CN103571924A - Specific detection primers and detection liquid phase chip for IKZF1 gene mutation - Google Patents

Specific detection primers and detection liquid phase chip for IKZF1 gene mutation Download PDF

Info

Publication number
CN103571924A
CN103571924A CN201210250295.9A CN201210250295A CN103571924A CN 103571924 A CN103571924 A CN 103571924A CN 201210250295 A CN201210250295 A CN 201210250295A CN 103571924 A CN103571924 A CN 103571924A
Authority
CN
China
Prior art keywords
seq
site
sequence
phase chip
tag sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201210250295.9A
Other languages
Chinese (zh)
Other versions
CN103571924B (en
Inventor
许嘉森
刘志明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Surexam Bio Tech Co Ltd
Original Assignee
Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Surexam Bio Tech Co Ltd filed Critical Surexam Bio Tech Co Ltd
Priority to CN201210250295.9A priority Critical patent/CN103571924B/en
Publication of CN103571924A publication Critical patent/CN103571924A/en
Application granted granted Critical
Publication of CN103571924B publication Critical patent/CN103571924B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses a detection liquid phase chip and specific primers for IKZF1 gene mutation. The liquid phase chip mainly comprises: ASPE primers comprising a 5' terminal tag sequence and a 3' terminal target gene mutational site-targeted specific primer sequence, wherein the specific primer sequence comprises T136G site-targeted SEQ ID NO.7, T136G site-targeted SEQ ID NO.8, G75C site-targeted SEQ ID NO.9, G75C site-targeted SEQ ID NO.10, and/or T107C site-targeted SEQ ID NO.11 and T107C site-targeted SEQ ID NO.12; anti-tag sequence coated microspheres; and amplification primers. According to the present invention, coincidence frequency of the detection results of the detection liquid phase chip and the sequencing method is up to 100%, and single and parallel detection on the wild-type with multiple mutational sites and the mutant-type with multiple mutational sites can be achieved.

Description

IKZF1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of IKZF1 detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.
Background technology
KZF1 gene claims Ikaros family zinc finger protein 1, and English name is karos family zinc finger1, is positioned on the galianconism of No. 7 karyomit(e) 7p12.2, and particular location is between No. 7 karyomit(e) 50344377 to 50367357 base pairs.IKZF1 belongs to zinc finger protein family member, and be the gene of coding lymph transcription factor IKAROS, and be a kind of very important hematopoiesis transcription regulaton factor, in pouring, be especially that bematogenesis is being brought into play key regulating effect.The high risk factor of the change of IKZF1 gene in signal pathway and acute lymphoblastic leukemia is closely bound up, the acquired change of IKZF1 gene can cause acute lymphoblastic leukemia relapse rate to raise, and the new genetics variation according to showing this gene can make acute lymphoblastic leukemia sickness rate raise.IKZF1 has vital role in normal lymphocyte or white corpuscle growth, if developmental genetics changes, may affect the function of these genes, thereby normal lymphocyte development pathway is obstructed, and is transformed into cancer cell.Separately studies have found that IKZF1 gene pleiomorphism and systemic lupus erythematosus susceptibility significant correlation.
At present, IKZF1 detection method of gene mutation mainly contains: Illumina optical fiber superbead chip technology and Affymetrix SNP6.0 chip technology, although Illumina optical fiber superbead chip technology is the high throughput testing system of highly sensitive and accuracy, but level of automation is low, manual operations is many, is difficult to meet the needs of practical application.Although high-throughput makes Affymetrix SNP6.0 chip technology comparative maturity, yet this chip technology in low-density clinical diagnosis cake core improper, be difficult to expansion in same reaction system and detect relevant SNP or the Tag SNP of numerous biological characters, in addition, Affymetrix SNP6.0 chip is mainly more intense on chip of expression spectrum, and species are more, on SNP chip relatively a little less than, and detect expensively, can not meet actual needs.
The IKZF1 gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number The content of IKZF1 gene point mutation Write a Chinese character in simplified form
1 , there is T → G sudden change in the 136th Nucleotide of SEQ ID NO.33 T136G
2 , there is G → C sudden change in the 75th Nucleotide of SEQ ID NO.34 G75C
3 , there is T → C sudden change in the 107th Nucleotide of SEQ ID NO.35 T107C
SEQ ID NO.33 mutational site: T136GCAGAAGGGTGTGGCATTTGGAAACGGGAATAAACAAAATTGCTGCACCAAT GCACTGAGTGAAGGAAGAGAGACAGAGGATCAAGGGCTTTAGACAGCACTCCTTCA ATATGCAATCACAGAGAAAGATGCGCCTTATCCAAGTTAATATCTCTAAGGTGAGA GCCTTCTTAGAGTCAGTTTGTTGCAAATTTCACCTACTCTGTTCTTTTCCATCCAT CCCCCTGAGTCAGTTGGTTGAAGGGAGTTATTTTTTCAAGTGGAATTCAAACAAAG CTCAAACCAGAACTGTAAATAGTGATTGCAGGAATTCTTTTCTAAACTGCTTTGCC CTTTC
SEQ ID NO.34 mutational site: G75C
TCACATTGGGATTAGGGTTTCAACCCATGAATTTTGGTGGGGGATGCAAACATTCAGTTTATTGCACTGAACGTGTGTCTACTTGAAAAATTTAATGAGCTAGTGCATTATCTAAAAGAATCAAGTATTTATTTTAATAGGAATATGTTGTTAGTACAGCTCACCAGATACTGGGAGACGGAGGGTGTTAGAGAG
SEQ ID NO.35 mutational site: T107C
TTCAACACATCTGGACTGGGCAGAGGGACAGAACAGTGAGTAAGTGAGAATGGTCCCCATCCTTAGCAGCAGACAGCTACTAGGGGAGGGTAGGTAGAAGTTTATGTGTGATTGCATGGATAATTCCTTCCCATCTGAGAAATCCACGAAGACAAGGGGAGCGTGCCATGAGAGCATTACACAGGTTTCTGATCTTGTAAGAGTCAGCCAGATAAGGAGGGTTGATAAGGAGGGTTTTGTGTCCCAGTGTTGG
Summary of the invention
One of object of the present invention is to provide IKZF1 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the saltant type of parallel detection IKZF1 gene three kinds of common genotype T136G, G75C and T107C.
A gene mutation detection liquid-phase chip, includes
(A). the ASPE primer pair of the wild-type designing respectively for IKZF1 gene mutation site and saltant type: every ASPE primer holds the specific primer sequence for goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in T136G site, for SEQ ID NO.9 and the SEQ ID NO.10 in G75C site, and/or for SEQ ID NO.11 and the SEQ ID NO.12 in T107C site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.6;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.13～SEQ ID NO.18, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.
Therein in an embodiment, described amplimer is for the SEQ ID NO.19 in T136G site and SEQ ID NO.20, for SEQ ID NO.21 and the SEQ ID NO.22 in G75C site, and/or for SEQ ID NO.23 and the SEQ ID NO.24 in T107C site.
Therein in an embodiment, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.7 in T136G site and the sequence being comprised of SEQ IDNO.2 and SEQ IDNO.8, for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.9 in G75C site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.10, and/or for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.11 in T107C site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.12.
Another object of the present invention is to provide the Auele Specific Primer for IKZF1 detection in Gene Mutation.
Auele Specific Primer for IKZF1 detection in Gene Mutation, described Auele Specific Primer is for the SEQ ID NO.7 in T136G site and SEQ ID NO.8, for SEQ ID NO.9 and the SEQ ID NO.10 in G75C site, and/or for SEQ ID NO.11 and the SEQ ID NO.12 in T107C site.
Major advantage of the present invention is:
1. the identical rate of the detected result of IKZF1 gene mutation detection liquid-phase chip provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared IKZF1 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in a plurality of mutational sites.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the sudden change situation in a plurality of mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, 3 kinds of mutational sites are detected and can be completed the amplification of 3 target sequences that contain mutational site by a step PCR, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1IKZF1 gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
Wild-type and saltant type for IKZF1 gene three kinds of common genotype T136G, G75C and T107C, design respectively specific primer sequence.ASPE primer is comprised of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (tag sequence+specific primer sequence) of table 1IKZF1 gene
Figure BDA00001903617300041
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence.Tag sequence of the present invention is when choosing, avoid various tag sequences as far as possible, anti-tag sequence, cross reaction between specific primer sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag sequence may form from different ASPE primer sequences, simultaneously, can also meet the primer in the various mutations site in detection system and the specificity requirement of PCR product parallel detection, thereby realize parallel detection various mutations type in same reaction system, in whole parallel detection system, avoid cross reaction, and make the specificity of liquid-phase chip testing product of the present invention, between sensitivity and repeatability, reach and optimize and balance, accurately distinguish the genotype of various types.On 6 kinds of microballoons numberings selecting and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
Figure BDA00001903617300051
6 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH 2o is made into the stock solution of 100nmol/ml.Described spacerarm is for for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) disturb, can also use poly(TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 * 10 6the carboxylated microballoon of individual above-mentioned numbering (purchased from Luminex company) is suspended in the MES solution of 50ul0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from Pierce Chemical company) working fluid.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/LTris(pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For IKZF1 gene three kinds of common genotype T136G, G75C and T107C, design of amplification primers, to (in Table 3), amplifies 3 target sequences that contain 3 mutational sites.
Table 3 amplifies the primer of the target sequence with mutational site
Figure BDA00001903617300061
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
The detection of IKZF1 gene mutation detection liquid-phase chip described in embodiment 2 utilization embodiment 1 to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 * Tm hybridization buffer
Figure BDA00001903617300063
Figure BDA00001903617300071
After filtration, be stored in 4 ℃.
ExoSAP-IT test kit is purchased from U.S. USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to < < molecular cloning > > about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design 3 pairs of primers, multiplex PCR one step amplifies 3 target sequences that contain respectively IKZF1 gene three kinds of common genotype T136G, G75C and T107C, product size is respectively 336bp, 195bp, 253bp, and primer sequence (SEQ IDNO.19-24) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.19-24 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Figure BDA00001903617300072
Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Figure BDA00001903617300081
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
According to design ASPE primer, the corresponding 6 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 * 10 5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul 2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH 2o complements to 50ul;
7. with masking foil, encase 96 orifice plates with lucifuge, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 * Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 ℃, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 * PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI(NET MFI be less than 0 with 0 expression);
3. meet the data of above two conditions, by following formula, calculate sudden change ratio:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments IKZF1 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.With sequencing, detect with liquid-phase chip result and compare, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments IKZF1 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible IKZF1 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of IKZF1 exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Figure BDA00001903617300091
Figure BDA00001903617300101
Table 5 sample IKZF1 transgenation ratio (%)
Sample number T136G G75C T107C
1 1% 2% 2%
2 2% 2% 1%
3 2% 52% 1%
4 2% 1% 2%
5 1% 1% 2%
6 2% 2% 1%
7 2% 2% 2%
8 98% 2% 1%
9 2% 2% 2%
10 2% 2% 2%
11 2% 1% 2%
12 3% 2% 1%
13 2% 2% 2%
14 3% 1% 1%
15 2% 1% 3%
16 1% 3% 98%
17 2% 1% 2%
18 2% 2% 3%
19 1% 2% 2%
20 3% 3% 1%
Table 6 sample IKZF1 gene mutation type analytical results
Figure BDA00001903617300102
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to IKZF1 gene SNP site
One, the design that prepared by liquid-phase chip (selection of Tag sequence and Anti-Tag sequence)
Take IKZF1 gene T136G, G75C and T107C site mutation, to detect liquid-phase chip be example, respectively for the wild-type of T136G, G75C and T107C and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ ID NO.6, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.13-SEQ ID NO.18.Specific design is as shown in following table (table 7).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method like described in embodiment 1 and embodiment 2.
Design prepared by table 7 liquid-phase chip
Figure BDA00001903617300121
One, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 8 sample IKZF1 gene T136G detected result and Polymorphism Analysis
Table 9 sample IKZF1 gene G75C detected result and Polymorphism Analysis
Figure BDA00001903617300132
Table 10 sample IKZF1 gene T107C detected result and Polymorphism Analysis
Figure BDA00001903617300142
From the present embodiment, can find out, liquid-phase chip for different mutational sites, the combination of Auele Specific Primer and different Tag sequences in the present invention, its result is still reliable and stable, but when ASPE primer is selected described in embodiment 1 in liquid-phase chip tag sequence and specific primer sequence collocation, effect better (signal to noise ratio is better), referring to the present embodiment test group 1, test group 5 and test group 9.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4IKZF1 detection in Gene Mutation specific primer sequence
One, the design that prepared by liquid-phase chip (selection of wild-type and saltant type specific primer sequence)
It is example that the pleomorphism site of IKZF1 gene T136G and T107C of take detects liquid-phase chip, the complementary sequence forward or backwards of this place, mutational site target sequence of take is template, respectively for the wild-type of T136G and T107C and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 11.Wherein, in frame, base is pleomorphism site.
Table 11 specific primer sequence
Figure BDA00001903617300151
It is example that the pleomorphism site of IKZF1 gene T136G and T107C of take detects liquid-phase chip, for T136G and T107C, select different specific primer sequences, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 12).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method like described in embodiment 1 and embodiment 2.
Two of design prepared by table 12 liquid-phase chip
Figure BDA00001903617300152
Figure BDA00001903617300161
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 13 sample IKZF1 gene T136G detected result and Polymorphism Analysis
Figure BDA00001903617300162
Table 14 sample IKZF1 gene T107C detected result and Polymorphism Analysis
Figure BDA00001903617300172
Figure BDA00001903617300181
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, detect the specific primer sequence (signal to noise ratio is better) that effect is much better than other, referring to the present embodiment test group 10 and test group 13.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different SNP sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detects effect also better, and concrete data are omitted.
The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Figure IDA00001903617800021
Figure IDA00001903617800031
Figure IDA00001903617800041
Figure IDA00001903617800051
Figure IDA00001903617800061
Figure IDA00001903617800071

Claims (5)

1. an IKZF1 gene mutation detection liquid-phase chip, is characterized in that, includes
(A). the wild-type designing respectively for the different mutational sites of IKZF1 gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, described specific primer sequence is: for SEQ IDNO.7 and the SEQ IDNO.8 in T136G site, for SEQ ID NO.9 and the SEQ ID NO.10 in G75C site, and/or for SEQ ID NO.11 and the SEQ ID NO.12 in T107C site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.6;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.13～SEQ ID NO.18, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.
2. IKZF1 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described amplimer is for the SEQ ID NO.19 in T136G site and SEQ ID NO.20, for SEQ ID NO.21 and the SEQ ID NO.22 in G75C site, and/or for SEQ ID NO.23 and the SEQ ID NO.24 in T107C site.
3. IKZF1 gene mutation detection liquid-phase chip according to claim 1 and 2, it is characterized in that, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.7 in T136G site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.8, for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.9 in G75C site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.10, and/or for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.11 in T107C site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.12.
4. IKZF1 gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described spacerarm is 5-10 T.
5. for the Auele Specific Primer of IKZF1 detection in Gene Mutation, it is characterized in that, described Auele Specific Primer is for the SEQ ID NO.7 in T136G site and SEQ ID NO.8, for SEQ ID NO.9 and the SEQ ID NO.10 in G75C site, and/or for SEQ ID NO.11 and the SEQ ID NO.12 in T107C site.
CN201210250295.9A 2012-07-18 2012-07-18 Specific detection primers and liquid phase chip for IKZF1 gene mutation Active CN103571924B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210250295.9A CN103571924B (en) 2012-07-18 2012-07-18 Specific detection primers and liquid phase chip for IKZF1 gene mutation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210250295.9A CN103571924B (en) 2012-07-18 2012-07-18 Specific detection primers and liquid phase chip for IKZF1 gene mutation

Publications (2)

Publication Number Publication Date
CN103571924A true CN103571924A (en) 2014-02-12
CN103571924B CN103571924B (en) 2015-05-13

Family

ID=50044633

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210250295.9A Active CN103571924B (en) 2012-07-18 2012-07-18 Specific detection primers and liquid phase chip for IKZF1 gene mutation

Country Status (1)

Country Link
CN (1) CN103571924B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005020683A1 (en) * 2003-08-28 2005-03-10 Aveo Pharmaceuticals, Inc. Chimeric cancer models
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005020683A1 (en) * 2003-08-28 2005-03-10 Aveo Pharmaceuticals, Inc. Chimeric cancer models
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
栾海霞: "中国汉族人群C1qA、IKZF1单核苷酸多肽性与系统性红斑狼疮的相关性研究", 《中国优秀硕士学位论文全文数据库 医药卫生科技辑》, no. 11, 15 November 2010 (2010-11-15) *

Also Published As

Publication number Publication date
CN103571924B (en) 2015-05-13

Similar Documents

Publication Publication Date Title
CN103451271B (en) THADA gene mutation detection specific primer and liquid phase chip
CN103374609B (en) ABO gene mutation detection specific primers and liquid chip
CN102191337B (en) Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
CN102912002B (en) ABCB2 gene polymorphism detection specific primers and liquid chip
CN102191336B (en) MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip
CN103451272A (en) BAT3 gene mutation detection specific primer and liquid phase chip
CN102952866B (en) Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene
CN103571924B (en) Specific detection primers and liquid phase chip for IKZF1 gene mutation
CN103374607B (en) ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip
CN102181573B (en) Specific primers and liquid-phase chip for detection of KITLG gene
CN103849942A (en) Specific primer and liquid phase chip for detecting TOX3 gene mutation
CN103451266B (en) NKX3.1 gene mutation detection specific primers and liquid chip
CN103451273B (en) TGM5 gene mutation detection specific primer and liquid phase chip
CN102191335B (en) Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes
CN103571918A (en) Specific detection primers and detection liquid phase chip for FYCO1 gene mutation
CN103849943A (en) Specific primer and liquid phase chip for detecting MC1R gene mutation
CN103374611B (en) LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip
CN103849675B (en) RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN102952867B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene
CN103374608B (en) MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip
CN102888444B (en) Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip
CN103571919A (en) Specific detection primers and detection liquid phase chip for HNF1B gene mutation
CN102952869B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene
CN103849938A (en) Specific primer and liquid phase chip for detecting MAP3K1 gene mutation
CN103571931A (en) Specific primers and liquid chip for EHBP1 (EH domain binding protein 1) gene mutation detection

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant