immersion liquid obtained in the step (2) for 10min, and then inoculating the explant to a preculture medium for 2 days.

(4) After the completion of step (3), the explants were inoculated to the selection differentiation medium for 8 weeks (subculture every 2 weeks) at which time resistant shoots were grown on the explants.

Screening the differentiation medium: 4.4g of MS salt, 2.0mg of zeatin, 50mg of kanamycin, 100mg of inositol, 0.5mg of folic acid and 20g of sucrose are dissolved in water, the volume is fixed to 1L by water, the pH is adjusted to between 5.8 and 6.0 by 1mol/L KOH, agar is added to make the concentration of the mixture be 0.8%, and the mixture is subjected to high-pressure sterilization.

(5) And (3) when the length of the resistant bud in the step (4) is 3cm, cutting the resistant bud, transferring the resistant bud to a rooting culture medium for culture, and obtaining a rooted plant which is a T0 generation plant.

Rooting medium: 4.4g of MS salt, 50mg of kanamycin, 0.5mg of folic acid, 0.5mg of indolebutyric acid and 30g of sucrose are dissolved in water, the volume is fixed to 1L by water, the pH is adjusted to between 5.8 and 6.0 by 1mol/L KOH, agar is added to make the concentration of the agar be 0.8%, and the mixture is sterilized under high pressure.

Culture conditions of the whole process: 25 ℃, 16h light/8 h darkness.

3. Homozygous mutant plants were selected from T0 generation plants.

The screening method comprises the following steps: and taking genomic DNA of plant leaves, carrying out PCR amplification by adopting a primer pair consisting of F1 and R1, and recovering PCR amplification products and sequencing.

F1：5′-ATGCAATCAGATTATGAAATGG-3′；

R1：5′-GAGGCTGTGTACAGTATCGCTC-3′。

2 plants with homozygous mutation (mutations were located in the target sequences of the primer pair consisting of F1 and R1 in the SlFS8.1 gene) were selected and designated as plant 6 and plant 7, respectively.

The "AGTAGATCAGTCTCAGACGGCGG" substitution in plant 6 was "AGTAGATCAGCGG" and homozygous substitution (i.e., identical substitution occurred for both chromosomes) compared to wild type tomato. Such substitution results in a frame shift mutation of the gene CDS sequence from position 232, premature generation of a stop codon, translation of a truncated protein which loses the DNA binding domain, and thus loss of function of the slfs8.1 protein (the plant does not contain slfs8.1 protein).

The "AGTAGATCAGTCTCAGACGGCGG" substitution in plant 7 was "AGTAGATCAGTCTCAGAACGGCGG" and homozygous substitution (i.e., identical substitution occurred for both chromosomes) compared to wild type tomato. The substitution causes a frame shift mutation of the gene CDS sequence from position 239, a stop codon is generated in advance, and truncated proteins losing the DNA binding domain are translated, so that the function of the SlFS8.1 protein is lost (the plant does not contain the SlFS8.1 protein).

4. And normally culturing the plant 6, selfing to obtain seeds, namely T1 generation seeds, and culturing the T1 generation seeds into plants, namely T1 generation plants. And normally culturing the plant 7, selfing to obtain seeds, namely T1 generation seeds, and culturing the T1 generation seeds into plants, namely T1 generation plants.

5. Plants without exogenous DNA were selected from T1 generation plants.

The screening method comprises the following steps: and taking genomic DNA of plant leaves, and performing PCR (polymerase chain reaction) amplification by adopting a primer pair consisting of F2 and R2 (the target sequence of the primer pair consisting of F2 and R2 is positioned in a Cas9 gene in a CRISPR/Cas9 carrier, the amplification product is expected to be about 402 bp), wherein if the obtained amplification product indicates that the plant contains exogenous DNA, and if the obtained amplification product does not indicate that the plant does not contain exogenous DNA.

F2：5′-TTGACAAGCTGTTCATCCAG-3′；

R2：5′-CCTTCGTAATCTCGGTGTTC-3′。

About 1/4 of the individuals in the T1 generation plant population obtained from plant 6 did not contain exogenous DNA.

About 1/4 of the individuals in the T1 generation plant population obtained from plant 7 contained no exogenous DNA.

6. And (3) extracting genomic DNA of leaves from the plants obtained by screening in the step (5), carrying out PCR amplification by adopting a primer pair consisting of F1 and R1, recovering PCR amplification products and sequencing.

The plants without exogenous DNA obtained by screening from the T1 generation plants obtained by the plant 6 are homozygously replaced by the gene SlFS8.1 which is the same as the plant 6. The plants without exogenous DNA screened from the T1 generation plants obtained from the plant 7 are homozygously replaced by the gene SlFS8.1 which is the same as the plant 7. The result shows that the mutation generated by introducing the recombinant plasmid prepared in the first step into the wild tomato can be stably inherited from the T0 generation to the T1 generation.

The plants selected from the T1 generation plants obtained from the plant 6 and not containing the exogenous DNA are all named 6-SlFS8.1 gene editing plants. The plants selected from the T1 generation plants obtained from the plant 7 and not containing the exogenous DNA are all named 7-SlFS8.1 gene editing plants.

3. Fruit observation

The plants tested were: 6-SlFS8.1 gene editing plant, 7-SlFS8.1 gene editing plant, wild tomato plant.

1. The seedlings of the tested plants are cultivated under the conditions of 25 ℃ and 16h illumination/8 h darkness until the plants grow to 4-5 leaves.

2. After the step 1 is completed, the plants (10 plants of each tested plant and consistent growth vigor) are transplanted into a greenhouse. The plant spacing and the row spacing are above 60 cm; the plants tested are randomly distributed; and the normal water and fertilizer management ensures that the water and fertilizer conditions of all plants are basically consistent.

After 3 months of transplanting, the plants begin to enter a fruiting period, which lasts for about 6 months. Mature fruits were collected throughout the fruiting period.

6-SlFS8.1 gene editing plants, the average number of mature fruits harvested in the whole fruiting period of each plant is 50, and the mature fruits are all long fruits.

7-SlFS8.1 gene editing plants, the average number of mature fruits harvested in the whole fruiting period of each plant is 60, and the mature fruits are all long fruits.

The average number of mature fruits harvested from each plant during the whole fruiting period of wild tomato is 56, and the fruits are round fruits.

Exemplary results for partial fruits are shown in fig. 1.

The aspect ratio (average) of the fruits of each test plant is shown in fig. 2.

The fruits of the slfs8.1 gene editing plants were transformed from round to long compared to the fruits of the wild tomato plants.

The result shows that the SlFS8.1 gene and the protein coded by the same can regulate the fruit shape of tomatoes, and circular tomato materials can be converted into long tomato materials by carrying out gene editing on the SlFS8.1 gene.

The present application is described in detail above. It will be apparent to those skilled in the art that the present application can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the application and without undue experimentation. While the application has been described with respect to specific embodiments, it will be appreciated that the application may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the application following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the application pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

SEQUENCE LISTING

<110> institute of genetic and developmental biology of national academy of sciences

Qingdao national institute of agricultural science

<120> preparation method of long tomato material

<130> GNCYX200499

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 315

<212> PRT

<213> Solanum lycopersicum

<400> 1

Met Gln Ser Asp Tyr Glu Met Gly Gly Ile His Gln Glu Cys Glu Asp

1 5 10 15

Glu Pro Arg Phe Met Val Glu Asn Asn Ala Ser Thr Ser Ser Pro Phe

20 25 30

Tyr Pro Asn Tyr His Phe Pro Pro Thr Ser His Pro Ile Leu Gln Gln

35 40 45

Ile His Ser Leu Pro Ile Thr Gln His Phe Phe Pro Tyr Gln His Ala

50 55 60

His Tyr Arg Ser Met Ser Glu Glu Ile Arg Val Asp Gln Ser Gln Thr

65 70 75 80

Ala Glu Leu Val Ala Phe Pro Ala Ser Glu Ile Arg Gly Gly Gln Glu

85 90 95

Asp Ala Leu Ile Arg Gly Ser Glu Arg Tyr Cys Thr Gln Pro Arg Gln

100 105 110

Thr Cys Val Ala Val Trp Gln Asn Gln Glu Asp Ser Ala Met Lys Gln

115 120 125

Pro Val Trp Lys Gly Glu Tyr Ser Asn Gly Asn Ala Ile Glu Lys Asn

130 135 140

Lys Gln Glu Glu Asp Glu Glu Leu Tyr Ser Leu Glu Glu Thr Asn Lys

145 150 155 160

Arg Arg Val Val Phe Gly Glu Leu Glu Ala Ile Cys Ile Arg Gly Ile

165 170 175

Ala Ser Glu Ser Ala Asp Asn Leu Pro Thr Asn His Asn Val Thr Phe

180 185 190

Pro Glu Leu Ala Leu Asn Glu Ala Met Val Asn Lys Met Asp Asn Thr

195 200 205

Met Gly Lys Phe His Lys Arg Lys Arg Gly Lys Asp Glu Trp Gly Arg

210 215 220

Phe Phe Lys Ser Leu Val Lys Lys Leu Ala Asn His Gln Glu Asp Leu

225 230 235 240

Gln Arg Ser Leu Met Glu Thr Met Glu Arg Leu Asp Gln Glu Arg Lys

245 250 255

Glu Arg Glu Glu Leu Trp Arg Glu Lys Glu Leu Glu Lys Leu Gln Asn

260 265 270

Glu Glu Ala Ala Arg Ala His Glu Arg Arg Leu Ala Ser Thr Arg Glu

275 280 285

Ala Ala Leu Val Ser Cys Leu Glu Lys Leu Thr Gly Gln Lys Ile Asp

290 295 300

Phe Gln Thr Phe Lys Ile Lys Glu Asp Glu Thr

305 310 315

<210> 2

<211> 948

<212> DNA

<213> Solanum lycopersicum

<400> 2

atgcaatcag attatgaaat gggtgggatc catcaagagt gtgaagatga gcctagattc 60

atggtggaaa ataatgcttc cacttcttcc ccattttacc caaactatca cttccctccg 120

acgtctcatc ctattctcca acaaatccac agtttaccga ttactcaaca ttttttccct 180

tatcaacatg ctcattacag atctatgtca gaagaaataa gagtagatca gtctcagacg 240

gcggagttag tggcttttcc tgcaagtgaa ataagaggag gacaagaaga tgctttgatt 300

cgtgggagtg agcgatactg tacacagcct cgacaaactt gtgtagctgt ttggcaaaac 360

caagaagatt ctgctatgaa acaacctgtt tggaaaggag aatattcaaa tggaaatgca 420

attgagaaaa acaaacaaga agaagatgag gaattgtata gtttagaaga aactaataaa 480

cgtagagtag tattcggaga gttagaagct atttgtattc gtggaattgc atctgaatct 540

gctgataatt tgccaaccaa ccacaatgtc acttttcctg aattggctct caatgaagcc 600

atggttaaca aaatggataa tactatgggt aaatttcata aaaggaagag agggaaagat 660

gaatggggaa gatttttcaa gtcattagtg aagaaactgg cgaaccacca agaagatcta 720

caaagaagtt tgatggaaac aatggagaga ttagatcaag aaagaaaaga aagagaagaa 780

ttatggagag agaaagaatt agaaaaactc caaaatgaag aagctgctag agcccatgaa 840

agaagattgg cttcaactag agaagctgct cttgtttctt gcttagaaaa actcacaggt 900

cagaaaattg attttcaaac attcaaaata aaggaagacg aaacctga 948

<210> 3

<211> 1057

<212> DNA

<213> Solanum lycopersicum

<400> 3

atgcaatcag attatgaaat gggtgggatc catcaagagt gtgaagatga gcctagattc 60

atggtggaaa ataatgcttc cacttcttcc ccattttacc caaactatca cttccctccg 120

acgtctcatc ctattctcca acaaatccac agtttaccga ttactcaaca ttttttccct 180

tatcaacatg ctcattacag atctatgtca gaagaaataa gagtagatca gtctcagacg 240

gcggagttag tggcttttcc tgcaagtgaa ataagaggag gacaagaaga tgctttgatt 300

cgtgggagtg agcgatactg tacacagcct cgacaaactt gtgtagctgt ttggcaaaac 360

caagaagatt ctgctatgaa acaacctgtt tggtaatctt ttctgcactc aatcacatgt 420

aaatctctcc cgtacaccct accctattaa ttaatataaa tattaatatt ttattattat 480

tattattttt gatttatgta ggaaaggaga atattcaaat ggaaatgcaa ttgagaaaaa 540

caaacaagaa gaagatgagg aattgtatag tttagaagaa actaataaac gtagagtagt 600

attcggagag ttagaagcta tttgtattcg tggaattgca tctgaatctg ctgataattt 660

gccaaccaac cacaatgtca cttttcctga attggctctc aatgaagcca tggttaacaa 720

aatggataat actatgggta aatttcataa aaggaagaga gggaaagatg aatggggaag 780

atttttcaag tcattagtga agaaactggc gaaccaccaa gaagatctac aaagaagttt 840

gatggaaaca atggagagat tagatcaaga aagaaaagaa agagaagaat tatggagaga 900

gaaagaatta gaaaaactcc aaaatgaaga agctgctaga gcccatgaaa gaagattggc 960

ttcaactaga gaagctgctc ttgtttcttg cttagaaaaa ctcacaggtc agaaaattga 1020

ttttcaaaca ttcaaaataa aggaagacga aacctga 1057

<210> 4

<211> 97

<212> RNA

<213> Artificial sequence

<400> 4

gaguagauca gucucagacg gguuuuagag cuagaaauag caaguuaaaa uaaggcuagu 60

ccguuaucaa cuugaaaaag uggcaccgag ucggugc 97

Claims (6)

1. A plant breeding method comprising the steps of: carrying out gene editing on a gene of the plant, which codes for a protein shown in a sequence 1 in a sequence table, so as to obtain a plant with long fruits; the plant is tomato.

2. A plant breeding method comprising the steps of: inhibiting the expression of a gene encoding a protein shown in a sequence 1 in a sequence table in a plant, thereby obtaining a plant with long fruits; the plant is tomato.

3. A plant breeding method comprising the steps of: reducing the content of protein shown in sequence 1 in a sequence table in the plant, thereby obtaining a plant with long fruits; the plant is tomato.

4. A method of making a gene-editing plant comprising the steps of: introducing recombinant plasmid into the receptor plant to obtain transgenic plant, and screening from the transgenic plant to obtain gene editing plant; the recombinant plasmid is provided with a coding gene of Cas9 protein and a coding gene of sgRNA; the target sequence of the sgRNA is positioned in a gene for encoding a protein shown as a sequence 1 in a sequence table; the fruit shape of the gene editing plant is a long fruit shape; the plant is tomato.

5. A method of making a gene-editing plant comprising the steps of: introducing a recombinant plasmid expressing the sgRNA gene and a recombinant plasmid expressing the Cas9 gene into a receptor plant to obtain a transgenic plant, and screening the transgenic plant to obtain a gene editing plant; the target sequence of the sgRNA is positioned in a gene for encoding a protein shown as a sequence 1 in a sequence table; the fruit shape of the gene editing plant is a long fruit shape; the plant is tomato.

6. The method according to claim 1 or 2 or 4 or 5, characterized in that: the gene for encoding the protein shown in the sequence 1 in the sequence table is (b 1) or (b 2) as follows:

(b1) A DNA molecule with a coding region shown as a sequence 2 in a sequence table;

(b2) A DNA molecule shown in a sequence 3 in a sequence table.