CN103374609B - ABO gene mutation detection specific primers and liquid chip - Google Patents

ABO gene mutation detection specific primers and liquid chip Download PDF

Info

Publication number
CN103374609B
CN103374609B CN201210107203.1A CN201210107203A CN103374609B CN 103374609 B CN103374609 B CN 103374609B CN 201210107203 A CN201210107203 A CN 201210107203A CN 103374609 B CN103374609 B CN 103374609B
Authority
CN
China
Prior art keywords
seq
sequence
site
tag
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201210107203.1A
Other languages
Chinese (zh)
Other versions
CN103374609A (en
Inventor
许嘉森
刘志明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Surexam Bio Tech Co Ltd
Original Assignee
Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Surexam Bio Tech Co Ltd filed Critical Surexam Bio Tech Co Ltd
Priority to CN201210107203.1A priority Critical patent/CN103374609B/en
Publication of CN103374609A publication Critical patent/CN103374609A/en
Application granted granted Critical
Publication of CN103374609B publication Critical patent/CN103374609B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an ABO gene mutation detection liquid chip and specific primers. The liquid chip mainly comprises each ASPE (allele specific primer extension) primer formed by tag sequences at 5' terminal and specific primer sequences aiming at target gene mutation sites at 3' terminal, microspheres coated by anti-tag sequences as well as amplification primers, wherein the specific primer sequences are SEQ ID NO.13 and SEQ ID NO.14 aiming at T98C sites, SEQ ID NO.15 and SEQ ID NO.16 aiming at G268A sites, SEQ ID NO.17 and SEQ ID NO.18 aiming at C124A sites, SEQ ID NO.19 and SEQ ID NO.20 aiming at G100T sites, SEQ ID NO.21 and SEQ ID NO.22 aiming at G139T sites and/or SEQ ID NO.23 and SEQ ID NO.24 aiming at G50A sites. The liquid chip has the advantages that the coincidence rate of the detection results of the detection liquid chip provided by the invention and a sequencing method is as high as 100%; and parallel detection of wild types and mutant types of a plurality of mutation sites is achieved.

Description

ABO detection in Gene Mutation Auele Specific Primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of ABO detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.
Background technology
Mankind ABO gene is positioned at karyomit(e) 9q34.1～34.2, and its gene product is glycosyltransferase, and these enzymes are controlled the biosynthesizing of abo blood group antigen.ABO gene comprises length scale and from 28～688 7 exons that do not wait and length, is about 6 introns of 19514bp, and overall length is approximately 18～20kb.Most encoding sequences are positioned on the 6th and the 7th exon, their encoded catalysis regions of glycosyltransferase.At present, there are some researches show, the developing of ABO transgenation and chronic pancreatitis and carcinoma of the pancreas, blood plasma level, intercellular adhesion molecule level etc. are relevant, and have very large relation with the risk that carcinoma of the pancreas occurs.
At present, ABO detection method of gene mutation mainly contains: PCR-RFLP, direct sequencing and fluorescent quantitative PCR technique, PCR-RFLP method is the change of the restriction enzyme enzyme recognition site that causes based on transgenation, as lost or generation novel site in site, by a certain specific fragment of pcr amplification, use again digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, the transgenation that this method changes for detection of restriction enzyme site, can directly judge genotype, but this method can not be for not producing the detection in Gene Mutation of new restriction enzyme site.And other take PCR as basic detection technique, as direct sequencing and fluorescent quantitative PCR technique, exist sensitivity low, the shortcoming that sample easily pollutes, false positive rate is high.Again, above these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not meet the needs of practical application.
The ABO gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number The content of ABO gene point mutation Write a Chinese character in simplified form
1 , there is T → C sudden change in the 98th Nucleotide of SEQ ID NO.55 T98C
2 , there is G → A sudden change in the 268th Nucleotide of SEQ ID NO.55 G268A
3 , there is C → A sudden change in the 124th Nucleotide of SEQ ID NO.56 C124A
4 , there is G → T sudden change in the 100th Nucleotide of SEQ ID NO.57 G100T
5 , there is G → T sudden change in the 139th Nucleotide of SEQ ID NO.58 G139T
6 , there is G → A sudden change in the 50th Nucleotide of SEQ ID NO.59 G50A
SEQ ID NO.55 mutational site: T98C, G268A
AACTAAGACAGCATAACCCGTGGGGCAGGACAGACTCCTGGGGTGGCAGCTGTGTTCATCATCTTGACTGGGTCAAGATGTATCCAGCTGTACCTTT ATGTGCGGTTTATTGTATACATCCGTTGAAACATATTAAGACAAAAAAGGGAAAACAAAGACCACAAAGGAGGGACAGGGAAGAACCCGGAAGGCGCTGGCAGCACAGGGAGGAGGCAGGTGTTTGCAGTCAGACCTGAGTCCCAGGCCCCACTCAGCCCTTCCTGCCT GGACCAGAGCACTGTCCCAGATCTCTCCAAACCTGTTTTCCCGTGGGTGAAAGAATGACCCGGGAAGTATTTACCGTTCCTTCCTGAGAACTCAGCGATATTGAACACAGTGCTGCCTCACAGTAAACACTGACAAATGGTGAGCATTACTGAGGGCAGGGC。
SEQ ID NO.56 mutational site: C124A
CTGACTCCGCTGTTCGGCACCCTGCACCCCGGCTTCTACGGAAGCAGCCGGGAGGCCTTCACCTACGAGCGCCGGCCCCAGTCCCAGGCCTACATCCCCAAGGACGAGGGCGATTTCTACTAC TGGGGGGGTTCTTCGGGGGGTCGGTGCAAGAGGTGCAGCGGCTCACCAGGGCCTGCCACCAGGCCATGATGGTCGACCAGGCCAACGGCATCGAGGCCGTGTGGCACGACGAGAGCCACCTGAACAAGTACCTGCTGCGCCACAAACCCACCAAGGT。
SEQ ID NO.57 mutational site: G100T
CCACCAAGATTTCCCTACAGCCAAACGATCTACCAACTACAAAAATGGAAAAAATAATTTAGGACATGTAAAGTTCAAATGTTTTGCCTCCCACGTTTC GTTTCAAGAAGCTATTCGAGATAAATCGCTCCGTGGTCACAGGACTTAGAAAGGTGGAGGTAAACACACACAAGCATTATAAGATAAGAAGTAACAGATGAATTAGTTGAAAGGGACTGATTTCGGGGGAAGGAAT。
SEQ ID NO.58 mutational site: G139T
TGACTATGGATGGGGAGAGGTGGGGGAGGTTTTTGTGAGAGCTGCTTCTATGAGCCTTTGGGTTAACCCACGAATACAAGGTATGATACAGCAGCCCACAAGGATGAGTACACCTGTAACTGTTGCAAGGGAGGTAAA ATTTAGGTCATGAGTCCCTTCCATTTTCCAAACCATTTCTCCATGACACCTGCAAAGGGGTCATCTATTCCAGAGTTCTCGGCTAATTCATTTGCTAGGGTGGTAAGGCTTGTAAGGCTTTTGTGATTGTCCCGTCCAGGGCTGTGTTATTG。
SEQ ID NO.59 mutational site: G50A
TGCCTTATCCGCCACCTGATTCCAAATCAAAGTAAAACATCTCTCCCCA ATGTGTACACAGCACTCCTCTAAATTAAAGGGCTGTGTGCTGGCTCTGGGTACCCCACCCGGCTCTCCCTGGCCTTTGGCGTTGGGGTTCACTGGCCTGCAGCCTGCACCCCGTGGCCCTGCGTTCTGCATCCCTCCCTCTGAAGCGAC。
Summary of the invention
One of object of the present invention is to provide ABO gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the saltant type of parallel detection ABO gene six kinds of common genotype T98C, G268A, C124A, G100T, G139T and G50A.
The technical scheme that realizes above-mentioned purpose is as follows:
An ABO gene mutation detection liquid-phase chip, includes:
(A). the wild-type designing respectively for the different mutational sites of ABO gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, and described specific primer sequence is: for SEQ ID NO.13 and the SEQ ID NO.14 in T98C site; SEQ ID NO.15 and SEQ ID NO.16 for G268A site; SEQ ID NO.17 and SEQ ID NO.18 for C124A site; SEQ ID NO.19 and SEQ ID NO.20 for G100T site; SEQ ID NO.21 and SEQ ID NO.22 for G139T site; And/or for SEQ ID NO.23 and the SEQ ID NO.24 in G50A site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.12;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.25～SEQ ID NO.36, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.
In some embodiment therein, described amplimer is: for SEQ ID NO.37 and the SEQ ID NO.38 in T98C, G268A site; SEQ ID NO.39 and SEQ ID NO.40 for C124A site; SEQ ID NO.41 and SEQ ID NO.42 for G100T site; SEQ ID NO.43 and SEQ ID NO.44 for G139T site; And/or for SEQ ID NO.45 and the SEQ ID NO.46 in G50A site.
In some embodiment therein, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.13 in T98C site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.14; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.15 in G268A site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.16; For the sequence being formed by SEQ ID NO.5 and SEQ ID NO.17 in C124A site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.18; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.19 in G100T site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.21 in G139T site and the sequence being formed by SEQ ID NO.10 and SEQ ID NO.22; And/or for the sequence being formed by SEQ ID NO.11 and SEQ ID NO.23 in G50A site and the sequence being formed by SEQ ID NO.12 and SEQ ID NO.24.
Another object of the present invention is to provide the Auele Specific Primer for ABO detection in Gene Mutation.
The technical scheme that realizes this object is as follows:
For an Auele Specific Primer for ABO detection in Gene Mutation, described Auele Specific Primer is: for SEQ ID NO.13 and the SEQ ID NO.14 in T98C site; SEQ ID NO.15 and SEQ ID NO.16 for G268A site; SEQ ID NO.17 and SEQ ID NO.18 for C124A site; SEQ ID NO.19 and SEQ ID NO.20 for G100T site; SEQ ID NO.21 and SEQ ID NO.22 for G139T site; And/or for SEQ ID NO.23 and the SEQ ID NO.24 in G50A site.
Major advantage of the present invention is:
1. the identical rate of the detected result of ABO gene mutation detection liquid-phase chip provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared ABO gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in a plurality of mutational sites.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the sudden change situation in a plurality of mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, 6 kinds of mutational sites are detected and can be completed the amplification of 5 target sequences that contain mutational site by a step PCR, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
5. the parallel detection that the ABO gene mutation detection liquid-phase chip in the present invention is a plurality of sites Multi-genotype provides a kind of technical scheme of different designs, and has produced significant technique effect.Meanwhile, due to the technical characterictics such as high-throughput high specific, the demand of more realistic application.Liquid-phase chip technology of the present invention is by the technology trends that is representing that biological target detects.
Embodiment
Embodiment 1 ABO gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
Wild-type and saltant type for ABO gene six kinds of common genotype T98C, G268A, C124A, G100T, G139T and G50A, design respectively specific primer sequence.ASPE primer is comprised of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence of table 1 ABO gene (tag sequence+specific primer sequence)
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 12 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
12 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH 2o is made into the stock solution of 100nmol/ml.Described spacerarm is for for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 * 10 6the carboxylated microballoon of individual above-mentioned numbering (purchased from Luminex company) is suspended in the MES solution of 50ul0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (purchased from the Pierce Chemical company) working fluid of preparation 10ng/ml.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris (pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For ABO gene six kinds of common genotype T98C, G268A, C124A, G100T, G139T and G50A, design of amplification primers, to (in Table 3), amplifies 5 target sequences that contain 6 mutational sites.
Table 3 amplifies the primer of the target sequence with mutational site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
The detection of ABO gene mutation detection liquid-phase chip described in embodiment 2 utilization embodiment 1 to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 * Tm hybridization buffer
After filtration, be stored in 4 ℃.
ExoSAP-IT test kit is purchased from U.S. USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to < < molecular cloning > > about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design 5 pairs of primers, multiplex PCR one step amplifies 5 target sequences that contain respectively six kinds of common genotype T98C of ABO gene and G268A, C124A, G100T, G139T, G50A, product size is respectively 430bp, 281bp, 236bp, 291bp, 199bp, and primer sequence (SEQ ID NO.37-46) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.37-46 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
According to design ASPE primer, the corresponding 12 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 * 10 5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul 2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH 2o complements to 50ul;
7. with masking foil, encase 96 orifice plates with lucifuge, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 * Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 ℃, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 * PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI (NET MFI be less than 0 with 0 expression);
3. meet the data of above two conditions, by following formula, calculate sudden change ratio:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments ABO gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.With sequencing, detect with liquid-phase chip result and compare, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments ABO genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible ABO gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of ABO exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Two of table 5 pattern detection result (MFI)
Table 6 sample ABO transgenation ratio (%)
Sample number T98C G268A C124A G100T G139T G50A
1 2％ 2％ 2％ 2％ 2％ 1％
2 2％ 2％ 2％ 2％ 2％ 1％
3 2％ 1％ 2％ 50％ 2％ 2％
4 2％ 1％ 2％ 2％ 2％ 1％
5 1％ 1％ 2％ 2％ 1％ 1％
6 1％ 2％ 2％ 2％ 2％ 2％
7 98％ 1％ 2％ 2％ 2％ 2％
8 2％ 1％ 2％ 3％ 1％ 2％
9 2％ 2％ 1％ 2％ 2％ 2％
10 1％ 2％ 1％ 2％ 2％ 2％
11 2％ 2％ 3％ 2％ 1％ 2％
12 3％ 3％ 2％ 2％ 3％ 98％
13 3％ 2％ 2％ 1％ 2％ 3％
14 3％ 1％ 2％ 2％ 2％ 1％
15 2％ 99％ 2％ 1％ 2％ 1％
16 3％ 2％ 2％ 2％ 2％ 2％
17 3％ 1％ 1％ 2％ 2％ 1％
18 2％ 2％ 2％ 1％ 1％ 51％
19 2％ 1％ 2％ 2％ 2％ 1％
20 3％ 2％ 1％ 3％ 2％ 1％
Table 7 sample ABO gene mutation type analytical results
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to ABO gene SNP site
One, the design that prepared by liquid-phase chip (selection of Tag sequence and Anti-Tag sequence)
Take ABO gene T98C, G268A, G100T and G50A site mutation, to detect liquid-phase chip be example, respectively for the wild-type of T98C, G268A, G100T and G50A and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ ID NO.12, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.25-SEQ ID NO.36.Specific design is as shown in following table (table 8).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 8 liquid-phase chip
One, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 9 sample ABO gene T98C detected result and gene mutation analysis
Table 10 sample ABO gene G268A detected result and gene mutation analysis
Table 11 sample ABO gene G100T detected result and gene mutation analysis
Table 12 sample ABO gene G50A detected result and gene mutation analysis
From above-described embodiment, other is for the liquid-phase chip in different mutational sites, and ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1, test group 5, test group 8 and test group 12.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4 ABO detection in Gene Mutation specific primer sequences
One, the design that prepared by liquid-phase chip (selection of wild-type and saltant type specific primer sequence)
Take the mutational site of ABO gene C 124A and G139T, to detect liquid-phase chip be example, the complementary sequence forward or backwards of this place, mutational site target sequence of take is template, respectively for the wild-type of C124A and G139T and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 12.Wherein, interior base is mutational site.
Table 13 specific primer sequence
Take the mutational site of ABO gene C 124A and G139T, to detect liquid-phase chip be example, for C124A and G139T, select different specific primer sequences, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 14).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 14 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 15 sample ABO gene C 124A detected result and gene mutation analysis
Table 16 sample ABO gene G139T detected result and gene mutation analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 13 and test group 16.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 1 and 2 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different SNP sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detects effect also better, and concrete data are omitted.
The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.

Claims (5)

1. an ABO gene mutation detection liquid-phase chip, is characterized in that, includes:
(A). the wild-type designing respectively for the different mutational sites of ABO gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, and described specific primer sequence is: for SEQ ID NO.13 and the SEQ ID NO.14 in T98C site; And also include SEQ ID NO.15 and the SEQ ID NO.16 for G268A site; SEQ ID NO.17 and SEQ ID NO.18 for C124A site; SEQ ID NO.19 and SEQ ID NO.20 for G100T site; SEQ ID NO.21 and SEQ ID NO.22 for G139T site; And/or for SEQ ID NO.23 and the SEQ ID NO.24 in G50A site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.12;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.25～SEQ ID NO.36, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that have corresponding mutational site, described amplimer is: for SEQ ID NO.37 and the SEQ ID NO.38 in T98C, G268A site; And also include SEQ ID NO.39 and the SEQ ID NO.40 for C124A site; SEQID NO.41 and SEQ ID NO.42 for G100T site; SEQ ID NO.43 and SEQ ID NO.44 for G139T site; And/or for SEQ ID NO.45 and the SEQ ID NO.46 in G50A site.
2. ABO gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.13 in T98C site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.14; And also include for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.15 in G268A site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.16; For the sequence being formed by SEQ ID NO.5 and SEQ ID NO.17 in C124A site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.18; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.19 in G100T site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.21 in G139T site and the sequence being formed by SEQ ID NO.10 and SEQ ID NO.22; And/or for the sequence being formed by SEQ ID NO.11 and SEQ ID NO.23 in G50A site and the sequence being formed by SEQ ID NO.12 and SEQ ID NO.24.
3. ABO gene mutation detection liquid-phase chip according to claim 1, is characterized in that,
(A). described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.13 in T98C site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.14; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.15 in G268A site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.16; For the sequence being formed by SEQ ID NO.5 and SEQ ID NO.17 in C124A site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.18; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.19 in G100T site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.21 in G139T site and the sequence being formed by SEQ ID NO.10 and SEQ ID NO.22; With the sequence being formed by SEQ ID NO.11 and SEQ ID NO.23 for G50A site and the sequence being formed by SEQ ID NO.12 and SEQ ID NO.24;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.25～SEQ ID NO.36, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). described amplimer is: for SEQ ID NO.37 and the SEQ ID NO.38 in T98C, G268A site; SEQ ID NO.39 and SEQ ID NO.40 for C124A site; SEQ ID NO.41 and SEQ ID NO.42 for G100T site; SEQ ID NO.43 and SEQ ID NO.44 for G139T site; With SEQ ID NO.45 and the SEQ ID NO.46 for G50A site.
4. according to the ABO gene mutation detection liquid-phase chip described in claim 1-3 any one, it is characterized in that, described spacerarm is 5-10 T.
5. for an Auele Specific Primer for ABO detection in Gene Mutation, it is characterized in that, described Auele Specific Primer is: for SEQ ID NO.13 and the SEQ ID NO.14 in T98C site; And also include SEQ ID NO.15 and the SEQ ID NO.16 for G268A site; SEQ ID NO.17 and SEQ ID NO.18 for C124A site; SEQ ID NO.19 and SEQ ID NO.20 for G100T site; SEQ ID NO.21 and SEQ ID NO.22 for G139T site; And/or for SEQ ID NO.23 and the SEQ ID NO.24 in G50A site.
CN201210107203.1A 2012-04-12 2012-04-12 ABO gene mutation detection specific primers and liquid chip Expired - Fee Related CN103374609B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210107203.1A CN103374609B (en) 2012-04-12 2012-04-12 ABO gene mutation detection specific primers and liquid chip

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210107203.1A CN103374609B (en) 2012-04-12 2012-04-12 ABO gene mutation detection specific primers and liquid chip

Publications (2)

Publication Number Publication Date
CN103374609A CN103374609A (en) 2013-10-30
CN103374609B true CN103374609B (en) 2014-11-26

Family

ID=49460441

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210107203.1A Expired - Fee Related CN103374609B (en) 2012-04-12 2012-04-12 ABO gene mutation detection specific primers and liquid chip

Country Status (1)

Country Link
CN (1) CN103374609B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106048059B (en) * 2016-08-10 2019-04-09 青岛大学附属医院 A kind of SNP site for the A anomaly blood group causing acute hemolytic transfusion reaction
CN106636420B (en) * 2017-01-04 2020-09-01 青岛市中心血站 SNP site of ABO blood type variant for triggering hemolytic transfusion reaction
CN112029842B (en) * 2020-08-31 2021-04-27 深圳市血液中心(深圳市输血医学研究所) Kit and method for ABO blood type genotyping based on high-throughput sequencing

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101984070B (en) * 2010-09-21 2013-04-24 广州益善生物技术有限公司 c-KIT gene mutation detection liquid-phase chip
CN101984071B (en) * 2010-09-21 2013-01-16 广州益善生物技术有限公司 Bcr-Abl gene mutation detection liquid-phase chip
CN102115788B (en) * 2010-12-02 2012-12-26 公安部物证鉴定中心 SNP composite detection system and detection method
CN102154455B (en) * 2010-12-30 2013-03-20 广州益善生物技术有限公司 Specific primer and liquid phase chip for SNP (Single Nucleotide Polymorphism) detection of CYP2C9 (Cytochrome P4502C9)

Also Published As

Publication number Publication date
CN103374609A (en) 2013-10-30

Similar Documents

Publication Publication Date Title
CN103374609B (en) ABO gene mutation detection specific primers and liquid chip
CN102134605B (en) Single-nucleotide polymorphism (SNP) detection specific primer of CYP2C19 gene and liquid phase chip
CN103451271A (en) THADA gene mutation detection specific primer and liquid phase chip
CN102191337B (en) Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
CN102912002B (en) ABCB2 gene polymorphism detection specific primers and liquid chip
CN103031369B (en) CDKN2A gene mutation detection specific primer and liquid chip
CN102952866B (en) Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene
CN102191336B (en) MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip
CN103451272A (en) BAT3 gene mutation detection specific primer and liquid phase chip
CN102181573B (en) Specific primers and liquid-phase chip for detection of KITLG gene
CN103374606B (en) CHEK1 (checkpoint kinase 1) gene mutation detection specific primers and liquid chip
CN103374608B (en) MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip
CN102888444B (en) Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip
CN103451266B (en) NKX3.1 gene mutation detection specific primers and liquid chip
CN103374611B (en) LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip
CN102952872B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene
CN102952869B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene
CN103571919A (en) Specific detection primers and detection liquid phase chip for HNF1B gene mutation
CN102952868B (en) Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene
CN103849675B (en) RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103031371B (en) CDH1 gene mutation detection specific primer and liquid chip
CN102952867B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene
CN102952870B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene
CN103451273B (en) TGM5 gene mutation detection specific primer and liquid phase chip
CN102952874B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C53 Correction of patent for invention or patent application
CB02 Change of applicant information

Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Applicant after: Surexam Biological Technology Co., Ltd.

Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Applicant before: Guangzhou Yishan Biotechnology Co., Ltd.

COR Change of bibliographic data

Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD.

C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20141126

Termination date: 20150412

EXPY Termination of patent right or utility model