CN103571918A - Specific detection primers and detection liquid phase chip for FYCO1 gene mutation - Google Patents
Specific detection primers and detection liquid phase chip for FYCO1 gene mutation Download PDFInfo
- Publication number
- CN103571918A CN103571918A CN201210250142.4A CN201210250142A CN103571918A CN 103571918 A CN103571918 A CN 103571918A CN 201210250142 A CN201210250142 A CN 201210250142A CN 103571918 A CN103571918 A CN 103571918A
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- site
- fyco1
- tag sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention discloses a detection liquid phase chip and specific primers for FYCO1 gene mutation. The liquid phase chip mainly comprises: ASPE primers comprising a 5' terminal tag sequence and a 3' terminal target gene mutational site-targeted specific primer sequence, wherein the specific primer sequence comprises A92G site-targeted SEQ ID NO.1, A92G site-targeted SEQ ID NO.2, and/or C57T site-targeted SEQ ID NO.3 and C57T site-targeted SEQ ID NO.4; anti-tag sequence coated microspheres; and amplification primers. According to the present invention, coincidence frequency of the detection results of the detection liquid phase chip and the sequencing method is up to 100%, and single and parallel detection on the wild-type with multiple mutational sites and the mutant-type with multiple mutational sites can be achieved.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of FYCO1 detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.
Background technology
FYCO1 gene claims that English name is FYVE and coiled-coil domain containing 1, is positioned on No. 3 chromosome 3p 21.31 galianconism, specifically between No. 3 karyomit(e) 45959394 to 46037306 base pairs containing FYVE and coiled coil territory 1.FYCO1 transgenation is the reason that a kind of recessive hereditary cataract occurs, and is considered to play certain effect in the pathogenic process of lenticular biological variation and autosomal recessive inheritance type congenital cataract.Studies have found that, there is autophagy in the albumen of this gene synthesized, and this is a necessary process eliminating harmful albumen.Want to keep lenticular health, cell on it just must constantly decompose some proteic substance, researchist thinks, because lens cell has lost their intrinsic organoid in growth course, protein will produce improper gathering in tissue, and this will likely affect lenticular transparency.Generally speaking, the Fyco1 gene in lens growth course is healthy relevant to it, and the sudden change of this gene is one of arch-criminal of autosomal recessive inheritance type congenital cataract.
At present, FYCO1 detection method of gene mutation mainly contains: ABI 3730xl conventional order-checking platform and fluorescent quantitative PCR technique, ABI 3730xl sequencing technologies can be realized high throughput testing, but handiness is inadequate, can only accomplish qualitative analysis to detected result, operate also very loaded down with trivial details, sequencing reaction is wasted time and energy, that fluorescent quantitative PCR technique has is highly sensitive, high specificity, feature that level of automation is high, but also there is the shortcoming that sample easily pollutes, false positive rate is high, and can only detect a kind of mutation type at every turn.
The FYCO1 gene mutation site of target detect of the present invention, it is as shown in the table:
| Sequence number | The content of FYCO1 gene point mutation | Write a Chinese character in simplified form |
| 1 | , there is A → G sudden change in the 92nd Nucleotide of SEQ ID NO.29 | A92G |
| 2 | , there is C → T sudden change in the 57th Nucleotide of SEQ ID NO.30 | C57T |
SEQ ID NO.29 mutational site:: A92G
ATGGGGATAGATGATAACACCTTCCTCATAGGACTGTTAGGAGGATTAAATGGGTAAATGTATGCAAAGTATTCAAAACAGAGTCGGCCACATTTTCAGCATTATTTAAATACATGCTGCTACTATTACCATTATTATTATGATCTAACTTTTATTTCATTTTAGTTTTTCCAAAGCTTGCAGTTACTGAAGTATGATATGCACTGCCAGAGAGAAGAAAATTGAG
SEQ ID NO.30 mutational site: C57T
GCATGACTGGAGGAGCTGGTCAGGATCTCCGGGGGGTCCCCTGGCACCGACTCGCACGATGGCTGTGTACCTCCTTTTCCCAGGAGTACCTGAGGGCGTCACAGCCCGAGGATTCACAGGGCATGGCCAGTGCACCCAGCTCAGTCTCCAACATGCAGGGCCCTGGTGGGGCAGGGCAGAAAATCTCTCCACAGGCAGAAGTTGGAATCACCCCTGCCCGTGAAACTCTCCACAAGAGGCCTGTAGCCAACTGTGCTCCCAGGAGAGGCTGATGGTCTCCTGGGTGTTTAAACCTTTGGCAGAGCATCCCT
Summary of the invention
One of object of the present invention is to provide FYCO1 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the saltant type of two kinds of common genotype A92G of parallel detection FYCO1 gene and C57T.
The technical scheme that realizes above-mentioned purpose is as follows.
A gene mutation detection liquid-phase chip, includes
(A). the wild-type designing respectively for the different mutational sites of FYCO1 gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, described specific primer sequence is: for SEQ ID NO.1 and the SEQ ID NO.2 in A92G site, and/or for SEQ ID NO.3 and the SEQ ID NO.4 in C57T site; Described tag sequence is selected from SEQ ID NO.5～SEQ ID NO.10;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.11～SEQ ID NO.16, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.
In an embodiment, described amplimer is therein: for SEQ ID NO.17 and the SEQ ID NO.18 in A92G site, and/or for SEQ ID NO.19 and the SEQ ID NO.20 in C57T site.
Therein in an embodiment, described ASPE primer is: for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.1 in A92G site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.2, and/or for the sequence being formed by SEQ IDNO.7 and SEQ ID NO.3 in C57T site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.4.
Another object of the present invention is to provide the Auele Specific Primer for FYCO1 detection in Gene Mutation.
Concrete technical scheme is as follows.
For the Auele Specific Primer of FYCO1 detection in Gene Mutation, for SEQ ID NO.1 and the SEQ ID NO.2 in A92G site, and/or for SEQ ID NO.3 and the SEQ ID NO.4 in C57T site.
Major advantage of the present invention is:
1. the identical rate of the detected result of FYCO1 gene mutation detection liquid-phase chip provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared FYCO1 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in a plurality of mutational sites.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the sudden change situation in a plurality of mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, 2 kinds of mutational sites are detected and can be completed the amplification of 2 target sequences that contain mutational site by a step PCR, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1FYCO1 gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
Wild-type and saltant type for two kinds of common genotype A92G of FYCO1 gene and C57T, design respectively specific primer sequence.ASPE primer is comprised of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (specific primer sequence) of table 1FYCO1 gene
The ASPE primer sequence (tag sequence) of table 2FYCO1 gene
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence (as shown in Table 2 above) for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L TrisBuffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence.Tag sequence of the present invention is when choosing, avoid various tag sequences as far as possible, anti-tag sequence, cross reaction between specific primer sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag sequence may form from different ASPE primer sequences, simultaneously, can also meet the primer in the various mutations site in detection system and the specificity requirement of PCR product parallel detection, thereby realize parallel detection various mutations type in same reaction system, in whole parallel detection system, avoid cross reaction, and make the specificity of liquid-phase chip testing product of the present invention, between sensitivity and repeatability, reach and optimize and balance, accurately distinguish the genotype of various types.On 6 kinds of microballoons numberings selecting and microballoon, corresponding anti-tag sequence is as shown in table 3:
Corresponding anti-tag sequence on table 3 microballoon numbering and microballoon
6 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH
2o is made into the stock solution of 100nmol/ml.Described spacerarm is for for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) disturb, can also use poly(TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 * 10
6the carboxylated microballoon of individual above-mentioned numbering (purchased from Luminex company) is suspended in the MES solution of 50ul0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from Pierce Chemical company) working fluid.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris(pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For two kinds of common genotype A92G of FYCO1 gene and C57T, design of amplification primers, to (in Table 4), amplifies 2 target sequences that contain two mutational sites.
Table 4 amplifies the primer of the target sequence with mutational site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
The detection of FYCO1 gene mutation detection liquid-phase chip described in embodiment 2 utilization embodiment 1 to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 * Tm hybridization buffer
| Reagent | Source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | SigmaT3038 | 0.2M | 50ml |
| 5M NaCl | Sigma S5150 | 0.4M | 20ml |
| Triton X-100 | Sigma T8787 | 0.16％ | 0.4ml |
After filtration, be stored in 4 ℃.
ExoSAP-IT test kit is purchased from U.S. USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to < < molecular cloning > > about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design 2 pairs of primers, multiplex PCR one step amplifies the 2 objective sequences that contain respectively two kinds of common genotype A92G of FYCO1 gene and C57T, and product size is respectively 226bp and 311bp, and primer sequence (SEQ ID NO.17-20) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.17-20 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the designed ASPE primer of table 5 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on reacted product band.
ASPE combination of primers in table 5 embodiment 2 (tag sequence+specific primer sequence and anti-tag sequence)
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
According to design ASPE primer, the corresponding 6 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 * 10
5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul
2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH
2o complements to 50ul;
7. with masking foil, encase 96 orifice plates with lucifuge, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 * Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 ℃, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 6, table 7 and table 8.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 * PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI(NET MFI be less than 0 with 0 expression);
3. meet the data of above two conditions, by following formula, calculate sudden change ratio:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments FYCO1 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.With sequencing, detect with liquid-phase chip result and compare, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments FYCO1 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible FYCO1 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of FYCO1 exactly, and result is reliable and stable.
Table 6 pattern detection result (MFI)
Table 7 sample FYCO1 transgenation ratio (%)
Table 8 sample FYCO1 gene mutation type analytical results
| Catalogue number(Cat.No.) | Liquid-phase chip detected result | Sequencing result |
| 1 | Wild-type | Wild-type |
| 2 | Wild-type | Wild-type |
| 3 | Wild-type | Wild-type |
| 4 | Wild-type | Wild-type |
| 5 | Wild-type | Wild-type |
| 6 | Wild-type | Wild-type |
| 7 | 57CT | 57CT |
| 8 | Wild-type | Wild-type |
| 9 | Wild-type | Wild-type |
| 10 | Wild-type | Wild-type |
| 11 | Wild-type | Wild-type |
| 12 | Wild-type | Wild-type |
| 13 | Wild-type | Wild-type |
| 14 | Wild-type | Wild-type |
| 15 | 92GG | 92GG |
| 16 | Wild-type | Wild-type |
| 17 | Wild-type | Wild-type |
| 18 | Wild-type | Wild-type |
| 19 | Wild-type | Wild-type |
| 20 | Wild-type | Wild-type |
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to FYCO1 gene SNP site
One, the design that prepared by liquid-phase chip (selection of Tag sequence and Anti-Tag sequence)
Take FYCO1 Gene A 92G and C57T site mutation, to detect liquid-phase chip be example, respectively for the wild-type of A92G and C57T and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.5-SEQ ID NO.10, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.11-SEQ ID NO.16.Specific design is as shown in following table (table 9).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method like described in embodiment 1 and embodiment 2.
Design prepared by table 9 liquid-phase chip
One, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 10 sample FYCO1 detected result and Polymorphism Analysis
Table 11 sample FYCO1 detected result and Polymorphism Analysis
From the present embodiment, can find out, liquid-phase chip for different mutational sites, ASPE primer uses different Tag sequence in embodiment 1 table 2, its result is still reliable and stable, but when ASPE primer is selected in embodiment 2 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1 and test group 5.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4FYCO1 detection in Gene Mutation specific primer sequence
One, the design that prepared by liquid-phase chip (selection of wild-type and saltant type specific primer sequence)
Take the mutational site of FYCO1 Gene A 92G and C57T, to detect liquid-phase chip be example, the complementary sequence forward or backwards of this place, mutational site target sequence of take is template, respectively for the wild-type of A92G and C57T and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 12.Wherein, in frame, base is mutational site.
Table 12 specific primer sequence
Take the mutational site of FYCO1 Gene A 92G and C57T, to detect liquid-phase chip be example, for A92G and C57T, select different specific primer sequences, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 2, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 13).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method like described in embodiment 1 and embodiment 2.
Two of design prepared by table 13 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 14 sample A92G detected result and gene mutation analysis
Table 15 sample C57T detected result and gene mutation analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, detect the specific primer sequence (signal to noise ratio is better) that effect is much better than other, referring to the present embodiment test group 7 and test group 10.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 1 and embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different mutational sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, embodiment 1 and the selected Auele Specific Primer of embodiment 2, have better signal to noise ratio, detect effect also better, concrete data are omitted.
The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Claims (5)
1. a FYCO1 gene mutation detection liquid-phase chip, is characterized in that, includes
(A). the wild-type designing respectively for the different mutational sites of FYCO1 gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, described specific primer sequence is: for SEQ ID NO.1 and the SEQ ID NO.2 in A92G site, and/or for SEQ ID NO.3 and the SEQ ID NO.4 in C57T site; Described tag sequence is selected from SEQ ID NO.5～SEQ ID NO.10;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.11～SEQ ID NO.16, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.
2. FYCO1 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described amplimer is: for SEQ ID NO.17 and the SEQ ID NO.18 in A92G site, and/or for SEQ ID NO.19 and the SEQID NO.20 in C57T site.
3. FYCO1 gene mutation detection liquid-phase chip according to claim 1 and 2, it is characterized in that, described ASPE primer is: for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.1 in A92G site and the sequence being formed by SEQ ID NO.6 and SEQ IDNO.2, and/or for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.3 in C57T site and the sequence being formed by SEQID NO.8 and SEQ ID NO.4.
4. FYCO1 gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described spacerarm is 5-10 T.
5. for the Auele Specific Primer of FYCO1 detection in Gene Mutation, it is characterized in that, described Auele Specific Primer is the Auele Specific Primer for FYCO1 detection in Gene Mutation, described Auele Specific Primer is for the SEQ ID NO.1 in A92G site and SEQ IDNO.2, and/or for SEQ ID NO.3 and the SEQ ID NO.4 in C57T site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210250142.4A CN103571918A (en) | 2012-07-18 | 2012-07-18 | Specific detection primers and detection liquid phase chip for FYCO1 gene mutation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210250142.4A CN103571918A (en) | 2012-07-18 | 2012-07-18 | Specific detection primers and detection liquid phase chip for FYCO1 gene mutation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103571918A true CN103571918A (en) | 2014-02-12 |
Family
ID=50044627
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210250142.4A Pending CN103571918A (en) | 2012-07-18 | 2012-07-18 | Specific detection primers and detection liquid phase chip for FYCO1 gene mutation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103571918A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113628682A (en) * | 2021-08-11 | 2021-11-09 | 上海小海龟科技有限公司 | T790M and C797S cis-trans mutation type identification and calculation method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002059354A2 (en) * | 2001-01-25 | 2002-08-01 | Tm Bioscience Corporation | Polynucleotides for use as tags and tag complements, manufacture and use thereof |
| WO2005047533A1 (en) * | 2003-11-17 | 2005-05-26 | Tm Bioscience Corporation | Method of detecting mutations associated with thrombosis |
-
2012
- 2012-07-18 CN CN201210250142.4A patent/CN103571918A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002059354A2 (en) * | 2001-01-25 | 2002-08-01 | Tm Bioscience Corporation | Polynucleotides for use as tags and tag complements, manufacture and use thereof |
| WO2005047533A1 (en) * | 2003-11-17 | 2005-05-26 | Tm Bioscience Corporation | Method of detecting mutations associated with thrombosis |
Non-Patent Citations (1)
| Title |
|---|
| DUNBAR SA.: "Applications of Luminex xMAP technology for rapid, high-throughput multiplexed nucleic acid detection", 《CLIN CHIM ACTA》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113628682A (en) * | 2021-08-11 | 2021-11-09 | 上海小海龟科技有限公司 | T790M and C797S cis-trans mutation type identification and calculation method |
| CN113628682B (en) * | 2021-08-11 | 2023-10-24 | 上海小海龟科技有限公司 | T790M and C797S cis-trans mutation type identification and calculation method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103451271A (en) | THADA gene mutation detection specific primer and liquid phase chip | |
| CN103374609B (en) | ABO gene mutation detection specific primers and liquid chip | |
| CN102191337B (en) | Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene | |
| CN102912002B (en) | ABCB2 gene polymorphism detection specific primers and liquid chip | |
| CN103571918A (en) | Specific detection primers and detection liquid phase chip for FYCO1 gene mutation | |
| CN103451272A (en) | BAT3 gene mutation detection specific primer and liquid phase chip | |
| CN102191336B (en) | MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip | |
| CN103374607B (en) | ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip | |
| CN102952866B (en) | Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene | |
| CN103849940A (en) | Specific primer and liquid phase chip for detecting BARD1 gene mutation | |
| CN103571919A (en) | Specific detection primers and detection liquid phase chip for HNF1B gene mutation | |
| CN103849943A (en) | Specific primer and liquid phase chip for detecting MC1R gene mutation | |
| CN102952867B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene | |
| CN103451266B (en) | NKX3.1 gene mutation detection specific primers and liquid chip | |
| CN103451273B (en) | TGM5 gene mutation detection specific primer and liquid phase chip | |
| CN103571924B (en) | Specific detection primers and liquid phase chip for IKZF1 gene mutation | |
| CN102191335B (en) | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes | |
| CN103374608B (en) | MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip | |
| CN103849942A (en) | Specific primer and liquid phase chip for detecting TOX3 gene mutation | |
| CN103849675B (en) | RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
| CN103374611B (en) | LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip | |
| CN102888444B (en) | Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip | |
| CN102952869B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene | |
| CN103865986A (en) | CDKN1A gene mutation detection specific primers and liquid chip | |
| CN103374605A (en) | ATR (ataxia telangiectasia-mutated and Rad3-related) gene mutation detection specific primers and liquid chip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20140212 |