CN102168091A - Qinghai-Tibet Plateau wild barley HsCIPK5 gene - Google Patents

Abstract

The invention discloses a Qinghai-Tibet Plateau wild barley HsCIPK5 gene, which is characterized in that the gene is defined by the nucleotide sequence SEQ ID NO.1. The invention comprises steps: using paddy rice OsCIPK homologous gene sequence to design an electron probe, searching homologous fragment from existing various barley nucleotide sequence library like EST library, then obtaining target genes coding sequence (coding sequence, CDs) by using methods of cluster analysis and electron splicing, etc; carrying out the structural analysis and function prediction to target genes by using bioinformatics method; extracting wild barley total RNA to prepare cDNA and design PCR primer; cloning target genes through PCR technology, and carrying out TA cloning, sequencing and sequence analyzing to obtained target genes.

Description

The wild barley HsCIPK5 gene in Qinghai-Tibet Platean

Technical field

The present invention relates to gene engineering technology field, especially Qinghai-Tibet wild barley HsCIPK5 gene.

Background technology

The Gramineae wild germplasm resource of Qinghai-Tibet Platean is very abundant, and its distinctive annual wild barley (Hordeum spontoneum C.Koch) especially is the Gramineae wild resource of the world preciousness of attracting attention always, is the national treasure that waits to develop.Because long term growth under various severe environment, through very long evolving naturally, has formed anti-(anti-) property idiotype network (Nevo et al., 1997) of the uniqueness that adapts with it, and abundant allelic variation, has very big utility value.In recent years, we are under the subsidy of state natural sciences fund main project, to the appearance features under this batch wild resource environment-stress patience, physical signs is screened and is identified, its hereditary formation, transcript and protein groups feature have systematically been analyzed, obtained the genetic resources of a collection of anti-(anti-) salt, arid, freeze injury, aluminium poison etc., obtained interim achievement in research with independent intellectual property right.Under the situation of current international " the gene Great War " that grows in intensity, utilize modern biotechnology, systematically the excellent stress resistance allelotrope and the controlling element thereof of this batch wild resource are cloned, and in nearly edge staple crops of Gramineae (paddy rice) and model plant Arabidopis thaliana, carry out functional verification, will be for improve anti-(anti-) property of abiotic stress of important food crop from now on effectively by the transgenosis means, the candidate gene resource is provided, and utilizing aspect the precious wild resource specific gene, obtain status initiatively in the world.

Arid, freeze injury, salt marsh, acid soil etc. are that the main environment that plant suffers at nature is coerced the factor, have a strong impact on growth and the output of crop.Correspondingly, plant adapts in the physical environment long-term, has also developed a series of environment-stress anti-(resisting) mechanism, can make a series of responses to coercing at aspects such as morphological structure, Physiology and biochemistry, molecular genetic and signal transmission.Along with developing rapidly of the deep and modern molecular biology technique that plant adverse circumstance response mechanism is studied, people begin to break away from effort traditional breeding method mode consuming time, then transform existing farm crop in large quantities by hereditary means such as transgenosiss,, high-quality degeneration-resistant, high yield, environmental protection new crop varieties in the hope of obtaining.So far, the result of study of model plant shows that the gene locus of anti-adverse circumstance the (regulation and control zone and coding region) is determining a certain abiotic stress patience of genotype, perhaps the difference of the overall patience performance of abiotic stress.Yet, at present the kind of China Gramineae food crop such as () paddy rice staple food crop all is derived from the minority backbone parent, the allelotrope that is present in these kinds on above-mentioned (relevant with stress resistance) gene locus is very not abundant, in secular domestication process, many excellent allelotrope resources have been lost.Yet these excellent allelotrope resources are abundanter in the wild barley in Qinghai-Tibet Platean.According to our early-stage Study, the dna polymorphism in the Qinghai-Tibet wild barley enriches degree, and is higher more than 40% than the domestication kind.By allelic screening on the stress resistance site, connect analysis with carrying the resistance performance under adverse environmental factor of certain allelic wild resource and this resource, and design by overexpression, the resistance performance of checking in paddy rice, at home and abroad also not attempting, is in default of special Gramineae wild resource to a great extent.Theory of heredity and breeding practice all show, and germ plasm resource, the particularly excavation of distinguished germ plasm resource are the bases and key that can breeding objective be realized with utilizing.The Qinghai-Tibet Platean is one of barley origin center, the world, and barley germ plasm resource is very abundant, especially its exclusive annual wild barley (Hordeumspontoneum C.Koch), be the precious wild resource that international barley circle is attracted attention always.Because long term growth in various severe environment, has formed the Genetic Control system (Nevo et al., 1997) that adapts with it, shows very strong environment-stress patience.Nearly edge wild resource has perennial wild barley and annual wild barley two classes, to perennial wild barley H.Bulbosum (bulbous barley) and H.Chilense (Chilean barley), though people once carried out many researchs, the allelotrope of its favourable proterties is not imported the successful illustration of nearly edge Gramineae food crop (as paddy rice) so far as yet by transgenic technology.Annual wild barley is primary gene storehouse (Nevo et al., 1992 that can lay in and be used in the breed improvement; Ceccarelli et al., 1995).Annual wild barley mainly is distributed in the Qinghai-Tibet Platean of area, the Middle East " fertile sinus " (Fertile Crescent) and China.At present in the world the research of annual wild barley mainly is limited to Middle East type, and the wild barley of this area has been brought into play enormous function in the wheat crops genetic improvement.The research of the annual wild barley in Middle East certain degree is utilized by breed improvement.Owing to be subjected to the restriction of Special geography and social environment, external less at present to the research of the annual wild barley in Qinghai-Tibet Platean, but some investigators carried out research to secondhand fragmentary or small quantity of material, and therefrom identified some special genetic stockss (Kaneko et al., 2000; Konishi, 2001).Domestic also had research to the annual wild barley germ plasm resource in Qinghai-Tibet Platean.During " six or five ", country once organized the relevant expert that the barley germ plasm resource of Qinghai-Tibet Platean is examined or check and collected; During " the Seventh Five-Year Plan " and " eight or five ", cultivation barley, the catalogue of wild barley resource, numerous kind and evaluation work have been carried out in the whole nation.The annual wild barley sample that Xu Tingwen etc. collect during to " six or five " has carried out identifying arrangement, is a kind with its ownership, two subspecies, count 32 mutation, wherein wild degeneration two ribs, wild naked grain two ribs, wild six ribs are the rare mutation in the world, count more than 200 strain system.Shao Qiquan (Chinese Academy of Sciences), Ma Dequan (the Chinese Academy of Agricultural Sciences) etc. have carried out comparatively systematic research to the economical character of annual wild barley; Zhang Guoping (Zhejiang University) etc. have carried out the identification research of salt tolerant and drought resisting material on the basis of research Tibet barley beta-glucan content gene type difference (Zhang et al., 2002).Zhang Qifa (Hua Zhong Agriculture University), fourth firm (Wuhan University) etc. are then in conduct a research aspect the origin of wild barley and evolution and the molecular biology (Yin et al., 2003; Li et al., 2004).The annual wild barley resource in utilizations such as Sun Dongfa Qinghai-Tibet Plateans has been bred first nucleo-cytoplasmic interreaction barley male sterile line 88BCMS of China and 6 precocities, short bar barley new variety (No. 1, river agricultural university, No. 2, river agricultural university, magnificent barley No. 1, magnificent barley No. 2, magnificent barley No. 3, magnificent barley No. 4), and has obtained 9 parts of special drought resistings, cold-resistant, salt tolerant alkali, special brewing quality material.More than studies show that out in the utilization of the annual wild barley resource of Qinghai-Tibet barley and have very big potentiality.Yet, China is to the research of the annual wild barley resource in Qinghai-Tibet Platean, generally with excavate and utilize these resources require gap very far away, carry out very few to its allelic clone of environment-stress patience who contains with the research of striding the species utilization by the transgenosis means.The fast development of modern genomics for the research of germ plasm resource brings brand-new theory and technique means, makes us be able to resolve the inheritance of economical character within sweep of the eye with on the molecule microscopic scale in whole genome.The application of genomics technology on germ plasm resource lays particular emphasis on the gene mapping of foundation, genotype identification (genotyping), Main Agronomic Characters (comprising the QTL proterties) of development, the Core Germplasms resource (core collection) of all kinds of molecule markers and location etc. in early days, more pays attention to the excavation of specific gene, the clone and the functional study of gene in recent years.

Calcium is important second messenger in the plant signal transduction pathway, and cell activates the genetic expression and the physiological response in downstream by various calcium receptor decoding calcium signals.Wherein, class calcineurin B protein subunit (calcineurinB-like protein, CBL) be the calcium receptor of a quasi-representative, constituted unique calcium signal network system with its target protein CIPK (CBL-interactingprotein kinase) protein kinase, in regulation and control plant adverse circumstance is replied, played an important role.CIPK be plant peculiar, with a class serine-threonine protein kinase enzyme of CBL specific action.The adjusting territory that the C end regions of CIPK contains 21-24 amino acid composition of a uniqueness is NAF structural domain (Figure 1A and B), also claims FISL motif.The sequence in this adjusting territory is conservative at all CIPK camber, A wherein, and F and L residue are conservative fully.It has a special catalyst structure domain at the N end, structurally extremely similar to yeast SNF1 (sucrose non-fermenting), animal AMPK (AMP-activated protein kinase), so CIPKs is considered to one of the similar kinases of plant SNF1-(SnRK) three big subtribes, be the SnRK3 subtribe, this structural domain high conservative.The Ser/Thr/Tyr that is arranged in the N end in the CIPKs gene family is that the NAF/FISL structural domain of silk/Soviet Union/tyrosine kinase domain and close C end all is a high conservative at whole gene family, therefore also becomes and judges whether unknown gene sequence belongs to a kind of effective ways of CIPKs.

At present, in the plant of finishing gene order-checking work, relevant scholar has identified 26 AtCIPKs from Arabidopis thaliana, 31 rice Os CIPKs, 43 corn ZmCIPKs, 27 diversiform-leaved poplar PtCIPKs, other are as also there being report in succession in the species such as cotton, tomato, grape, Chinese sorghum.According to existing result of study, plant CIPK mainly participates in the signal conduction of various environment stresses.Because the barley gene order-checking remains unfulfilled at present, can't determine what HsCIPK genes it contains, but should comprise 31 HsCIPKs gene family members at least in the wild in theory barley genome.From gene structure, the AtCIPK gene is divided into many introns gene and few intron gene, shows that by transcriptional expression and functional analysis whether the CIPK gene contains the intron environment stress corresponding with it does not have obvious relation.Have to studies show that between CBL and the CIPK to be not simple one-one relationship, a CBL can combine with a plurality of CIPK, and a plurality of CBL also can do mutually with a CIPK, and a kind of coercing may cause that multiple CBL-CIPK does mutually.Existing studies have shown that, AtCIPK14 gene possibility involved in sugar Signal Regulation approach, OsCIPK2, OsCIPK10, OsCIPK11 and OsCIPK14 gene expression amount under adverse circumstances such as high salt, low temperature all has variation in various degree, may participate in many adverse circumstance signal transduction pathways.

Expressed sequence tag (expressed sequence tags, EST) be partial sequence fragment to certain gene cDNA clone order-checking gained, length is approximately 200～600bp because gene expression regulation effect difference, the mRNA splice site of same gene is different with mode, so the full-length cDNA of same gene may comprise a plurality of EST.EST had both represented a certain section of gene cDNA, had also characterized the possible montage mode of ripe mRNA.The electronic cloning technology is est database in the biological data storehouse, nucleic acid sequence data storehouse, genome database, adopt methods such as homology sequence comparison and classification analysis, overlapping region assembling and splicing to prolong est sequence, until the homologous sequence can be for till not splicing with it, resulting sequence can be thought the full-length cDNA of corresponding gene, include the primer at open reading frame two ends according to the cDNA sequences Design of gained, carry out the method that RT-PCR clones corresponding gene.

Transposon tagging, DNA subclone, electronic cloning (Cloning In Silico), Tail-PCR, iPCR (InversePCR), TD-PCR (Touchdown-PCR), (technology such as cRACE, 3 '-RACE, 5 '-RACE) all is a technology commonly used in the molecular cloning to RACE.Along with the further investigation of transposon and developing by leaps and bounds of sequencing technologies, directly the difficulty of the new gene of isolation identification becomes more and more littler in addition.

Summary of the invention

The present invention utilizes paddy rice OSCIPK homologous gene sequences Design electronic probe, from existing various barley nucleotide sequence storehouses such as EST storehouse, search for homologous fragment, use methods such as cluster analysis and electronic splicing then, obtain the target gene encoding sequence (coding sequence, CDS).The utilization bioinformatics method carries out structural analysis and function prediction to target gene.Extract the total RNA of wild barley, preparation cDNA and design PCR primer are by the pcr clone target gene.The target gene that is obtained is carried out TA clone, order-checking and sequential analysis.

The wild barley HsCIPK5 gene in Qinghai-Tibet Platean, it is characterized in that coming from Qinghai-Tibet Platean annual wild barley and it and be plant institute peculiar, with CBL (calmodulin B-like protein, CBL) a class serine-threonine protein kinase enzyme of specific action, it is by the nucleotide sequence definition of SEQ ID NO:1.

Described Qinghai-Tibet Platean wild barley HsCIPK5 gene, it is characterized in that it has a special catalyst structure domain at the N end, the adjusting territory that the C end regions contains 21-24 amino acid composition of a uniqueness is the NAF structural domain, these two sequences of regulating the territory are conservative at all CIPK camber, described Qinghai-Tibet Platean wild barley HsCIPK5 gene, the aminoacid sequence of its coding SEQ ID NO:2 definition

The present invention identifies and isolates the HsCIPK5 gene from the annual wild barley in Qinghai-Tibet Platean (Hordeum spontoneum C.Koch).

Description of drawings

Fig. 1 is the CIPKs gene structure, show kinases territory and NAF structural domain

Fig. 2 is technological line figure of the present invention;

Fig. 3 is a HsCIPK5 electrophoresis result of the present invention;

Fig. 4 is a pMD18T::HsCIPK5 positive colony qualification result;

Fig. 5 is a HsCIPK5 protein structure of the present invention.

Embodiment

Because the barley genome is not announced yet at present, therefore, when target gene that the present invention is cloned into and paddy rice homologous gene carry out sequential analysis, unmatched nucleotide site is likely SNP (single nucleotide polymorphism) site, is the error that produces in PCR or the order-checking process but also can also get rid of.For avoiding this point the present invention that target gene is carried out independent repeated cloning and order-checking.

Embodiment 1

The technology used in the present invention route as shown in Figure 2.

1. according to pertinent literature, known CIPK5 gene order in other species of Gramineae (as paddy rice, wheat, Chinese sorghum, corn) is obtained in retrieval from various databases, and according to the coding rule of exon and intron and arrangement mode search and location open reading frame ORF (open read frame), and then obtain complete encoding sequence CDS (coding sequence).

2. complete or part conserved sequence is a probe with OsCIPK5, the various nucleotide sequences storehouse of retrieval comparison (nBlast or tBlastn) barley, infer that wherein a higher sequence of homology may be the partial sequence of HsCIPK5 in the wild barley, then classify this sequence as kind of subsequence and carry out next step electronic splicing and extension.

3. be probe with kind of subsequence, the homologous sequence that the above-mentioned database of repeated retrieval obtains retrieval is saved on the PC, operation DNAStar software package, with above-mentioned sequence input, because gene sequencing is finished by plasmid vector, be mixed with the carrier sequence in the sequence unavoidably, therefore need working procedure to search the carrier sequence, sequence is carried out latter end pruning removing redundancy section

4. program is according to coding rule and the arrangement mode search and the location open reading frame of exon and intron; Then, program is retrieved one by one and is compared the tumor-necrosis factor glycoproteins and the diversity sequence of each section sequence, and to splicing and assemble in the overlapping region, makes up overlap group (Contig)

5. be information labels with the overlap group who makes up, further retrieval comparison has been found height homologous unknown nucleotide sequence with it if search for its height homologous sequence, then repeats above-mentioned steps; If there is not new discovery, illustrate that the EST that the splicing assembling obtains may include all possible target gene sequences.

6. be the cDNA sequence with this est sequence, its design included a pair of Auele Specific Primer of whole open reading frame.

7. extract the total RNA of wild barley, synthetic cDNA, the performing PCR of going forward side by side clone.

8. the PCR product is carried out TA clone, order-checking, sequential analysis.

According to existing result of study, plant CIPKs mainly participates in the signal conduction of various environment stress responses or nutrition absorption etc.As the response of 30 CIPKs in the paddy rice to environment stress, a kind of during wherein 20 response arid, high salt, low temperature and ABA etc. coerce at least, response OsCIPKs arid and high salt coerces ABA also response.And for example potassium efficiently utilize candidate gene rice Os CIPK3, OsCIPK9, OsCBL2, OsCBL3, OsCBL4, OsCBL5, OsCBL6, OsCBL7, OsCBL8 and OsCBL10 because of and Arabidopis thaliana AKT1, CIPK23, CBL1 and CBL9 gene.The extreme habitat of the long-term adaptation of the wild barley in Qinghai-Tibet Platean, its CIPKs has stronger biological function at aspects such as environment stress response or nutrition absorption probably.Therefore, the present invention HsCIPK5 of being cloned into from the wild barley in Qinghai-Tibet Platean has significant application value probably in nutrition efficient utilization or the new crop varieties of anti-the adverse circumstance are cultivated.

The acquisition of embodiment 2HsCIPK5 gene complete sequence

1.1 design of primers (what be with underscore is the restriction enzyme site sequence):

HsCIPK5-KpnI-F?：CGG GGTACCATGGAGAGGAAGTCCACCATCCTCATG

HsCIPK5-XbaI-R：TGC TCTAGATTAAATGACATTCCTTTTGGTCGACTT

Table 1 reaction system

Table 2PCR reaction parameter

Cycle number	Temperature (℃)	Time (s)	Temperature (℃)	Time (s)	Temperature (℃)	Time (s)
							1	94	180	-	-	-	-
30	94	30	65	15	72	60
							1	72	600	-	-	-	-

1.2 experimental result

1.2.1PCR result

Get PCR product 5ul electrophoresis, obtain the clearly band about a 1.4kb, the clip size close (Fig. 3) of the CIPK5 gene of its size and known paddy rice and Arabidopis thaliana tentatively can be thought to have obtained required target DNA fragment.

1.2.2PCR the clone of product and evaluation

The PCR product end that obtains is added the A rear clone check order to the pDM18-T carrier, wherein the positive TA with underscore clones (Fig. 4).Sequencing result shows that obtaining dna fragmentation length is 1395bp, and the CIPK5 gene (AtCIPK5, OsCIPK5) of this fragment and Arabidopis thaliana, paddy rice has been carried out analyses and comparison on dna level, the protein level respectively.Wherein on dna level, the homology of the CIPK5 gene of paddy rice and wild barley is up to 87.0%, and on protein level, the homology of paddy rice and wild barley is up to 86.0%.Analyze three's aminoacid sequence, can obtain the peculiar structure of CIPK gene and comprise the kinase catalytic structural domain of N-end and the NAF motif of C-end, and these two structural domain high conservatives.Illustrate isolating new segment for the Qinghai-Tibet Platean annual wild barley CIPK5 gene (HsCIPK5) CDS sequence (Fig. 5).

Used software and network resource brief introduction:

DNAStar is a software package commonly used in a electronic cloning, it is with complete function and powerful and celebrated, and it mainly comprises following application program: EditSeq, GeneMan, GeneQuest, MapDraw, MegAlign, PrimerSelect, Protean and SeqMan II.

■ GeneQuest can find the gene in the note dna sequence dna, and relevant parameter is provided, and comprises ORF, splicing site, transcription factor binding site point, tumor-necrosis factor glycoproteins, restriction enzyme digestion sites etc.By using " methods " order, every relevant information of sequence and parameter can display with the form of figure.

■ EditSeq is input and the instrument of pruning DNA or protein sequence.EditSeq can read most Format Series Lines, also can be by using the keyboard input, and perhaps duplicate, paste and obtain from elsewhere.After sequence is opened, EditSeq can the use standard or specified genetic code translate or instead translate, seek open reading frame and read check and correction.

■ MapDraw can make simple linear graph to annotated circular chart, when showing restriction enzyme site, can also show feature, open reading frame and the translation result thereof of sequence simultaneously.Restriction enzyme site and cloning experimentation are mainly used and planned to the MapDraw instrument, produces detailed and sufficient result and summarize.

■ MegAlign provide comparison method, and the pairing and the multisequencing of carrying out DNA and protein sequence compare.The multisequencing comparison can be checked in the working interface of MegAlign and edit.Can make evolutionary tree according to the result of formation, can make form about the data of sequence distance and residue substitute.

■ PrimerSelect can aided design primer and probe.After the protein template sequence of input DNA, RNA or reverse translation, PrimerSelect can be in the various parameters of the sequence of calculation, and the user can limit calculation result by the various parameters of control.After template was handled, PrimerSelect determined the position of primer according to user-defined parameter, and to the primer scoring, filters out the best primer sequence on the template sequence then.

■ American National bioinformation center (National Center of Biotechnology Information, NCBI), Http:// www.ncbi.nlm.nih.gov/

The ■ Cold Spring Harbor Laboratory (Cold Spring Habor Laboratory, CSHL), Http:// clio.cshl.org/

■ Europe molecular biology Information Network (European Molecular Biology Net, EMBnet), Http:// www.embnet.org/

■ European Molecular Bioglogy Laboratory (European Molecular Biology Laboratory, EMBL), Http:// www.embl-heidelberg.de/

■ Japan state-run genetic research institute (National Insti tute of Genetics, NIG), Http:// www.ddbj.nig.ac.jp/

■ Peking University information biology center (Peking University Center of Bioinformatics, PKUCBI), Http:// www.cbi.pku.edu.cn/

Should be understood that, for those of ordinary skills, can be improved according to the above description or conversion, and all these improvement and conversion all should belong to the protection domain of claims of the present invention.

Sequence table

Claims (2)

1. Qinghai-Tibet wild barley HsCIPK5 gene, it is characterized in that coming from Qinghai-Tibet Platean annual wild barley and it and be plant institute peculiar, with CBL (calmodulin B-like protein, CBL) a class serine-threonine protein kinase enzyme of specific action, it is by the nucleotide sequence definition of SEQ ID NO:1.

2. Qinghai-Tibet Platean according to claim 1 wild barley HsCIPK5 gene, it is characterized in that it has a special catalyst structure domain at the N end, the adjusting territory that the C end regions contains 21-24 amino acid composition of a uniqueness is the NAF structural domain, these two sequences of regulating the territory are conservative at all CIPK camber, described Qinghai-Tibet Platean wild barley HsCIPK5 gene, the aminoacid sequence of its coding SEQ ID NO:2 definition.

Images