CN102191335B - Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes - Google Patents
Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes Download PDFInfo
- Publication number
- CN102191335B CN102191335B CN 201110153867 CN201110153867A CN102191335B CN 102191335 B CN102191335 B CN 102191335B CN 201110153867 CN201110153867 CN 201110153867 CN 201110153867 A CN201110153867 A CN 201110153867A CN 102191335 B CN102191335 B CN 102191335B
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- pigu
- primer
- wild
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes, which mainly comprises an ASPE (allele specific primer extension) primer, a microsphere and an amplification primer, wherein the ASPE primer is composed of a tag sequence at a 5' terminal and specific primer sequences aiming at the mutant sites of target genes at a 3' terminal; the specific primer sequences comprise one of wild-type SEQ ID NO.1, SEQ ID NO.18 and SEQ ID NO.19 and one of mutant-type SEQ ID NO.2, SEQ ID NO.20 and SEQ ID NO.21; and the microsphere is coated by an anti-tag sequence. The coinciding rate of the detection result of the liquid-phase chip provided by the invention and the detection result of a sequencing method reaches 100%, and wild-type and mutant-type parallel detection of SNP sites is realized.
Description
Technical field
The present invention bends in biology field, relates to medical science and biotechnology, concrete a kind of PIGU gene SNP detection specific primer and the liquid-phase chip of relating to.
Background technology
PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) gene has another name called CDC91L1, is the 5th subunit of GPI transamidae, and the albumen of this genes encoding plays an important role in the cell divising regulatory process.
The PIGU gene mutation site of target detect of the present invention, it is as shown in the table:
| Sequence number | The content of PIGU site mutation | Write a Chinese character in simplified form |
| 1 | G → A sudden change takes place in the 86th Nucleotide of SEQ ID NO.17 | G86A |
Almost do not detect the launch of PIGU gene pleiomorphism at present both at home and abroad, report about this gene pleiomorphism is also very few, and most report still is in the experimental study stage, not commercialization as yet, existing detection technique mainly are based upon on the basis of round pcr, as direct sequencing, real-time fluorescence quantitative PCR method etc., the shortcoming that these technology exist sample easily to pollute, false positive rate is high simultaneously, can not satisfy clinical needs owing to detect the limitation of flux.
Summary of the invention
One of purpose of the present invention provides the PIGU gene pleiomorphism and detects liquid-phase chip, and this liquid-phase chip can be used for detecting wild-type and the mutant of the common genotype G86A of PIGU gene.
A kind of PIGU gene SNP detection liquid-phase chip includes:
(A). the wild-type that designs respectively at the G86A mutational site and the ASPE primer of mutant: every kind of ASPE primer is made up of at the Auele Specific Primer in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, described Auele Specific Primer is: be selected among SEQ ID NO.1, SEQ ID NO.18 and the SEQ ID NO.19 one and be selected among SEQ ID NO.2, SEQ ID NO.20 and the SEQ ID NO.21 one at the detection probes of mutant at the detection probes of wild-type; Described tag sequence is selected from any two among the SEQ ID NO.3-8;
(B). microballoon anti-tag sequence bag quilt, that have the different colours coding is arranged, also be provided with the spacerarm sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected among SEQ ID NO.9～SEQ ID NO.14 two, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). being used for amplifying need primer that detect, that have the target sequence in G86A SNP site.
Preferably, described wild-type detection probes is that SEQ ID NO.1, mutant detection probes are SEQ ID NO.2.
Preferably, described amplimer is SEQ ID NO.15～SEQ ID NO.16.
Preferably, described ASPE primer is: the sequence of being made up of SEQ ID NO.3 and SEQ ID NO.1 reaches the sequence of being made up of SEQ ID NO.4 and SEQ ID NO.2.
Another object of the present invention provides a kind of specific primer sequence for the detection of PIGU gene SNP.
Concrete technical scheme is as follows:
A kind of specific primer sequence for the detection of PIGU gene SNP includes SEQ ID NO.1 and SEQ ID NO.2.
Major advantage of the present invention is:
1. the identical rate of the detected result of liquid-phase chip provided by the present invention and sequencing is up to 100%, and detects the needed time well below sequencing technologies commonly used, and realistic especially application needs.Prepared PIGU gene pleiomorphism detects liquid-phase chip and has extraordinary signal-noise ratio, and there is not cross reaction between designed probe and the anti-tag sequence basically, choosing and tag sequence label and the specifically combination of ASPE primer and pcr amplification product of tag sequence label, anti-tag sequence label, cross reaction be can avoid, wild-type and the mutant parallel detection in SNP site realized.
2. the ASPE primer specificity primer of the present invention's design can sensitive be identified the mutational site of target detect specifically, accurately distinguishes the genotype of various types; In same reaction system, between the different Auele Specific Primers, do not have cross reaction basically between the pcr amplification product of Auele Specific Primer and non-target detect, detection specificity is good, and cross reacting rate is lower than 3%.
3. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the defective of the repeatability difference of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value that detects improves greatly, thereby makes the sensitivity that detects be further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1PIGU gene pleiomorphism detects liquid-phase chip, mainly includes:
One, ASPE primer
Wild-type and mutant at the common genotype G86A of PIGU gene design specific primer sequence respectively.The ASPE primer is made up of " Tag sequence+specific primer sequence ".The ASPE primer sequence is as shown in the table:
Specific primer sequence in the table 1PIGU Gene A SPE primer sequence
Tag sequence in the table 2PIGU Gene A SPE primer sequence
Every the ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence at anti-tag sequence on the corresponding microballoon, and 3 ' end is mutant or the special primer fragment (shown in above-mentioned table 1) of wild-type.All ASPE primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer.
Two, the microballoon of anti-tag sequence bag quilt
According to designed ASPE Auele Specific Primer fragment, select the tag sequence, reduce between the anti-tag sequence of each microballoon to greatest extent and secondary structure that tag and ASPE Auele Specific Primer fragment may form, corresponding anti-tag sequence is as shown in table 3 on 2 kinds of microballoons numberings of selection and the microballoon:
Corresponding anti-tag sequence on table 3 microballoon numbering and the microballoon
| SEQ NO. | The microballoon numbering | The anti-tag sequence (5 '-3 ') of correspondence on the microballoon |
| 9 | 21 | ATTGGTAAATTGGTAAATGAATTG |
| 10 | 15 | TGATAAAGTGATAAAGGATTAAAG |
| 11 | 25 | TGAAATGAATGAATGATGAAATTG |
| 12 | 35 | GTAGTAATGTTAATGAATTAGTAG |
| 13 | 41 | GATTTGTAATTGTTGAGTAAATGA |
| 14 | 36 | ATTGTTAGTGATGTTAGTAATTAG |
2 kinds of microballoons selecting are available from U.S. Luminex company, with anti-tag sequence bag by with microballoon on.Be connected with the spacerarm sequence of 5-10 T between anti-tag sequence and the microballoon, namely add the spacerarm sequence of the preceding paragraph 5-10 T before each anti-tag sequence, the anti-tag sequence is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.With synthetic anti-tag sequence sterilization ddH
2O is made into the stock solution of 100nmol/ml.Described spacerarm is for being used for anti-tag and microsphere surface is spaced apart or anti-tag is placed the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficient of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n 〉=3) are as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the process of microballoon bag quilt is as follows:
Get 5 * 10 respectively
6The carboxylated microballoon of individual above-mentioned numbering (available from Luminex company) is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (available from the Pierce Chemical company) working fluid of preparation 10ng/ml.Add the EDC working fluid of 2.5ul in the microballoon suspension, constant temperature was hatched 30 minutes, added the EDC working fluid of 2.5ul again, and constant temperature was hatched 30 minutes again.After reaction finished, the Tween-20 washing with 0.02% was once washed once with 0.1% SDS liquid again.The microballoon that is coated with the anti-tag sequence after the washing is resuspended in the Tris-EDTA solution [10mmol/LTris (pH8.0)] of 100ul, and among the lmmol/LEDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains the mutational site
At the common genotype G86A of PIGU gene, design of amplification primers amplifies the target sequence that contains pleomorphism site to (seeing Table 4).
Table 4 amplifies the primer of the target sequence with pleomorphism site
All primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer.
Embodiment 2 is suitable for PIGU gene test liquid-phase chip to the detection of sample
The prescription of described various solution is as follows:
MES damping fluid (pH5.0) prescription (250ml) of 50mM:
2 * Tm hybridization buffer
| Reagent | The source | Final concentration | The consumption of every 250ml |
| 1MTris-HCl，pH8.0 | SigmaT3038 | 0.2M | 50ml |
| 5MNaCl | Sigma S5150 | 0.4M | 20ml |
| Triton X-100 | Sigma T8787 | 0.16％ | 0.4ml |
Be stored in 4 ℃ after the filtration.
The ExoSAP-IT test kit is available from U.S. USB company.
Biotin labeled dCTP is available from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
With reference to " molecular cloning " methods involving about DNA extraction, obtain DNA to be detected.
Two, with the pcr amplification of test sample product
One step of design primer PCR amplifies the target sequence of the common genotype G86A that contains the PIGU gene, and the product size is 297bp, and primer sequence (SEQ ID NO.15-16) is seen shown in the above-mentioned table 3.
At first prepare the multiple PCR primer working fluid: respectively get the primer stock solution 100ul of SEQ ID NO.15-16 respectively in the 1.5ml Eppendorf tube, mix and be the multiple PCR primer working fluid.The multi-PRC reaction system is as follows:
The pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations are standby.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme; 2.37 ℃ hatch 15min, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after the processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on the reacted product band.
At first prepare the ASPE primer working fluid that mixes: get the corresponding wild-type of gene to be detected and mutant ASPE primer stock solution 10ul respectively in the 1.5ml Eppendorf tube, the composition of ASPE primer is respectively:
Add 10mmol/L Tris Buffer and mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ of preservations are standby.
Five, hybridization
1. according to the ASPE primer of design, every group selection has comprised that (every kind of microballoon concentration is 2.5 * 10 to microballoon for corresponding 2 kinds
5Individual/ml);
2. get the microballoon of every kind of numbering of 1ul respectively in the Eppendorf tube of 1.5ml;
3. microballoon is in 〉=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, the vortex mixing;
5. get the above-mentioned microballoon suspension of 25ul in the corresponding hole of 96 hole filter plates, control wells adds the ddH of 25ul
2O;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH
2O complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after the hybridization is in 〉=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in 〉=centrifugal the 2-5min of 3000g;
11. microballoon is resuspended in 1 * Tm hybridization buffer of 75ul, adding 15ul concentration is Streptavidin-phycoerythrin (SA-PE) of 10ug/ml;
12.37 ℃ hatch 15min, on the Luminex instrument, detect.
Six, the result detects and data analysis
The reaction after product detects by Luminex serial analysis instrument.Detected result is shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing there are following requirement:
1. each site need have an allelotrope MFI at least greater than 300 and greater than 10 * PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI (NET MFI less than 0 with 0 the expression);
3. satisfy the data of above two conditions, calculate sudden change ratio by following formula:
Sudden change ratio=mutant NET MFI ÷ (mutant NET MFI+ wild-type NET MFI)
4. rule of thumb the sudden change ratio of each detection site is determined threshold value (cut-off value), to divide wild-type homozygote, heterozygote and mutant homozygote.
Use present method to detect 20 increments PIGU gene polymorphism sites originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: the sudden change ratio range is considered as the wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as the anomaly homozygote.Compare with the liquid-phase chip result with the sequencing detection, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments PIGU genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.As seen PIGU gene pleiomorphism provided by the present invention detects liquid-phase chip and can detect PIGU gene polymorphism sites type exactly, and the result is reliable and stable.
One of table 4 pattern detection result (MFI)
Table 5 sample PIGU transgenation ratio (%)
| Sample number | G86A |
| 1 | 1％ |
| 2 | 1％ |
| 3 | 1％ |
| 4 | 2％ |
| 5 | 1％ |
| 6 | 98％ |
| 7 | 2％ |
| 8 | 1％ |
| 9 | 2％ |
| 10 | 1％ |
| 11 | 1％ |
| 12 | 1％ |
| 13 | 98％ |
| 14 | 2％ |
| 15 | 1％ |
| 16 | 1％ |
| 17 | 1％ |
| 18 | 51％ |
| 19 | 2％ |
| 20 | 2％ |
Table 6 sample PIGU gene mutation type analytical results
| Catalogue number(Cat.No.) | The liquid-phase chip detected result | Sequencing result |
| 1 | Wild-type | Wild-type |
| 2 | Wild-type | Wild-type |
| 3 | Wild-type | Wild-type |
| 4 | Wild-type | Wild-type |
| 5 | Wild-type | Wild-type |
| 6 | 86AA | 86AA |
| 7 | Wild-type | Wild-type |
| 8 | Wild-type | Wild-type |
| 9 | Wild-type | Wild-type |
| 10 | Wild-type | Wild-type |
| 11 | Wild-type | Wild-type |
| 12 | Wild-type | Wild-type |
| 13 | 86AA | 86AA |
| 14 | Wild-type | Wild-type |
| 15 | Wild-type | Wild-type |
| 16 | Wild-type | Wild-type |
| 17 | Wild-type | Wild-type |
| 18 | 86GA | 86GA |
| 19 | Wild-type | Wild-type |
| 20 | Wild-type | Wild-type |
The liquid-phase chip of the ASPE primer that embodiment 3 is different is to the detection of PIGU gene polymorphism sites
One, the design (selection of Tag sequence and Anti-Tag sequence) of liquid-phase chip preparation
Detecting liquid-phase chip with PIGU gene G86A site mutation is example, respectively at the wild-type of G86A and the specific primer sequence of mutant design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end then is selected from SEQ ID NO.3-SEQ IDNO.8, accordingly, bag is selected from SEQ ID NO.9-SEQ ID NO.14 by the anti-tag sequence with corresponding tag sequence complementary pairing on microballoon.Specific design is shown in following table (table 7).Synthetic, the anti-tag sequence bag of ASPE primer is described like embodiment 1 and embodiment 2 by microballoon, amplimer, detection method.
The design of table 7 liquid-phase chip preparation
Two, sample detection
Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 21-40 is detected, detected result is as follows:
Table 8 pattern detection result and Polymorphism Analysis
By present embodiment as seen, when the ASPE primer was selected among the embodiment 2 collocation of tag sequence and specific primer sequence for use, effect better (signal to noise ratio is better) was referring to present embodiment test group 1.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and present embodiment, concrete data are omitted.
The selection of embodiment 4PIGU gene SNP detection specific primer sequence
One, the design (selection of wild-type and mutant specific primer sequence) of liquid-phase chip preparation
Detecting liquid-phase chip with PIGU gene G86A site mutation is example, complementary sequence forward or backwards with this place, mutational site target sequence is template, respectively at the wild-type of G86A and the specific primer sequence of mutant design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the invention 1, as shown in table 9.Wherein,
Interior base is pleomorphism site.
Table 9 specific primer sequence
Detecting liquid-phase chip with PIGU gene G86A site mutation is example, select different specific primer sequences for use at GG86A, the Tag sequence of ASPE primer 5 ' end then is fixed as the best effect sequence among the embodiment 1, and select with it corresponding anti-tag sequence for use, specific design is shown in following table (table 10).Synthetic, the anti-tag sequence bag of ASPE primer is described like embodiment 1 and embodiment 2 by microballoon, amplimer, detection method.
Two of the design of table 10 liquid-phase chip preparation
Two, sample detection
Adopt the liquid-phase chip of above-mentioned design preparation, by embodiment 2 described testing processes and method sample 41-60 is detected, detected result is as follows:
Table 11 pattern detection result and Polymorphism Analysis
By present embodiment as seen, when the ASPE primer was selected among the embodiment 1 collocation of specific primer sequence and tag sequence for use, effect better (signal to noise ratio is better) was referring to present embodiment test group 4.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and present embodiment, namely still be that specific primer sequence is better with the detection effect of different tag sequence collocation among the embodiment 2, concrete data are omitted.
More than be at the specifying of possible embodiments of the present invention, but this embodiment is not in order to limiting claim of the present invention, does not allly break away from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the claim of the present invention.
Claims (5)
1. a PIGU gene SNP detection liquid-phase chip is characterized in that, includes:
(A). the wild-type that designs respectively at G86A SNP site and the ASPE primer of mutant: every kind of ASPE primer is made up of at the specific primer sequence in goal gene SNP site tag sequence and the 3 ' end of 5 ' end, described specific primer sequence is: be selected among SEQ ID NO.1, SEQ ID NO.18 and the SEQ ID NO.19 one and be selected among SEQ ID NO.2, SEQ ID NO.20 and the SEQ ID NO.21 one at the detection probes of mutant at the detection probes of wild-type; Described G86A is the 86th Nucleotide of SEQ ID NO.17, and G → A sudden change takes place; Described tag sequence is selected from any two among SEQ ID NO.3 ~ SEQ IDNO.8;
(B). microballoon anti-tag sequence bag quilt, that have the different colours coding is arranged, also be provided with the spacerarm sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected among SEQ ID NO.9～SEQ ID NO.14 two, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). need primer detection, that have the target sequence in G86A SNP site for amplifying, described amplimer is SEQ ID NO.15～SEQ ID NO.16.
2. PIGU gene SNP detection liquid-phase chip according to claim 1 is characterized in that, described specific primer sequence is: be SEQ ID NO.1 and be SEQ ID NO.2 at the detection probes of mutant at the detection probes of wild-type.
3. according to each described PIGU gene SNP detection liquid-phase chip of claim 1-2, it is characterized in that described ASPE primer is: the sequence of being made up of SEQ ID NO.3 and SEQ ID NO.1 reaches the sequence of being made up of SEQ ID NO.4 and SEQ ID NO.2.
4. according to each described PIGU gene SNP detection liquid-phase chip of claim 1-2, it is characterized in that described spacerarm is 5-10 T.
5. one kind is used for the Auele Specific Primer that the PIGU gene SNP detects, and it is characterized in that, includes SEQ ID NO.1 and SEQ ID NO.2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110153867 CN102191335B (en) | 2011-06-09 | 2011-06-09 | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110153867 CN102191335B (en) | 2011-06-09 | 2011-06-09 | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102191335A CN102191335A (en) | 2011-09-21 |
| CN102191335B true CN102191335B (en) | 2013-07-17 |
Family
ID=44600200
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110153867 Expired - Fee Related CN102191335B (en) | 2011-06-09 | 2011-06-09 | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102191335B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824467A (en) * | 2009-12-29 | 2010-09-08 | 广州益善生物技术有限公司 | CYP2D6 gene mutation detection liquid-phase chip and detection method |
| CN101824466A (en) * | 2009-12-29 | 2010-09-08 | 广州益善生物技术有限公司 | Specific primer, liquid-phase chip and method for SNP detection of CYP2C9 and VKORC1 genes |
| CN102010898A (en) * | 2010-06-08 | 2011-04-13 | 广州益善生物技术有限公司 | EPHX1 (Microsomal epoxide hydrolase, mEH, EPHX1) gene detection specific primer and liquid phase chip |
-
2011
- 2011-06-09 CN CN 201110153867 patent/CN102191335B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101824467A (en) * | 2009-12-29 | 2010-09-08 | 广州益善生物技术有限公司 | CYP2D6 gene mutation detection liquid-phase chip and detection method |
| CN101824466A (en) * | 2009-12-29 | 2010-09-08 | 广州益善生物技术有限公司 | Specific primer, liquid-phase chip and method for SNP detection of CYP2C9 and VKORC1 genes |
| CN102010898A (en) * | 2010-06-08 | 2011-04-13 | 广州益善生物技术有限公司 | EPHX1 (Microsomal epoxide hydrolase, mEH, EPHX1) gene detection specific primer and liquid phase chip |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102191335A (en) | 2011-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102134605A (en) | Single-nucleotide polymorphism (SNP) detection specific primer of CYP2C19 gene and liquid phase chip | |
| CN102994621B (en) | PTPN11 gene mutation detection specificity primer and liquid chip thereof | |
| CN102191337B (en) | Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene | |
| CN103374609A (en) | ABO gene mutation detection specific primers and liquid chip | |
| CN102912002B (en) | ABCB2 gene polymorphism detection specific primers and liquid chip | |
| CN102191335B (en) | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes | |
| CN102181573B (en) | Specific primers and liquid-phase chip for detection of KITLG gene | |
| CN103374607B (en) | ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip | |
| CN102191336B (en) | MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip | |
| CN103451272A (en) | BAT3 gene mutation detection specific primer and liquid phase chip | |
| CN102952866B (en) | Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene | |
| CN102888444B (en) | Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip | |
| CN102952867B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene | |
| CN102304566B (en) | Specific primers and liquid phase chip for polymorphic detection of human hedgehog interacting protein (HHIP) gene | |
| CN102952868B (en) | Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene | |
| CN102952872B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene | |
| CN102304564B (en) | Specific primers and liquid phase chip for single nucleotide polymorphism (SNP) detection in 15 q 25 section of chromosome | |
| CN102952874B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene | |
| CN103451273B (en) | TGM5 gene mutation detection specific primer and liquid phase chip | |
| CN103374611B (en) | LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip | |
| CN102952869B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene | |
| CN103374608B (en) | MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip | |
| CN102952870B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene | |
| CN102994625B (en) | PIK3R1 gene mutation detection specificity primer and liquid chip thereof | |
| CN102994616B (en) | MEK1 gene mutation detection specificity primer and liquid chip thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee |
Owner name: SUREXAM BIOTECHNOLOGY CO., LTD. Free format text: FORMER NAME: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. |
|
| CP01 | Change in the name or title of a patent holder |
Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Patentee after: Surexam Biological Technology Co., Ltd. Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C Patentee before: Guangzhou Yishan Biotechnology Co., Ltd. |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130717 Termination date: 20140609 |