CN102952873B - Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene - Google Patents
Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene Download PDFInfo
- Publication number
- CN102952873B CN102952873B CN201110251736.2A CN201110251736A CN102952873B CN 102952873 B CN102952873 B CN 102952873B CN 201110251736 A CN201110251736 A CN 201110251736A CN 102952873 B CN102952873 B CN 102952873B
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- site
- primer
- tag
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a liquid chip and specific primer for detecting an NAT1 (N-acetyltransferase 1) gene. The liquid chip mainly comprises ASPE (allele specific primer extension) primers, microspheres and amplification primers, wherein each ASPE primer is formed by tag sequences at the 5' terminal and specific primer sequences which are arranged at the 3' terminal and aim at the mutation site of the target gene; the specific primer sequences are SEQ ID NO.15 and SEQ ID NO.16 aiming at the C135T site, SEQ ID NO.17 and SEQ ID NO.18 aiming at the G136A site, SEQ ID NO.19 and SEQ ID NO.20 aiming at the T216G site, SEQ ID NO.21 and SEQ ID NO.22 aiming at the A328T site, SEQ ID NO.23 and SEQ ID NO.24 aiming at the A460T site, SEQ ID NO.25 and SEQ ID NO.26 aiming at the C106T site and/or SEQ ID NO.27 and SEQ ID NO.28 aiming at the C199T site; and the microspheres are enveloped by anti-tag sequences. The detecting liquid chip provided by the invention has the advantages that the consistency of the detection result and the sequencing method is as high as 100%, thus parallel detection of wild types and mutant types of a plurality of mutation sites is achieved.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of NAT1 gene pleiomorphism detection specificity primer and the liquid-phase chip of relating to.
Background technology
N-acetylize metabolism is the important biomolecule path for transformation of a lot of aryl amines and hydrazine compound; by N-acetyltransferase (NAT) catalysis that depends on acetyl-CoA; N-acetyl transferase (N-acetyltrans ferasel; NAT) be that catalysis nitrogenous compound makes it acetylizad enzyme system in body; its nitrogenous exogenous material that can activate or degrade, especially contains the exogenous carcinogens of amido.The gene of coding NAT has NAT1 and NAT2, be positioned on the 8th pair of karyomit(e) (8p21.3-23.1), there are some researches show, mankind NAT1 has tissue distribution widely, be present in mucous membrane of colon, liver, bladder, red corpuscle and lymphocyte, be dominant Transacetylase in colorectum tissue, and participate in the metabolism of patients with inflammatory bowel disease 5-aminosalicylic acid in mucous membrane of colon.
The NAT1 gene mutation site of target detect of the present invention, it is as shown in the table:
| Sequence number | The content of NAT1 site mutation | Write a Chinese character in simplified form |
| 1 | , there is C → T sudden change in the 135th Nucleotide of SEQ ID NO.55 | C135T |
| 2 | , there is G → A sudden change in the 136th Nucleotide of SEQ ID NO.55 | G136A |
| 3 | , there is T → G sudden change in the 216th Nucleotide of SEQ ID NO.55 | T216G |
| 4 | , there is A → T sudden change in the 328th Nucleotide of SEQ ID NO.55 | A328T |
| 5 | , there is A → T sudden change in the 460th Nucleotide of SEQ ID NO.55 | A460T |
| 6 | , there is C → T sudden change in the 106th Nucleotide of SEQ ID NO.56 | C106T |
| 7 | , there is C → T sudden change in the 199th Nucleotide of SEQ ID NO.56 | C199T |
SEQ ID NO.55 and the concrete sequence of SEQ ID NO.56 are as follows:
SEQ ID NO.55
ATCAGCCTCAGGTGCCTTGTGTCTTCCGTTTGACGGAAGAGAATGGATTCTGGTATCTAGACCAAATCAGAAGGGAACAGTACATTCCAAATGAAGAATTTCTTCATTCTGATCTCCTAGAAGACAGCAAATACCGAAAAATCTACTCCTTTACTCTTAAGCCTCGAACAATTGAAGATTTTGAGTCTATGAATACATACCTGCAGACATCTCCATCATCTGTGTTTACTAGTAAATCATTTTGTTCCTTGCAGACCCCAGATGGGGTTCACTGTTTGGTGGGCTTCACCCTCACCCATAGGAGATTCAATTATAAGGACAATACAGATCTAATAGAGTTCAAGACTCTGAGTGAGGAAGAAATAGAAAAAGTGCTGAAAAATATATTTAATATTTCCTTGCAGAGAAAGCTTGTGCCCAAACATGGTGATAGATTTTTTACTATTTAGAATAAGGAGTAAAACAATCTTGTCTATTTGTCATCCAGCTCACCAGTTATCAACTGACGACCTATCATGTATCTTCTGTACCCTTACCTTATTTTGAAGAAAATCCTAGACATCAAATCATTTCACCTATAAAAATGTCATCATATATAATTAAACAGCTTTTTAAAGAAACATAACCACAAACCTTTTCAAATAA。
SEQ ID NO.56
TAGGGGATCATGGACATTGAAGCATATCTKGAAAGAATTGGCTATAAGAAGTCTAGGAACAAATTGGACTTGGAAACATTAACTGACATTCTTCAACACCAGATCCGAGCTGTTCCCTTTGAGAACCTTAACATCCATTGTGGGGATGCCATGGACTTAGGCTTAGAGGCCATTTTTGATCAAGTTGTGAGAAGAAATCGGGGTGGATGGTGTCTCCAGGTCAATCATCTTCTGTACTGGGCTCTGACCACTATTGGTTTTGAGACCACGATGTTGGGAGGGTATGTTTACAGCACTCCAGCCAAAAAATACAGCACTGGCATGATTCACCTTCTCCTGCAGGTGACCATTGATGG。
At present, the method that NAT1 gene pleiomorphism is detected, analyzed mainly contains: direct sequencing and PCR-RFLP analytical method etc., wherein the most frequently used method has PCR-RFLP analytical method.PCR-RFLP method is the change of the restriction enzyme enzyme recognition site that causes based on transgenation, as lost or generation novel site in site, by a certain specific fragment of pcr amplification, use again digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, the transgenation that this method changes for detection of restriction enzyme site, can directly judge genotype, but this method can not be used for not producing the detection in Gene Mutation of new restriction enzyme site.Again, above these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not meet the needs of practical application.
Summary of the invention
One of object of the present invention is to provide NAT1 gene pleiomorphism and detects liquid-phase chip, and this liquid-phase chip can be used for wild-type and the saltant type of individual event or parallel detection NAT1 gene seven kinds of common genotype C135T, G136A, T216G, A328T, A460T, C106T and C199T.
A kind of NAT1 gene pleiomorphism detects liquid-phase chip, includes:
(A). the wild-type designing respectively for the different pleomorphism sites of NAT1 gene and the ASPE primer pair of saltant type: every ASPE primer is made up of for the specific primer sequence of goal gene pleomorphism site tag sequence and the 3 ' end of 5 ' end, and described specific primer sequence is: for SEQ ID NO.15 and the SEQ ID NO.16 in C135T site; For SEQ IDNO.17 and the SEQ ID NO.18 in G136A site; For SEQ ID NO.19 and the SEQ ID NO.20 in T216G site; For SEQ ID NO.21 and the SEQ ID NO.22 in A328T site; For SEQ ID NO.23 and the SEQ ID NO.24 in A460T site; For SEQ ID NO.25 and the SEQ ID NO.26 in C106T site; And/or for SEQ ID NO.27 and the SEQID NO.28 in C199T site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.14;
(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.29～SEQ ID NO.42, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs the target sequence detecting, there is corresponding pleomorphism site.
Preferably, described amplimer is: for SEQ IDNO.43 and the SEQ ID NO.44 in C135T, G136A, T216G, A328T, A460T site; For SEQ ID NO.45 and the SEQ ID NO.46 in C106T, C199T site.
Preferably, described ASPE primer is: for the sequence being made up of SEQ ID NO.1 and SEQ ID NO.15 in C135T site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.16; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.17 in G136A site and the sequence that formed by SEQ ID NO.4 and SEQ ID NO.18; For the sequence being formed by SEQ ID NO.5 and SEQ ID NO.19 in T216G site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.21 in A328T site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.22; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.23 in A460T site and the sequence that formed by SEQ ID NO.10 and SEQ ID NO.24; The sequence forming for the sequence being formed by SEQ ID NO.11 and SEQID NO.25 in C106T site and by SEQ ID NO.12 and SEQ ID NO.26; And/or for the sequence being formed by SEQ ID NO.13 and SEQ ID NO.27 in C199T site and the sequence that formed by SEQ ID NO.14 and SEQ ID NO.28.
Another object of the present invention is to provide the Auele Specific Primer detecting for NAT1 gene pleiomorphism.
The technical scheme that realizes above-mentioned purpose is as follows:
The Auele Specific Primer detecting for NAT1 gene pleiomorphism, this Auele Specific Primer is: for SEQ IDNO.15 and the SEQ ID NO.16 in C135T site; For SEQ ID NO.17 and the SEQ ID NO.18 in G136A site; For SEQ ID NO.19 and the SEQ ID NO.20 in T216G site; For SEQ ID NO.21 and the SEQ ID NO.22 in A328T site; For SEQ ID NO.23 and the SEQ ID NO.24 in A460T site; For SEQ ID NO.25 and the SEQ ID NO.26 in C106T site; And/or for SEQ ID NO.27 and the SEQ ID NO.28 in C199T site.
Major advantage of the present invention is:
1. the identical rate of detection method provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared NAT1 gene pleiomorphism detects liquid-phase chip and has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection of multiple pleomorphism sites.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, the also polymorphism situation in the multiple mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, seven kinds of pleomorphism sites detect the amplification that can complete by a step multiplex PCR two target sequences that contain pleomorphism site, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR are avoided, thereby can greatly improve Detection accuracy, embody accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1
Described in the present embodiment, NAT1 gene pleiomorphism detects liquid-phase chip, mainly includes:
One, ASPE primer
For wild-type and the saltant type of NAT1 gene seven kinds of common genotype C135T, G136A, T216G, A328T, A460T, C106T and C199T, design respectively specific primer sequence.ASPE primer is made up of " Tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (Tag sequence+specific primer sequence) of table 1 NAT1 gene
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 14 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
14 kinds of microballoons selecting, purchased from Luminex company of the U.S., are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH
2o is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 × 10
6the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (purchased from the Pierce Chemical company) working fluid of preparation 10ng/ml.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris (pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 DEG C keeps in Dark Place.
Three, amplify the primer of the target sequence that contains pleomorphism site
For NAT1 gene seven kinds of common genotype C135T, G136A, T216G, A328T, A460T, C106T and C199T, design of amplification primers is to (be shown in table 3), amplify respectively two target sequences that contain pleomorphism site, wherein, 5 sites such as C135T, G136A, T216G, A328T and A460T are positioned at same amplified production, and C106T and C199T are positioned at same amplified production.
Table 3 amplifies the primer of the target sequence with pleomorphism site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Embodiment 2 uses the NAT1 gene pleiomorphism described in embodiment 1 to detect the detection of liquid-phase chip to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 × Tm hybridization buffer
After filtration, be stored in 4 DEG C.
ExoSAP-IT test kit is purchased from USB company of the U.S..
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to " molecular cloning " about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design two pairs of primers, multiplex PCR one step amplifies and contains respectively NAT1 gene seven kinds of common genotype C135T, G136A, T216G, A328T, A460T, C106T and C199T, wherein, 5 sites such as C135T, G136A, T216G, A328T and A460T are positioned at same amplified production, product size is 645bp, C106T and C199T are positioned at same amplified production, and product size is 356bp, and primer sequence (SEQ ID NO.43-46) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.43-46 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 DEG C of 3min; 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 40s, 30 circulations; 72 DEG C of 10min; 4 DEG C save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 DEG C, hatch 15min for 80 DEG C, the enzyme that deactivation is unnecessary.Enzyme is cut product after treatment and is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make multiple biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 DEG C of 2min; 94 DEG C of 30s, 54 DEG C of 1min, 72 DEG C of 2min, 30 circulations; 4 DEG C save backup.
Five, hybridization
1. according to the ASPE primer of design, every group selection is coated microballoon (as described in Example 1) accordingly, and every kind of microballoon concentration is 2.5 × 10
5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul
2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH
2o complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 DEG C of 60s, 37 DEG C of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 × Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 DEG C, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI (NET MFI be less than 0 represent with 0);
3. meet the data of above two conditions, calculate sudden change ratio by following formula:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NETMFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments NAT1 gene polymorphism sites originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.Detect with liquid-phase chip result and compare with sequencing, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments NAT1 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible NAT1 gene pleiomorphism provided by the present invention detects liquid-phase chip can detect NAT1 gene polymorphism sites type exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Two of table 5 pattern detection result (MFI)
Table 6 sample NAT1 transgenation ratio (%)
| Sample number | C135T | G136A | T216G | A328T | A460T | C106T | C199T |
| 1 | 1％ | 3％ | 2％ | 1％ | 2％ | 2％ | 2％ |
| 2 | 2％ | 2％ | 1％ | 2％ | 2％ | 98％ | 1％ |
| 3 | 2％ | 1％ | 2％ | 3％ | 1％ | 2％ | 2％ |
| 4 | 98％ | 2％ | 1％ | 1％ | 2％ | 3％ | 2％ |
| 5 | 2％ | 2％ | 2％ | 2％ | 1％ | 2％ | 3％ |
| 6 | 1％ | 1％ | 2％ | 3％ | 1％ | 2％ | 1％ |
| 7 | 2％ | 2％ | 1％ | 2％ | 2％ | 3％ | 1％ |
| 8 | 3％ | 1％ | 1％ | 2％ | 2％ | 2％ | 1％ |
| 9 | 1％ | 2％ | 98％ | 99％ | 2％ | 2％ | 1％ |
| 10 | 2％ | 2％ | 1％ | 2％ | 1％ | 2％ | 1％ |
| 11 | 2％ | 2％ | 1％ | 2％ | 1％ | 2％ | 1％ |
| 12 | 2％ | 1％ | 1％ | 1％ | 3％ | 2％ | 3％ |
| 13 | 1％ | 2％ | 1％ | 1％ | 3％ | 2％ | 2％ |
| 14 | 2％ | 3％ | 1％ | 2％ | 1％ | 1％ | 2％ |
| 15 | 2％ | 2％ | 47％ | 3％ | 2％ | 1％ | 1％ |
| 16 | 2％ | 2％ | 1％ | 2％ | 2％ | 2％ | 2％ |
| 17 | 2％ | 2％ | 2％ | 1％ | 3％ | 2％ | 98％ |
| 18 | 1％ | 3％ | 3％ | 1％ | 3％ | 1％ | 2％ |
| 19 | 2％ | 2％ | 1％ | 2％ | 3％ | 1％ | 1％ |
| 20 | 2％ | 2％ | 2％ | 2％ | 2％ | 2％ | 2％ |
Table 7 sample NAT1 gene mutation type analytical results
| Catalogue number(Cat.No.) | Liquid-phase chip detected result | Sequencing result |
| 1 | Wild-type | Wild-type |
| 2 | 106TT | 106TT |
| 3 | Wild-type | Wild-type |
| 4 | 135TT | 135TT |
| 5 | Wild-type | Wild-type |
| 6 | Wild-type | Wild-type |
| 7 | Wild-type | Wild-type |
| 8 | Wild-type | Wild-type |
| 9 | 216GG、328TT | 216GG、328TT |
| 10 | Wild-type | Wild-type |
| 11 | Wild-type | Wild-type |
| 12 | Wild-type | Wild-type |
| 13 | Wild-type | Wild-type |
| 14 | Wild-type | Wild-type |
| 15 | 216TG | 216TG |
| 16 | Wild-type | Wild-type |
| 17 | 199TT | 199TT |
| 18 | Wild-type | Wild-type |
| 19 | Wild-type | Wild-type |
| 20 | Wild-type | Wild-type |
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to NAT1 gene polymorphism sites
One, the design (selection of Tag sequence and Anti-Tag sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example taking NAT1 gene G136A and A328T site mutation, respectively for the wild-type of G136A and A328T and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ ID NO.14, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.29-SEQ ID NO.42.Specific design is as shown in following table (table 8).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 8 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 9 pattern detection result and Polymorphism Analysis
Table 10 pattern detection result and Polymorphism Analysis
Other is for the liquid-phase chip in different mutational sites, and ASPE primer uses different Tag sequences, and its result is still reliable and stable, and concrete data are omitted.And ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 2 and test group 5.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4 NAT1 gene pleiomorphism detection specificity primer sequences
One, the design (selection of wild-type and saltant type specific primer sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example taking the pleomorphism site of NAT1 gene T216G and A460T, taking the complementary sequence forward or backwards of this place, mutational site target sequence as template, respectively for the wild-type of T216G and A460T and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 11.Wherein,
interior base is pleomorphism site.
Table 11 specific primer sequence
Detect liquid-phase chip as example taking the pleomorphism site of NAT1 gene T216G and A460T, select different specific primer sequences for T216G and A460T, the Tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 12).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 12 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 13 pattern detection result and Polymorphism Analysis
Table 14 pattern detection result and Polymorphism Analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 7 and test group 10.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 1 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different mutational sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detect effect also better, concrete data are omitted.
Be more than for the illustrating of possible embodiments of the present invention, but this embodiment is not in order to limit the scope of the claims of the present invention, allly do not depart from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the scope of the claims of the present invention.
Claims (5)
1. NAT1 gene pleiomorphism detects a liquid-phase chip, it is characterized in that, includes:
(A). the wild-type designing respectively for the different pleomorphism sites of NAT1 gene and the ASPE primer pair of saltant type: every ASPE primer is made up of for the specific primer sequence of goal gene pleomorphism site tag sequence and the 3 ' end of 5 ' end, and described specific primer sequence is: for SEQ ID NO.15 and the SEQ ID NO.16 in C135T site; For SEQ ID NO.17 and the SEQ ID NO.18 in G136A site; For SEQ ID NO.19 and the SEQ ID NO.20 in T216G site; For SEQ ID NO.21 and the SEQ ID NO.22 in A328T site; For SEQ ID NO.23 and the SEQ ID NO.24 in A460T site; For SEQ IDNO.25 and the SEQ ID NO.26 in C106T site; And/or for SEQ ID NO.27 and the SEQ ID NO.28 in C199T site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.14;
(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.29～SEQ ID NO.42, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs the target sequence detecting, have corresponding pleomorphism site, described amplimer is: for SEQ ID NO.43 and the SEQ ID NO.44 in C135T, G136A, T216G, A328T, A460T site; And/or for SEQ ID NO.45 and the SEQ ID NO.46 in C106T, C199T site.
2. NAT1 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described ASPE primer is: for the sequence being made up of SEQ ID NO.1 and SEQ ID NO.15 in C135T site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.16; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.17 in G136A site and the sequence that formed by SEQ ID NO.4 and SEQ ID NO.18; For the sequence being formed by SEQ ID NO.5 and SEQ ID NO.19 in T216G site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.21 in A328T site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.22; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.23 in A460T site and the sequence that formed by SEQ ID NO.10 and SEQ ID NO.24; For the sequence being formed by SEQ ID NO.11 and SEQ ID NO.25 in C106T site and the sequence that formed by SEQ ID NO.12 and SEQ ID NO.26; And/or for the sequence being formed by SEQ ID NO.13 and SEQ ID NO.27 in C199T site and the sequence that formed by SEQ ID NO.14 and SEQ ID NO.28.
3. NAT1 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that,
(A). described ASPE primer is: for the sequence being made up of SEQ ID NO.1 and SEQ ID NO.15 in C135T site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.16; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.17 in G136A site and the sequence that formed by SEQ ID NO.4 and SEQ ID NO.18; For the sequence being formed by SEQ ID NO.5 and SEQ ID NO.19 in T216G site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.21 in A328T site and the sequence that formed by SEQ ID NO.8 and SEQ ID NO.22; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.23 in A460T site and the sequence that formed by SEQ ID NO.10 and SEQ ID NO.24; For the sequence being formed by SEQ ID NO.11 and SEQ ID NO.25 in C106T site and the sequence that formed by SEQ ID NO.12 and SEQ ID NO.26; With the sequence being formed by SEQ ID NO.13 and SEQ ID NO.27 for C199T site and the sequence being formed by SEQ ID NO.14 and SEQ ID NO.28;
(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.29～SEQ ID NO.42, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). described amplimer is: for SEQ ID NO.43 and the SEQ ID NO.44 in C135T, G136A, T216G, A328T, A460T site; With SEQ ID NO.45 and the SEQ ID NO.46 for C106T, C199T site.
4. detect liquid-phase chip according to the NAT1 gene pleiomorphism described in claim 1-3 any one, it is characterized in that, described spacerarm is 5-10 T.
5. the Auele Specific Primer detecting for NAT1 gene pleiomorphism, is characterized in that, this Auele Specific Primer is: for SEQ ID NO.15 and the SEQ ID NO.16 in C135T site; For SEQ ID NO.17 and the SEQ ID NO.18 in G136A site; For SEQ ID NO.19 and the SEQ ID NO.20 in T216G site; For SEQ ID NO.21 and the SEQ ID NO.22 in A328T site; For SEQ ID NO.23 and the SEQ ID NO.24 in A460T site; For SEQ ID NO.25 and the SEQ ID NO.26 in C106T site; With SEQ ID NO.27 and the SEQ ID NO.28 for C199T site.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110251736.2A CN102952873B (en) | 2011-08-29 | 2011-08-29 | Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110251736.2A CN102952873B (en) | 2011-08-29 | 2011-08-29 | Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102952873A CN102952873A (en) | 2013-03-06 |
| CN102952873B true CN102952873B (en) | 2014-07-23 |
Family
ID=47762254
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110251736.2A Expired - Fee Related CN102952873B (en) | 2011-08-29 | 2011-08-29 | Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102952873B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250593A (en) * | 2008-02-03 | 2008-08-27 | 广州益善生物技术有限公司 | Papillomavirus detection and parting method as well as liquid phase chip thereof |
-
2011
- 2011-08-29 CN CN201110251736.2A patent/CN102952873B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250593A (en) * | 2008-02-03 | 2008-08-27 | 广州益善生物技术有限公司 | Papillomavirus detection and parting method as well as liquid phase chip thereof |
Non-Patent Citations (5)
| Title |
|---|
| David W Hein et al..Molecular Genetics and Epidemiology of the NAT1 and NAT2 Acetylation Polymorphisms.《Cancer Epidemiology Biomarkers& * |
| David W Hein et al..Molecular Genetics and Epidemiology of the NAT1 and NAT2 Acetylation Polymorphisms.《Cancer Epidemiology Biomarkers&Prevention》.2000,第9卷29-42. |
| Genetic Polymorphisms of Human N-Acetyltransferase, Cytochrome P450,Glutathione-S-Transferase, and Epoxide Hydrolase Enzymes: Relevance to Xenobiotic Metabolism and Toxicity;Lars W. Wormhoudt et al.;《Critical Reviews in Toxicology》;19991231;第29卷(第1期);59-124 * |
| Lars W. Wormhoudt et al..Genetic Polymorphisms of Human N-Acetyltransferase, Cytochrome P450,Glutathione-S-Transferase, and Epoxide Hydrolase Enzymes: Relevance to Xenobiotic Metabolism and Toxicity.《Critical Reviews in Toxicology》.1999,第29卷(第1期),59-124. |
| Prevention》.2000,第9卷29-42. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102952873A (en) | 2013-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103451271A (en) | THADA gene mutation detection specific primer and liquid phase chip | |
| CN103374609B (en) | ABO gene mutation detection specific primers and liquid chip | |
| CN102912002B (en) | ABCB2 gene polymorphism detection specific primers and liquid chip | |
| CN102191337B (en) | Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene | |
| CN102952873B (en) | Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene | |
| CN103374607B (en) | ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip | |
| CN102952866B (en) | Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene | |
| CN102181573B (en) | Specific primers and liquid-phase chip for detection of KITLG gene | |
| CN102191336B (en) | MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip | |
| CN102952867B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene | |
| CN102912006B (en) | CYP2A6 gene polymorphism detection specific primers and liquid chip | |
| CN102191334B (en) | (STAT)4 gene polymorphism detection specific primer and liquid-phase chip | |
| CN102952870B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene | |
| CN102912007B (en) | CYP2B6 gene polymorphism detection specific primers and liquid chip | |
| CN102952868B (en) | Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene | |
| CN102952872B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene | |
| CN102952869B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene | |
| CN102888444B (en) | Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip | |
| CN102952874B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene | |
| CN102191335B (en) | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes | |
| CN103849942A (en) | Specific primer and liquid phase chip for detecting TOX3 gene mutation | |
| CN102994625B (en) | PIK3R1 gene mutation detection specificity primer and liquid chip thereof | |
| CN102952871B (en) | Specific primer and liquid chip for detecting polymorphism of SULT1A1 gene | |
| CN103374608B (en) | MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip | |
| CN102994623B (en) | STK11 gene mutation detection specificity primer and liquid chip thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB02 | Change of applicant information |
Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant after: Surexam Biological Technology Co., Ltd. Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Applicant before: Guangzhou Yishan Biotechnology Co., Ltd. |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140723 Termination date: 20150829 |
|
| EXPY | Termination of patent right or utility model |