CN101942448A - Novel functions of salt and drought tolerance of cotton nodulin-like gene and application thereof - Google Patents
Novel functions of salt and drought tolerance of cotton nodulin-like gene and application thereof Download PDFInfo
- Publication number
- CN101942448A CN101942448A CN2009101575058A CN200910157505A CN101942448A CN 101942448 A CN101942448 A CN 101942448A CN 2009101575058 A CN2009101575058 A CN 2009101575058A CN 200910157505 A CN200910157505 A CN 200910157505A CN 101942448 A CN101942448 A CN 101942448A
- Authority
- CN
- China
- Prior art keywords
- gene
- nodulin
- cotton
- salt
- drought
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
Abstract
The invention discloses novel functions of a cotton nodulin-like gene with a genebank accession number of AY217332 and protein encoded by the cotton nodulin-like gene with a genebank accession number of AAO60108. The cotton nodulin-like gene fulfills the novel functions of salt tolerance and drought tolerance. The cotton nodulin-like gene is converted to arabidopsis through an agrobacterium-mediated transformation method, and the salt tolerance and the drought tolerance of a transgenic plant are both increased compared with that of a wild plant. The gene plays an important role in breading a crop with strengthened salt and drought tolerance.
Description
Technical field
The present invention relates in the plant to coerce relevant gene and coded product and application, particularly salt tolerant, drought-enduring gene and a coded product thereof and its application in cultivating salt tolerant, drought tolerance raising plant in the cotton with anti-.
Background technology
The nodulin gene is the gene of host plant specifically expressing in root nodule bacterium and the leguminous plants symbiotic nitrogen fixation process, participates in growth, growth and the formation of regulation and control root nodule, plays an important role in symbiosis nodulation and nitrogen fixation process.Its function mainly comprises: neutral molecules such as water molecules and glycerine, methane amide stride the film transportation function; Participate in the regeneration of cytodifferentiation and cell walls; The response process of organizing generation and signal transduction functionality and participating in osmotic stress.Along with going deep into of research, people also have been isolated and cloned into the class nodulin gene with leguminous plants nodulin dna homolog from non-leguminous plant, it is similar to leguminous plants nodulin gene that the function of these genes has, what have then all is very different on expression pattern and function, wherein can class nodulin gene participate in the response process of osmotic stress, plays the extensive concern what kind of effect has been subjected to people in adverse circumstance.
Summary of the invention
The purpose of this invention is to provide a new salt tolerant of cotton nodulin-like gene, drought-enduring function.
Salt tolerant provided by the present invention, drought-enduring gene are the cotton nodulin-like genes of announcing among the genebank, and accession number is: AY217332
The salt tolerant of cotton nodulin-like gene provided by the present invention, drought tolerance function will play a significant role in cultivating resistance and resistance of reverse enhanced plant (particularly cotton).
Description of drawings
Fig. 1 is the sepharose detected result of RT-PCR amplification cotton nodulin-like eDNA
Fig. 2 is for changeing cotton nodulin-like gene Arabidopis thaliana PCR qualification result
Fig. 3 is for changeing cotton nodulin-like gene Arabidopis thaliana RT-PCR qualification result
Fig. 4 is for changeing the phenotype after cotton nodulin-like gene Arabidopis thaliana salt stress is handled
Fig. 5 is for changeing the survival rate after cotton nodulin-like gene Arabidopis thaliana salt stress is handled
Fig. 6 is for changeing the phenotype after cotton nodulin-like gene Arabidopis thaliana drought stress is handled
Fig. 7 is for changeing the survival rate after cotton nodulin-like gene Arabidopis thaliana drought stress is handled
Embodiment
All methods are ordinary method if no special instructions among the following embodiment.
The clone of embodiment 1, cotton nodulin-like gene
The sequences Design primer that provides according to genebank:
Upstream primer: 5 '-
GGGGACAAGTTTGTACAAAAAAGCAGGCTATTTCATAAGTGTCTTTTCTCTTCCTTTG-3’
Downstream primer: 5 '-
GGGGACCACTTTGTACAAGAAAGCTGGGTTGAGGAAAGAAAGATTATTATTAATAATAG-3’
(band underscore part base is a recombination sequence)
Total RNA is a template with Y18 children flower bud, and RT-PCR amplification cotton nodulin-like cDNA sequence: concrete grammar may further comprise the steps:
1, the extraction of total RNA:
1) 0.2g refrigerated material is put into the mortar of precooling, grind to form powdery, pour in the 2mL centrifuge tube, add the basic extracting solution that 1mL is preheated to 80 ℃, 10 μ l DTT stock solutions and 25 μ l Proteinase K stock solutions, mixing;
2) 42 ℃, 100rpm, gentleness was shaken 90 minutes;
3) every pipe adds 80 μ l 2mol/L KCl solution, adjusts the KCl final concentration to 160mmol/L, ice bath 1 hour;
4) 12, centrifugal 20 minutes of 000rpm gets 900 μ l supernatant liquors, adds 300 μ l 8mol/L LiCl, mixing, the precipitation of spending the night on ice;
5) 12, centrifugal 20 minutes of 000rpm abandons supernatant, and precipitation is washed 2～3 times with 2mol/L LiCl (ice precooling), and is colourless until supernatant liquor;
6) suspension LiCl-RNA is deposited in 400 μ l 10mmol/L Tris-Cl (pH7.5), mixing, and 12, centrifugal 10 minutes of 000rpm shifts supernatant to new centrifuge tube;
7) the 2mol/L KAc (pH5.5) of adding 1/10 volume, mixing, ice bath 15 minutes;
8) 12, centrifugal 10 minutes of 000rpm removes the insoluble substance that desalts, and gets supernatant;
9) spend the night or-70 ℃ of precipitations 2～3 hours in-20 ℃ of precipitations with the dehydrated alcohol of 2.5 times of volumes;
10) with 70% cold washing with alcohol RNA precipitation, vacuum rapid drying is dissolved in the DEPC water;
11) add RNase-Free DNase, 37 ℃, 30 minutes;
12) add isopyknic chloroform: the primary isoamyl alcohol extracting;
13) spend the night or-70 ℃ of precipitations 2～3 hours in-20 ℃ of precipitations with the dehydrated alcohol of 2.5 times of volumes;
14) with 70% washing with alcohol precipitation, drying;
15) RNA is dissolved in the water that DEPC handles standby.
2, the first chain cNDA's is synthetic: with ReverTra Ace-α-ThermoScript II test kit that company is spun by Japan, operate by the test kit specification sheets: reaction system:
RNA(1-5μg) 11.0μl
RNase?Inhibitor(10U/μl) 1.0μl
5×RT?buffer 4.0μl
dNTP?Mixture(10mmol/L?each) 2.0μl
Oligo(dT)20(10pmol/μl) 1.0μl
ReverTra?Ace 1.0μl
total 20.0μl
Reaction conditions: 42 ℃, 20min; 99 ℃, 5min; 4 ℃, 5min; Moment is centrifugal ,-20 ℃ of preservations.
3, RT-PCR amplification cDNA
The PCR reaction system:
cDNA 1.0μl
Reaction buffer (10X) 5.0 μ l
dNTP(2.5mmol/L?each) 4.0μl
Upstream primer (10 μ M) 1.0 μ l
Downstream primer (10 μ M) 1.0 μ l
Taq enzyme (2.5U/ μ l) 1.25 μ l
ddH
2O 36.75μl
total 50.0μl
Reaction conditions: 95 ℃, 5min; 95 ℃, 30 seconds; 55 ℃, 45 seconds; 72 ℃, 2min30s; 35 circulations; 72 ℃, 5min; 4 ℃, pause.
After reaction finishes, the PCR product is carried out 0.8% agarose gel electrophoresis detect, detected result (swimming lane M is marker, and swimming lane 1 is cotton nodulin-like RT-PCR product) as shown in Figure 1 obtains the band that molecular weight is about 1.5kb, conforms to expected results.Reclaim test kit (sky, Beijing root company) with sepharose and reclaim this fragment, should reclaim fragment then and be connected with pMD18-T (KAKARA company) carrier.
Linked system:
PCR reclaims product 3.0 μ l
pMD18-T 1.0μl
T4?DNA?Ligase 1.0μl
Reaction buffer (10X) 1.0 μ l
ddH
2O 4.0μl
total 10.0μl
16 ℃ of incubated overnight.
With above-mentioned connection product transformed into escherichia coli TOP10 competence.The reorganization system is added in the competent cell solution, and mixing was put 30 minutes on ice gently.Handled 90 seconds 42 ℃ of following heat shocks, put on ice ice bath 2 minutes immediately.Add 500 μ l LB liquid nutrient mediums, 37 ℃ of shaking table 180rp m cultivated 45 minutes, were coated on then on the LB solid medium of penbritin (50mg/L), were inverted cultivation and spent the night for 37 ℃, and screening positive clone obtains recombinant plasmid called after T-NL.With M13-47 on this carrier and M13-48 promoter sequence is that primer carries out nucleotide sequencing to it, sequencing result shows the mRNA (accession number: AY217332) different on the 373rd and 1030 that goes up the nodulin-like gene of the cotton of submitting to genebank, two sites all are that " G " replaced " A ", but nucleotide sequence is translated into aminoacid sequence, by sequence alignment, find to go up the protein sequence (number of submitting to of landing: AAO60108.1) in full accord with NCBI.
The structure of embodiment 2, cotton nodulin-like plant expression vector
Utilize the GATEWAY system constructing plant expression vector of Invitrogen company, T-NL among the embodiment 1 and entry vector pDONR211 are carried out the BP recombining reaction, nodulin-like cDNA is recombinated on the pDONR211.
The BP system of recombinating:
T-NL plasmid (50～100ng) 1.0 μ l
pDONOR221(30～50ng) 0.5μl
BP?enzyme?Mix 1.0μl
ddH2O 2.5μl
total 5.0μl
25 ℃ are incubated 1 hour, add 1 μ l Proteinase K, and 37 ℃, the 10min termination reaction.
With recombinant products transformed into escherichia coli TOP10 competence, obtain positive colony through blocking that screening, with recon called after pDONR211-NL.
Extract positive colony plasmid pDONR211-NL, utilize the LR recombining reaction that the nodulin-like fragment is recombinated on the plant expression vector pH7WG2.
The LR system of recombinating:
PDONOR221-NL plasmid (50～100ng) 1.0 μ l
pH7WG2(30～50ng) 0.5μl
LR?enzyme?Mix 0.5μl
ddH
2O 0.5μl
total 2.5μl
25 ℃ are incubated 1 hour, add 1 μ l Proteinase K, and 37 ℃, the 10min termination reaction.
With above-mentioned recombinant chou is transformed into escherichia coli TOP10 competence, obtains positive colony through the spectinomycin screening, with recon called after pH7WG2-NL.
The screening and the acquisition of embodiment 3, cotton nodulin-like transgenic arabidopsis
1, cotton nodulin-like plant expression vector arabidopsis thaliana transformation
Operate with gene pulser Xcell electroporation (U.S. Bio Rad company) and with reference to specification sheets, plasmid pH7WG2-NL is transformed Agrobacterium LBA4404 with the electric shock conversion method, screen through the resistant panel that contains Rifampin and spectinomycin and to obtain the Agrobacterium positive colony, utilize again and dip in colored method, under the mediation of above-mentioned positive colony Agrobacterium with the pH7WG2-NL arabidopsis thaliana transformation.
2, resistance screening transfer-gen plant
Dip in the seed of receiving after colored method transforms, plant the positive seedling of screening on the 1/2MS substratum that contains Totomycin (20mg/L) resistance after the sterilization.Treat it to be moved in the soil when positive seedling on the flat board grows four true leaves, covering the preservative film water conservation throws off two days later, seedling grows 8-10 sheet true leaf and clip blade when more sturdy but cultivate, carry genomic dna and identify whether be transgenic line, identify that correct transgenic line is designated as T1 for transgenic line.
3, the PCR of transgenic arabidopsis identifies
1) extraction of genomic dna
Edwards extracts damping fluid: 200mmol/L Tris-Cl (pH 7.5), 250mmol/L NaCl, 25mmol/L EDTA, 0.5%SDS
Get 1-2 sheet vanelets and put into the EP pipe; Add 400 μ lEdwards and extract damping fluid and grind, under the room temperature 12, centrifugal 10 minutes of 000rpm.Supernatant liquor is dropwise added (about 350 μ l) in isopyknic Virahol, placed 20 minutes for-20 ℃; Under the room temperature 14, centrifugal 10 minutes of 000rpm; Outwell supernatant, precipitation is with 70% washing with alcohol 2 times; DNA is dried up, add 40 μ l ddH
2O, 37 ℃ of dissolving DNAs
2) PCR of transfer-gen plant identifies
With step 1 genomic dna is template, under the guiding of upstream primer: 5 '-TGCCCAGCTATCTGTCACTTCATC-3 ' and downstream primer: 5 '-AATTGGCATGGTGAGCTTAGGC-3 ', method with PCR is identified transfer-gen plant, wherein upstream primer is according to the design of plant expression vector pH7WG2 35 promoter sequences, and downstream primer is according to cotton nodulin-like cDNA sequences Design.
The PCR reaction system:
Genomic dna 1.0 μ l
Reaction buffer (10X) 2.0 μ l
dNTP(2.5mmol/L?each) 1.6μl
Upstream primer (10 μ M) 0.5 μ l
Downstream primer (10 μ M) 0.5 μ l
Taq enzyme (2.5U/ μ l) 0.5 μ l
dd?H
2O 13.9μl
total 20.0μl
Reaction conditions: 95 ℃, 5min; 95 ℃, 30 seconds; 58 ℃, 45 seconds; 72 ℃, 2min30s; 35 circulations; 72 ℃, 5min; 4 ℃, pause.
After reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis to be detected, (swimming lane M is marker to detected result, and swimming lane 1-5 is different transgenic line, and swimming lane 6 is the wild-type plant as shown in Figure 2, swimming lane 7 positive plasmids, swimming lane 8 negative water contrasts) all transgenic lines amplify the band of about 800bp, and consistent with positive plasmid amplified band size, conform to the expection size, wild-type does not then have amplified band, shows that goal gene successfully changes in the Arabidopis thaliana.
3) RT-PCR of transfer-gen plant identifies
Respectively total RNA of the leaf of the used wild-type of extraction step 2 and 5 transgenic lines respectively gets the total RNA of 2 μ g and carries out reverse transcription, and RNA extracts the EASY spin plant RNA rapid extraction test kit with reference to Gai Ning company, the method in the reverse transcription reference example 1.With this reverse transcription product is template, at cotton nodulin-like cDNA special primer (upstream primer: TGCCAGCAGCCACATTTCTC; Downstream primer: GGATGCACCATGACATTACGC.) guiding carries out down RT-PCR detection (is interior mark with Actin2).
The PCR reaction system
cDNA 1.0μl
Reaction buffer (10X) 5.0 μ l
dNTP(2.5mmol/L?each) 4.0μl
Upstream primer (10 μ M) 1.0 μ l
Downstream primer (10 μ M) 1.0 μ l
Taq enzyme (2.5U/ μ l) 1.25 μ l
ddH
2O 36.75μl
total 50.0μl
Reaction conditions: 95 ℃, 5min; 95 ℃, 30 seconds; 58 ℃, 30 seconds; 72 ℃, 30 seconds; 30 circulations; 72 ℃, 5min; 4 ℃, pause.After reaction finishes, the PCR product is carried out 1% agarose gel electrophoresis to be detected, (swimming lane 1-5 is different transgenic lines to detected result as shown in Figure 3, swimming lane 6 is wild-type strain system), used transgenic line has all amplified nodulin-like band clearly, and wild-type does not have, and illustrates that nodulin-like is successfully to change in the Arabidopis thaliana.
The phenotype of the commentaries on classics cotton nodulin-like gene Arabidopis thaliana after embodiment 4, salt stress are handled
Be sprinkling upon the 1/2MS flat board uniformly after the seed-coat sterilization, 4 ℃ of lucifuge vernalization 2～3d, put into the illumination box growth (22 ℃, 16h/ illumination 8h dark, light intensity～4000LUX).Behind about 3～4d seedling moved on to and contain on the 200mmol/LNaCl salt flat board.The survival rate of statistics plant behind 6～7d, turning white with whole strain plant is death standard.Phenotype is observed as shown in Figure 4, on 200mmol/L salt flat board, changes nodulin-like gene plant survival rate and is higher than wild-type.Transfer-gen plant and wild-type plant survival rate statistics are shown in Figure 5 on 200mmol/L salt flat board, handle through three times, wherein the survival rate mean value of three transgenic lines is respectively 64.57%, 76.90% and 67.77%, and the survival rate of wild-type plant is 38.67%.Above result shows that transgenic line shows the tolerance to salt.
The phenotype of the commentaries on classics cotton nodulin-like gene Arabidopis thaliana after embodiment 5, drought stress are handled
4 ℃ of vernalization 3d after the seed disinfection, the normal cultivation about about 7d, select the relatively more consistent seedling of growing way to move to artificial soil (nutrition soil: vermiculite=1: 1), water every 3～5d, make Soil conservation moistening, cut off the water and carry out before the drought resisting processing, wild-type and transfer-gen plant are in same growth conditions, as shown in Figure 6A.Cut off the water, extremely handle, all wilt until all plant.The most of flavescence death of wild-type plant after the rehydration, and change cotton nodulin-like gene plant small portion flavescence death, the flavescence of a part of lotus throne leaf, but do not influence normal growth, as Fig. 6 B.Rehydration is statistics survival rate such as Fig. 7 after 2 weeks, triplicate, and three average survival rates of changeing cotton nodulin-like gene strain system are respectively 65.9%, 72.6% and 68.1%, and the survival rate of wild-type only is 23.7%.The rehydration survival rate of transgenic line is respectively 2.8 times of wild-type contrast, and 3.1 times, 2.9 times, visible transgenic line is better than the wild-type plant to the tolerance of arid.
Claims (7)
1. cotton nodulin-like salt tolerant, drought tolerance gene, the genebank accession number is: AY217332.
2. the albumen of the described cotton nodulin-like of claim 1 salt tolerant, drought tolerance genes encoding, its genebank accession number is: AAO60108.
3. contain claim 1 or 2 described salt tolerants, drought-enduring expression carrier.
4. the transgenic cell line that contains claim 1 or 2 described salt tolerants, drought-enduring gene.
5. the host bacterium that contains claim 1 or 2 described salt tolerants, drought-enduring gene.
6. a method of cultivating salt tolerant, drought-enduring plant is to utilize plant expression vector with claim 1 or 2 described salt tolerants, drought-enduring gene transfered plant cell, obtains high salt, arid tolerance enhanced transgenic cell line and transfer-gen plant.
7. method according to claim 6 is characterized in that: described is paddy rice, wheat, cotton, corn, Arabidopis thaliana, rape or soybean by the host transformed plant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101575058A CN101942448A (en) | 2009-07-10 | 2009-07-10 | Novel functions of salt and drought tolerance of cotton nodulin-like gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2009101575058A CN101942448A (en) | 2009-07-10 | 2009-07-10 | Novel functions of salt and drought tolerance of cotton nodulin-like gene and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101942448A true CN101942448A (en) | 2011-01-12 |
Family
ID=43434656
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009101575058A Pending CN101942448A (en) | 2009-07-10 | 2009-07-10 | Novel functions of salt and drought tolerance of cotton nodulin-like gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101942448A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102628055A (en) * | 2012-05-04 | 2012-08-08 | 江苏省农业科学院 | Cotton salt-tolerant gene GarCIPK for improving plant salt tolerance |
| CN103305488A (en) * | 2013-07-01 | 2013-09-18 | 中国农业科学院生物技术研究所 | Plant drought resistance related protein as well as encoding gene and application thereof |
| CN114634993A (en) * | 2022-04-27 | 2022-06-17 | 南通大学 | Transcriptome and proteome combined analysis-based cotton salt-tolerant gene discovery method and application thereof |
-
2009
- 2009-07-10 CN CN2009101575058A patent/CN101942448A/en active Pending
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102628055A (en) * | 2012-05-04 | 2012-08-08 | 江苏省农业科学院 | Cotton salt-tolerant gene GarCIPK for improving plant salt tolerance |
| CN103305488A (en) * | 2013-07-01 | 2013-09-18 | 中国农业科学院生物技术研究所 | Plant drought resistance related protein as well as encoding gene and application thereof |
| CN103305488B (en) * | 2013-07-01 | 2014-08-06 | 中国农业科学院生物技术研究所 | Plant drought resistance related protein as well as encoding gene and application thereof |
| CN114634993A (en) * | 2022-04-27 | 2022-06-17 | 南通大学 | Transcriptome and proteome combined analysis-based cotton salt-tolerant gene discovery method and application thereof |
| CN114634993B (en) * | 2022-04-27 | 2023-03-14 | 南通大学 | Transcriptome and proteome combined analysis-based cotton salt-tolerant gene discovery method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105543270A (en) | Double resistance CRISPR/Cas9 carrier and application | |
| CN105441460A (en) | Lilium regale Wilson WRKY transcription factor gene LrWRKY1 and application | |
| CN109053871A (en) | Application of the AtBIX gene in the regulation flowering of plant time | |
| CN101775398B (en) | Stress tolerance genetic engineering application of NAC protein gene DlNAC of chrysanthemum | |
| CN102002101B (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| CN102399760A (en) | Plant stress tolerance related protein TaSnRK2.10 as well as coding gene and application thereof | |
| CN100486994C (en) | Nitrate transport protein of diatom and its coding gene and application | |
| CN101307099B (en) | Protein related to iron deficiency resistance of plants, encoding gene thereof and use | |
| CN117660478A (en) | Gene for improving resistance of potatoes to late blight and application thereof | |
| CN102757486A (en) | Plant development related protein GA20ox, and encoding gene and application thereof | |
| CN101942448A (en) | Novel functions of salt and drought tolerance of cotton nodulin-like gene and application thereof | |
| CN107022563A (en) | Genetically modified plants | |
| CN103183731B (en) | Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof | |
| CN101121942A (en) | Corn genetic transferring method conducted by agrobacterium rhizogenes | |
| CN117106820A (en) | Method for creating few lateral branches of tomatoes through genome editing and application of method | |
| CN107446928A (en) | One cauliflower allelotaxis regulates and controls miRNA sequence and its application | |
| CN105296443B (en) | A kind of plant drought, protein related to salt tolerance EeSAPK7 and its encoding gene and application | |
| CN109354614B (en) | Application of OsCSLD4 protein in improving salt stress tolerance of plants | |
| CN104004773B (en) | One grow wheat WRKY transcription factor gene is changing the application in Arabidopis thaliana root system development | |
| CN102002496A (en) | DNA (Deoxyribonucleic Acid) molecule related to photosynthesis and application thereof | |
| CN102021181B (en) | Application of paddy gene KT488 in improvement on stress resistance of plants | |
| CN101987867B (en) | Ethylene receptor NTHK1 interactive protein relevant to plant stress tolerance as well as coding gene and application thereof | |
| CN103614385B (en) | A gene KT525 is improving the application on plant stress tolerance | |
| CN102021177B (en) | Application of genes KT473 and KT474 from rice in improving salt tolerance of plants | |
| CN106916213A (en) | A kind of albumin A sT and its encoding gene and the application in plant stress tolerance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20110112 |