CN102952868B - Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene - Google Patents
Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene Download PDFInfo
- Publication number
- CN102952868B CN102952868B CN201110251552.6A CN201110251552A CN102952868B CN 102952868 B CN102952868 B CN 102952868B CN 201110251552 A CN201110251552 A CN 201110251552A CN 102952868 B CN102952868 B CN 102952868B
- Authority
- CN
- China
- Prior art keywords
- seqidno
- site
- sequence
- seq
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a specific primer and liquid chip for detecting an SLC15A2 gene. The liquid chip mainly comprises ASPE (allele specific primer extension) primers, microspheres and amplification primers, wherein each ASPE primer is formed by tag sequences at the 5' terminal and specific primer sequences which are arranged at the 3' terminal and aim at the mutation site of the target gene; the specific primer sequences are SEQ ID NO.9 and SEQ ID NO.10 aiming at the C82T site, SEQ ID NO.11 and SEQ ID NO.12 aiming at the G115A site, SEQ ID NO.13 and SEQ ID NO.14 aiming at the G133A site and/or SEQ ID NO.15 and SEQ ID NO.16 aiming at the C107T site; and the microspheres are enveloped by anti-tag sequences. The detecting liquid chip provided by the invention has the advantages that the consistency of the detection result and the sequencing method is as high as 100%, thus parallel detection of wild types and mutant types of a plurality of mutation sites is achieved.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of SLC15A2 gene pleiomorphism detection specificity primer and the liquid-phase chip of relating to.
Background technology
Enteron aisle peptide transport protein 2 (peptide transporter, PepT2, peptide transporter, SLC 15A2) is the albumen that can transport dipeptides, tripeptides in mammalian body.Research shows, the small-molecule drug of some class peptides is substrates of SLC15A2, and this small-molecule drug metabolism situation is relevant to SLC15A2 gene pleiomorphism.
At present, the method that SLC15A2 gene pleiomorphism is detected, analyzed mainly contains: direct sequencing and PCR-RFLP analytical method etc., wherein the most frequently used method has PCR-RFLP analytical method.PCR-RFLP method is the change of the restriction enzyme enzyme recognition site that causes based on transgenation, as lost or generation novel site in site, by a certain specific fragment of pcr amplification, use again digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, the transgenation that this method changes for detection of restriction enzyme site, can directly judge genotype, but this method can not be used for not producing the detection in Gene Mutation of new restriction enzyme site.Again, above these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not meet the needs of practical application.
The SLC15A2 gene mutation site of target detect of the present invention, it is as shown in the table:
| Sequence number | The content of SLC15A2 site mutation | Write a Chinese character in simplified form |
| 1 | , there is C → T sudden change in the 82nd Nucleotide of SEQ ID NO.41 | C82T |
| 2 | , there is G → A sudden change in the 115th Nucleotide of SEQ ID NO.42 | G115A |
| 3 | , there is G → A sudden change in the 133rd Nucleotide of SEQ ID NO.43 | G133A |
| 4 | , there is C → T sudden change in the 107th Nucleotide of SEQ ID NO.44 | C107T |
SEQ ID NO.41GTGTTGCCATTGTATCTGAAGGATTATTTGTTGGTGATTCTGACATGTGTTCTTTGCTCTAAGGAAATGGCCCCAGCCCAGCCAGGTCCCCAGGAGGTTTTCCTACAAGTCTTGAATCTGGCAGATGATGAGGTGAAGGTGACAGTGGTGGGAAATGAAAACAATTCTCTGTTGATAGAGTCCATCAAATCCTTTCAGGTGAGGTGTGTACCTGAATGAATTAGAAACTCTGTATGCTATATTGATCTTGATTTTTCCTTAACATTAATTGTATCATAAGCATCTTCCCATGTCTTTAGATAATCTTTGAGCACATGATTTTAATGGGCATAT
SEQ ID NO.42CAACATCTTACCAAGGATCTGCCTGATGATCAAATTTTCTGAGTATAGGTCTTATTTCATCAGCTGTTACTGATTTTTACTTTCCTCTGTTGTAGGTAAAGGATACAGAAAGCAGAACAACCAATGGGATGACAACCGTGAGGTTTGAATGTCAATGAGATTCCAGGCCACTCTGTTTTCTTGAATCTTGGATCTCTTCTAATCTTTGGGGCTGCATTCTACTTGTTCTGAACAGGAATTCCCTCTCGTAGAATGCCAGGGGCACTGGTGTCAAAAGG
SEQ ID NO.43CTGGGCAAAGACTGAGTCAATTTAGAGTAATCCATACAGACATAGTGAACACTTACGAGAAGTTAATTCCACACTTGGAGACCAGACGATAAATGACAAAGTCAAACAACGGGATGAAGATAAGAACCAGAAGGGGATTTAGAACCTGTAACACCATGATAAAAAGGATTAGCTACAAATATTCTCCTATCATGAGTGTGAGCACTGCACTCATTTGCTTGTTTACACTCTGTCTCACATCTACACACACTTTTGTCATTGTAAGTACAGAATGACTCCACATTCCTCAGTCCATTTACACCCA
SEQ ID NO.44GAGAGGAGGTTGAATGCAGTAGGATAGAATCATTTTGAACATTAGGAAAGACTCTATCAAGCCATAAGATGTTTCTGCATTTCCAACTTACTGGATATTTCTCAGCCGCCCAGTCTAGCCAGTGCTGTCGCTTTGGAATGTCTCCAGAACGGTTCTTGAAACGATTGGAAATAGCAAACTAGGGCAGAGAGTAGACATCATGGGAGAGACAAAGAGAAAAACATCCTCTGCCTTTTCCAACTTATTATACCTTCCTTCAAACACCATACTTCTAGTGACTTATTCCAACTCTTTGACCTAATCAGGCATTGA
Summary of the invention
One of object of the present invention is to provide SLC15A2 gene pleiomorphism and detects liquid-phase chip.This liquid-phase chip can be used for wild-type and the saltant type of individual event or parallel detection SLC15A2 gene four kinds of common genotype C82T, G115A, G133A and C107T.
The technical scheme that realizes above-mentioned purpose is as follows:
A kind of SLC15A2 gene pleiomorphism detects liquid-phase chip, includes:
(A). the wild-type designing respectively for the different pleomorphism sites of SLC15A2 gene and the ASPE primer of saltant type: every kind of ASPE primer is comprised of for the specific primer sequence of goal gene pleomorphism site tag sequence and the 3 ' end of 5 ' end, and described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C82T site; For SEQ ID NO.11 and the SEQ ID NO.12 in G115A site; For SEQ ID NO.13 and the SEQ ID NO.14 in G133A site; And/or for SEQ ID NO.15 and the SEQ ID NO.16 in C107T site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.8;
(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.17～SEQ ID NO.24, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs the target sequence detecting, there is corresponding mutational site.
Preferably, described amplimer is: for SEQ ID NO.25 and the SEQ ID NO.26 in C82T site; For SEQ ID NO.27 and the SEQ ID NO.28 in G115A site; For SEQ ID NO.29 and the SEQ ID NO.30 in G133A site; And/or for SEQ ID NO.31 and the SEQ ID NO.32 in C107T site.
Preferably, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.9 in C82T site and the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.10; The sequence forming for the sequence being formed by SEQ ID NO.3 and SEQ IDNO.11 in G115A site and by SEQ ID NO.4 and SEQ ID NO.12; For the sequence being formed by SEQ IDNO.5 and SEQ ID NO.13 in G133A site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.14; And/or for the sequence being formed by SEQ ID NO.7 and SEQ ID NO.15 in C107T site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.16.
Another object of the present invention is to provide the Auele Specific Primer detecting for SLC15A2 gene pleiomorphism.
The technical scheme that realizes this object is as follows:
The Auele Specific Primer detecting for SLC15A2 gene pleiomorphism, this Auele Specific Primer is: for SEQ IDNO.9 and the SEQ ID NO.10 in C82T site; For SEQ ID NO.11 and the SEQ ID NO.12 in G115A site; For SEQ ID NO.13 and the SEQ ID NO.14 in G133A site; And/or for SEQ ID NO.15 and the SEQ ID NO.16 in C107T site.Major advantage of the present invention is:
1. the identical rate of detection method provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared SLC15A2 gene pleiomorphism detects liquid-phase chip and has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection of multiple pleomorphism sites.
2. the ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, the also polymorphism situation in the multiple mutational sites of parallel detection simultaneously, detects effect consistent.
3. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.Detection method step of the present invention is simple, four kinds of pleomorphism sites detect the amplification that can complete by a step multiplex PCR four target sequences that contain pleomorphism site, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1
Described in the present embodiment, SLC15A2 gene pleiomorphism detects liquid-phase chip, mainly includes:
One, ASPE primer
For wild-type and the saltant type of SLC15A2 gene four kinds of common genotype C82T, G115A, G133A and C107T, design respectively specific primer sequence.ASPE primer is comprised of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (tag sequence+specific primer sequence) of table 1SLC15A2 gene
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 8 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
8 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH
2o is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 × 10
6the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (purchased from the Pierce Chemical company) working fluid of preparation 10ng/ml.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris (pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For SLC15A2 gene four kinds of common genotype C82T, G115A, G133A and C107T, design of amplification primers, to (in Table 3), amplifies respectively four target sequences that contain pleomorphism site.
Table 3 amplifies the primer of the target sequence with pleomorphism site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Embodiment 2 uses SLC15A2 gene pleiomorphism described in embodiment 1 to detect the detection of liquid-phase chip to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 × Tm hybridization buffer
| Reagent | Source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | SigmaT3038 | 0.2M | 50ml |
| 5MNaCl | Sigma S5150 | 0.4M | 20ml |
| Triton X-100 | Sigma T8787 | 0.16％ | 0.4ml |
After filtration, be stored in 4 ℃.
ExoSAP-IT test kit is purchased from U.S. USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to < < molecular cloning > > about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design four pairs of primers, multiplex PCR one step amplifies the amplified production that contains respectively SLC15A2 gene four kinds of common genotype C82T, G115A, G133A and C107T, product size is respectively 333bp, 278bp, 304bp and 299bp, and primer sequence (SEQID NO.25-32) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.25-32 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.Enzyme is cut product after treatment and is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make multiple biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
According to design ASPE primer, the corresponding 8 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 × 10
5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul
2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH
2o complements to 50ul;
7. with masking foil, encase 96 orifice plates with lucifuge, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 × Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 ℃, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI (NET MFI be less than 0 with 0 expression);
3. meet the data of above two conditions, by following formula, calculate sudden change ratio:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NETMFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments SLC15A2 gene polymorphism sites originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.With sequencing, detect with liquid-phase chip result and compare, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments SLC15A2 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible SLC15A2 gene pleiomorphism provided by the present invention detects liquid-phase chip can detect SLC15A2 gene polymorphism sites type exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Table 5 sample SLC15A2 transgenation ratio (%)
| Sample number | C82T | G115A | G133A | C107T |
| 1 | 2％ | 1％ | 2％ | 2％ |
| 2 | 2％ | 2％ | 2％ | 1％ |
| 3 | 2％ | 2％ | 2％ | 2％ |
| 4 | 2％ | 2％ | 2％ | 3％ |
| 5 | 3％ | 1％ | 3％ | 2％ |
| 6 | 99％ | 1％ | 2％ | 3％ |
| 7 | 1％ | 1％ | 3％ | 2％ |
| 8 | 2％ | 1％ | 2％ | 3％ |
| 9 | 2％ | 2％ | 3％ | 2％ |
| 10 | 1％ | 2％ | 48％ | 2％ |
| 11 | 2％ | 1％ | 1％ | 1％ |
| 12 | 2％ | 2％ | 3％ | 1％ |
| 13 | 2％ | 98％ | 2％ | 1％ |
| 14 | 2％ | 1％ | 2％ | 2％ |
| 15 | 2％ | 3％ | 3％ | 2％ |
| 16 | 3％ | 2％ | 3％ | 3％ |
| 17 | 2％ | 2％ | 1％ | 1％ |
| 18 | 2％ | 2％ | 2％ | 1％ |
| 19 | 2％ | 1％ | 2％ | 2％ |
| 20 | 1％ | 1％ | 1％ | 2％ |
Table 6 sample SLC 15A2 gene mutation type analytical results
| Catalogue number(Cat.No.) | Liquid-phase chip detected result | Sequencing result |
| 1 | Wild-type | Wild-type |
| 2 | Wild-type | Wild-type |
| 3 | Wild-type | Wild-type |
| 4 | Wild-type | Wild-type |
| 5 | Wild-type | Wild-type |
| 6 | 82TT | 82TT |
| 7 | Wild-type | Wild-type |
| 8 | Wild-type | Wild-type |
| 9 | Wild-type | Wild-type |
| 10 | 133GA | 133GA |
| 11 | Wild-type | Wild-type |
| 12 | Wild-type | Wild-type |
| 13 | 115AA | 115AA |
| 14 | Wild-type | Wild-type |
| 15 | Wild-type | Wild-type |
| 16 | Wild-type | Wild-type |
| 17 | Wild-type | Wild-type |
| 18 | Wild-type | Wild-type |
| 19 | Wild-type | Wild-type |
| 20 | Wild-type | Wild-type |
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to SLC15A2 gene polymorphism sites
One, the design (selection of tag sequence and Anti-tag sequence) that prepared by liquid-phase chip
Take SLC15A2 gene G115A and C107T site mutation, detect liquid-phase chip as example, respectively for the wild-type of G115A and C107T and the specific primer sequence of saltant type design ASPE primer 3 ' end, the tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ ID NO.8, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.17-SEQ ID NO.24.Specific design is as shown in following table (table 7).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 7 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 8 pattern detection result and Polymorphism Analysis
Table 9 pattern detection result and Polymorphism Analysis
From experimental result, ASPE primer uses different tag sequences, and its result is still reliable and stable, but ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 2 and test group 5.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
Other is for the liquid-phase chip in different mutational sites, and ASPE primer uses different Tag sequences, and its result is still reliable and stable, and while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect is better, and concrete data are omitted.
The selection of embodiment 4SLC15A2 gene pleiomorphism detection specificity primer sequence
One, the design (selection of wild-type and saltant type specific primer sequence) that prepared by liquid-phase chip
Take the pleomorphism site of SLC15A2 gene C 82T and G133A, detect liquid-phase chip as example, take the complementary sequence forward or backwards of this place, mutational site target sequence as template, respectively for the wild-type of C82T and G133A and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 10.Wherein,
interior base is pleomorphism site.
Table 10 specific primer sequence
Take the pleomorphism site of SLC15A2 gene C 82T and G133A, detect liquid-phase chip as example, for C82T and G133A, select different specific primer sequences, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 11).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 11 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 12 pattern detection result and Polymorphism Analysis
Table 13 pattern detection result and Polymorphism Analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 7 and test group 10.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 1 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different mutational sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detect effect also better, concrete data are omitted.
Be more than for the illustrating of possible embodiments of the present invention, but this embodiment is not in order to limit the scope of the claims of the present invention, allly do not depart from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the scope of the claims of the present invention.
Claims (6)
1. SLC15A2 gene pleiomorphism detects a liquid-phase chip, it is characterized in that, includes:
(A). the wild-type designing respectively for the different pleomorphism sites of SLC15A2 gene and the ASPE primer of saltant type: every kind of ASPE primer is comprised of for the specific primer sequence of goal gene pleomorphism site tag sequence and the 3 ' end of 5 ' end, described specific primer sequence is: for SEQIDNO.9 and the SEQIDNO.10 in C82T site, and be selected from SEQIDNO.11 and the SEQIDNO.12 for G115A site; For SEQIDNO.13 and the SEQIDNO.14 in G133A site; With at least one pair of in SEQIDNO.15 and SEQIDNO.16 for C107T site; Described tag sequence is selected from SEQID NO.1～SEQIDNO.8; , there is C → T sudden change in the 82nd Nucleotide that described C82T site is SEQIDNO.41; , there is G → A sudden change in the 115th Nucleotide that described G115A site is SEQIDNO.42; Described G133A site is the 133rd Nucleotide of SEQID NO.43, and G → A sudden change occurs; , there is C → T sudden change in the 107th Nucleotide that described C107T site is SEQIDNO.44;
(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQIDNO.17～SEQIDNO.24, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs the target sequence detecting, there is corresponding mutational site.
2. SLC15A2 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described amplimer is: for SEQIDNO.25 and the SEQIDNO.26 in C82T site, and be selected from SEQIDNO.27 and the SEQIDNO.28 for G115A site; For SEQIDNO.29 and the SEQIDNO.30 in G133A site; With at least one pair of in SEQ IDNO.31 and SEQIDNO.32 for C107T site.
3. SLC15A2 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described ASPE primer is: the sequence forming for the sequence being formed by SEQIDNO.1 and SEQIDNO.9 in C82T site and by SEQIDNO.2 and SEQID NO.10, and be selected from for the sequence being formed by SEQIDNO.3 and SEQIDNO.11 in G115A site and the sequence that formed by SEQIDNO.4 and SEQIDNO.12; For the sequence being formed by SEQIDNO.5 and SEQID NO.13 in G133A site and the sequence being formed by SEQIDNO.6 and SEQIDNO.14; With at least one pair of in the sequence being formed by SEQ IDNO.7 and SEQIDNO.15 for C107T site and the sequence that formed by SEQIDNO.8 and SEQIDNO.16.
4. SLC15A2 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that,
(A). described ASPE primer is: for the sequence being comprised of SEQIDNO.1 and SEQIDNO.9 in C82T site and the sequence that is comprised of SEQIDNO.2 and SEQIDNO.10; For the sequence being formed by SEQIDNO.3 and SEQID NO.11 in G115A site and the sequence being formed by SEQIDNO.4 and SEQIDNO.12; For the sequence being formed by SEQ IDNO.5 and SEQIDNO.13 in G133A site and the sequence being formed by SEQIDNO.6 and SEQIDNO.14; With the sequence being formed by SEQIDNO.7 and SEQIDNO.15 for C107T site and the sequence being formed by SEQIDNO.8 and SEQIDNO.16;
(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQIDNO.17～SEQIDNO.24, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). described amplimer is: for SEQIDNO.25 and the SEQIDNO.26 in C82T site; For SEQIDNO.27 and the SEQIDNO.28 in G115A site; For SEQIDNO.29 and the SEQIDNO.30 in G133A site; With SEQIDNO.31 and the SEQIDNO.32 for C107T site.
5. according to the SLC15A2 gene pleiomorphism described in claim 1-4 any one, detect liquid-phase chip, it is characterized in that, described spacerarm is 5-10 T.
6. the Auele Specific Primer detecting for SLC15A2 gene pleiomorphism, is characterized in that, described specific primer sequence is: for SEQIDNO.9 and the SEQIDNO.10 in C82T site, and be selected from SEQIDNO.11 and the SEQID NO.12 for G115A site; For SEQIDNO.13 and the SEQIDNO.14 in G133A site; Arbitrary right with in SEQIDNO.15 for C107T site and SEQIDNO.16,, there is C → T sudden change in the 82nd Nucleotide that described C82T site is SEQIDNO.41; , there is G → A sudden change in the 115th Nucleotide that described G115A site is SEQIDNO.42; , there is G → A sudden change in the 133rd Nucleotide that described G133A site is SEQIDNO.43; , there is C → T sudden change in the 107th Nucleotide that described C107T site is SEQIDNO.44.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110251552.6A CN102952868B (en) | 2011-08-29 | 2011-08-29 | Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110251552.6A CN102952868B (en) | 2011-08-29 | 2011-08-29 | Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102952868A CN102952868A (en) | 2013-03-06 |
| CN102952868B true CN102952868B (en) | 2014-04-16 |
Family
ID=47762249
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110251552.6A Expired - Fee Related CN102952868B (en) | 2011-08-29 | 2011-08-29 | Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102952868B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101781684A (en) * | 2010-01-29 | 2010-07-21 | 广州益善生物技术有限公司 | Liquid phase chip for CYP19A1 gene SNP (Single Nucleotide Polymorphism) detection and detection method thereof |
-
2011
- 2011-08-29 CN CN201110251552.6A patent/CN102952868B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101781684A (en) * | 2010-01-29 | 2010-07-21 | 广州益善生物技术有限公司 | Liquid phase chip for CYP19A1 gene SNP (Single Nucleotide Polymorphism) detection and detection method thereof |
Non-Patent Citations (6)
| Title |
|---|
| Functional characterization of the peptide transporter PEPT2 in primary cultures of human upper airway epithelium;Praveen M. Bahadduri et.al.;《American Journal of Respiratory Cell and Molecular Biology》;20041230;第32卷(第4期);第319-325页 * |
| Genetic Variants of the Human H+/Dipeptide Transporter PEPT2: Analysis of Haplotype Functions;Julia Pinsonneault et.al.;《The Journal of Pharmacology and Expreimental Therapeutics》;20040728;第311卷(第3期);第1088-1096页 * |
| Interethnic differences of PEPT2 (SLC15A2) polymorphism distribution and associations with cephalexin pharmacokinetics in healthy Asian subjects;Rui Liu et.al.;《European Journal of Clinical Pharmacology》;20090131;第65卷(第1期);第65-70页 * |
| Julia Pinsonneault et.al..Genetic Variants of the Human H+/Dipeptide Transporter PEPT2: Analysis of Haplotype Functions.《The Journal of Pharmacology and Expreimental Therapeutics》.2004,第311卷(第3期),第1088-1096页. |
| Praveen M. Bahadduri et.al..Functional characterization of the peptide transporter PEPT2 in primary cultures of human upper airway epithelium.《American Journal of Respiratory Cell and Molecular Biology》.2004,第32卷(第4期),第319-325页. |
| Rui Liu et.al..Interethnic differences of PEPT2 (SLC15A2) polymorphism distribution and associations with cephalexin pharmacokinetics in healthy Asian subjects.《European Journal of Clinical Pharmacology》.2009,第65卷(第1期),第65-70页. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102952868A (en) | 2013-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103451271A (en) | THADA gene mutation detection specific primer and liquid phase chip | |
| CN103374609B (en) | ABO gene mutation detection specific primers and liquid chip | |
| CN102912002B (en) | ABCB2 gene polymorphism detection specific primers and liquid chip | |
| CN102191337B (en) | Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene | |
| CN103031365B (en) | ATM gene mutation detection specific primer and liquid chip | |
| CN102952868B (en) | Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene | |
| CN103451272A (en) | BAT3 gene mutation detection specific primer and liquid phase chip | |
| CN102952866B (en) | Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene | |
| CN103374607B (en) | ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip | |
| CN102191336B (en) | MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip | |
| CN102181573B (en) | Specific primers and liquid-phase chip for detection of KITLG gene | |
| CN102952867B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene | |
| CN102952869B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene | |
| CN102952872B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene | |
| CN102952870B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene | |
| CN102952874B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene | |
| CN102888444B (en) | Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip | |
| CN102952873B (en) | Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene | |
| CN102191335B (en) | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes | |
| CN102994625B (en) | PIK3R1 gene mutation detection specificity primer and liquid chip thereof | |
| CN102912007B (en) | CYP2B6 gene polymorphism detection specific primers and liquid chip | |
| CN103849943A (en) | Specific primer and liquid phase chip for detecting MC1R gene mutation | |
| CN103031371B (en) | CDH1 gene mutation detection specific primer and liquid chip | |
| CN102912005A (en) | CYP2C8 gene polymorphism detection specific primers and liquid chip | |
| CN103451273B (en) | TGM5 gene mutation detection specific primer and liquid phase chip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB02 | Change of applicant information |
Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant after: Surexam Biological Technology Co., Ltd. Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant before: Guangzhou Yishan Biotechnology Co., Ltd. |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140416 Termination date: 20140829 |
|
| EXPY | Termination of patent right or utility model |