CN102952874B - Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene - Google Patents

Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene Download PDF

Info

Publication number
CN102952874B
CN102952874B CN201110251737.7A CN201110251737A CN102952874B CN 102952874 B CN102952874 B CN 102952874B CN 201110251737 A CN201110251737 A CN 201110251737A CN 102952874 B CN102952874 B CN 102952874B
Authority
CN
China
Prior art keywords
seq
site
sequence
tag
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201110251737.7A
Other languages
Chinese (zh)
Other versions
CN102952874A (en
Inventor
许嘉森
罗可银
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Surexam Bio Tech Co Ltd
Surexam Bio Tech Co Ltd
Original Assignee
Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Surexam Bio Tech Co Ltd filed Critical Surexam Bio Tech Co Ltd
Priority to CN201110251737.7A priority Critical patent/CN102952874B/en
Publication of CN102952874A publication Critical patent/CN102952874A/en
Application granted granted Critical
Publication of CN102952874B publication Critical patent/CN102952874B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Abstract

The invention discloses a liquid chip and specific primer for detecting an SLC22A1 gene. The liquid chip mainly comprises ASPE (allele specific primer extension) primers, microspheres and amplification primers, wherein each ASPE primer is formed by tag sequences at the 5' terminal and specific primer sequences which are arranged at the 3' terminal and aim at the mutation site of the target gene; the specific primer sequences are SEQ ID NO.19 and SEQ ID NO.20 aiming at the C117T site, SEQ ID NO.21 and SEQ ID NO.22 aiming at the T198C site, SEQ ID NO.23 and SEQ ID NO.24 aiming at the C86T site, SEQ ID NO.25 and SEQ ID NO.26 aiming at the C97G site, SEQ ID NO.27 and SEQ ID NO.28 aiming at the C164T site, SEQ ID NO.29 and SEQ ID NO.30 aiming at the G123T site, SEQ ID NO.31 and SEQ ID NO.32 aiming at the G127A site, SEQ ID NO.33 and SEQ ID NO.34 aiming at the A148G site and/or SEQ ID NO.35 and SEQ ID NO.36 aiming at the G129C site; and the microspheres are enveloped by anti-tag sequences. The detecting liquid chip provided by the invention has the advantages that the consistency of the detection result and the sequencing method is as high as 100%, thus parallel detection of wild types and mutant types of a plurality of mutation sites is achieved.

Description

A kind of SLC22A1 gene pleiomorphism detection specificity primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of SLC22A1 gene pleiomorphism detection specificity primer and the liquid-phase chip of relating to.
Background technology
Organic Cation Transporter Gene 1 (OCT1, encoding gene SLC22A1) is a kind of translocator with gene pleiomorphism, is mainly distributed in people's liver, mediates a series of organic cations transhipments such as some medicines, poisonous substance and endogenous compound.SLC22A1 plays an important role in absorption, distribution and the excretion of many exogenous medicines.There are some researches show, SLC22A1 gene pleiomorphism is the major cause that causes its transport function individual difference.
At present, the method that SLC22A1 gene pleiomorphism is carried out to determination and analysis seldom, mainly contains direct sequencing and PCR-RFLP analytical method, and wherein the most frequently used method has PCR-RFLP analytical method.PCR-RFLP method is the change of the restriction enzyme enzyme recognition site that causes based on transgenation, as lost or generation novel site in site, by a certain specific fragment of pcr amplification, use again digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, the transgenation that this method changes for detection of restriction enzyme site, can directly judge genotype, but this method can not be for producing the detection in Gene Mutation of new restriction enzyme site.Again, above these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not meet the needs of practical application.
The SLC22A1 gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number The content of SLC22A1 site mutation Write a Chinese character in simplified form
1 , there is C → T sudden change in the 117th Nucleotide of SEQ ID NO.75 C117T
2 , there is T → C sudden change in the 198th Nucleotide of SEQ ID NO.75 T198C
3 , there is C → T sudden change in the 86th Nucleotide of SEQ ID NO.76 C86T
4 , there is C → G sudden change in the 97th Nucleotide of SEQ ID NO.76 C97G
5 , there is C → T sudden change in the 164th Nucleotide of SEQ ID NO.77 C164T
6 , there is G → T sudden change in the 123rd Nucleotide of SEQ ID NO.78 G123T
7 , there is G → A sudden change in the 127th Nucleotide of SEQ ID NO.79 G127A
8 , there is A → G sudden change in the 148th Nucleotide of SEQ ID NO.79 A148G
9 , there is G → C sudden change in the 129th Nucleotide of SEQ ID NO.80 G129C
SEQ ID NO.75
TCCTCATCTTATGCCTGCTGTCGGCTGCCTTTGCGCCCATCTGTGTGGGCATCGTCTTCCTGGGTTTCACACCTGACCACCACTGCCAGAGTCCTGGGGTGGCTGAGCTGAGCCAGCGCTGTGGCTGGAGCCCTGCGGAGGAGCTGAACTATACAGTGCCAGGCCTGGGGCCCGCGGGCGAGGCCTTCCTTGGCCAGTGCAGGCGCTATGAAGTGGACTGGAACCAGAGCGCCCTCAGCTGTGTAGACCCCCTGGCTAGCCTGGCCACCAACAGGAGCCACCTGCCGCTGGGTCCCTGCCAGGATGGCTGGGTGTATGACACGCCCGGCTCTTCCATCGTCACTG
SEQ ID NO.76
GAGCAACAGCATCACCCCGCTCAGGGCTGAACGTCAGACCGAGGAAAATGCCAGATAGTGATGAGTGGTGTTCGCAGGTGTGTGCCGGAGTCCCCTCGGTGGCTGTTATCACAAAAAAGAAACACTGAAGCAATAAAGATAATGGACCACATCGCTCAAAAGAATGGGAAGTTGCCTCCTGCTGATTTAAAGGTGAAATCTAGGAAGGGGTATCTCACATCACTGAATCTGGGGCTGGGTTCTGGTGCAGATTCGTCTGGGGCTGCCAGGGGAAAGAGCAGAACTGTGCCCCT
SEQ ID NO.77
GAAGCACGGTGGTGGCAAGGCTCACCTCCCCAGGGGCTCCCAGGTGGCTCTGCTCATGACAGCGTGAGTGTGGCTGATGCTCTCCCTCCCTCCTAGATGCTTTCCCTCGAAGAGGATGTCACCGAAAAGCTGAGCCCTTCATTTGCAGACCTGTTCCGCACGCCGCGCCTGAGGAAGCGCACCTTCATCCTGATGTACCTGTGGTGAGGGGCGTTCCTGTGCGTCTCTCCAGGCAGAATCAGCACGCTYGCCCAAGCACTGGGCTATAGATTAGAGACAGTGGAATACTCAGGTGGAAAAAGAGAAAGGGAAA
SEQ ID NO.78
CCTGGGAACTGTGCTGGTCAACGCGGTGTCGGGCGTGCTCATGGCCTTCTCGCCCAACTACATGTCCATGCTGCTCTTCCGCCTGCTGCAGGGCCTGGTCAGCAAGGGCAACTGGATGGCTGGCTACACCCTAAGTAATTATCATGGGGATGAGGCCAGGTCTCAGGGTAGAATGGGATGGGCCTAACGTGGGTAGGGGGTTGTTTGTGGGGTCAAGGAGCTTGCGGGGCACCAGTTCCTTGTATTTATGTGACTAGGGCAGGACATGGGCT
SEQ ID NO.79
GTGCTCTATCAGGGGCTCATCCTGCACATGGGCGCCACCAGCGGGAACCTCTACCTGGATTTCCTTTACTCCGCTCTGGTCGAAATCCCGGGGGCCTTCATAGCCCTCATCACCATTGACCGCGTGGGCCGCATCTACCCCATGGCCATGTCAAATTTGTTGGCGGGGGCAGCCTGCCTCGTCATGATTTTTATCTCACCTGGTAAGTTGGTAAGTTGTCTGCTTTCATCATTTCCCAGGCAATCGAAGTGTGGGGAAAGTGTTGTGACTCTTTGATAAGCCTCTGGAATGAGAACAAAGATGAGGTGC
SEQ ID NO.80
GAGCACTGGACAGCCACAGCAAGCTGCAGGTATTGGCATTGTACTTGTTTTAGCATCAGGTGAACATTTGGAAAAGTGAATCACAGAATTATCGTATTTTTTGTCCTTTGTATTTTATCAGGAACCTCGGAGTGATGGTGTGTTCCTCCCTGTGTGACATAGGTGGGATAATCACCCCCTTCATAGTCTTCAGGCTGAGGGAGGTCTGGCAAGCCTTGCCCCTCATTTTGTTTGGTAAGATTTTGTGGAGCATATATCATTCCTTCTTTTGCAGCTCGGCAGTGGGCTCAGCATGGGTGGAACTGAGTGTGAGTACTCAGTCGTATTTGTTGAGTGAAGGGAATGATATCTCTCAGTGAGTTTACAGAAGGCAAGGATGATGCATGCTCTTGGGATGTCTTCTGGCTTA
Summary of the invention
One of object of the present invention is to provide SLC22A1 gene pleiomorphism and detects liquid-phase chip, and this liquid-phase chip can be used for wild-type and the saltant type of individual event or parallel detection SLC22A1 gene nine kinds of common genotype C117T, T198C, C86T, C97G, C164T, G123T, G127A, A148G and G129C.
SLC22A1 gene pleiomorphism detects a liquid-phase chip, includes:
(A). the wild-type designing respectively for the different pleomorphism sites of SLC22A1 gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene pleomorphism site to form by the tag sequence and 3 ' of 5 ' end, and described specific primer sequence is: for SEQ ID NO.19 and the SEQ ID NO.20 in C117T site; SEQ ID NO.21 and SEQ ID NO.22 for T198C site; SEQ ID NO.23 and SEQ ID NO.24 for C86T site; SEQ ID NO.25 and SEQ ID NO.26 for C97G site; SEQ ID NO.27 and SEQ ID NO.28 for C164T site; SEQ ID NO.29 and SEQ ID NO.30 for G123T site; SEQ ID NO.31 and SEQ IDNO.32 for G127A site; SEQ ID NO.33 and SEQ ID NO.34 for A148G site; And/or for SEQ IDNO.35 and the SEQ ID NO.36 in G129C site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.18;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.37～SEQ ID NO.54, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding pleomorphism site.
Preferably, described amplimer is: for SEQ ID NO.55 and the SEQ ID NO.56 in C117T, T198C site; SEQ ID NO.57 and SEQ ID NO.58 for C86T, C97G site; SEQ ID NO.59 and SEQID NO.60 for C164T site; SEQ ID NO.61 and SEQ ID NO.62 for G123T site; SEQID NO.63 and SEQ ID NO.64 for G127A, A148G site; And/or for SEQ ID NO.65 and the SEQ ID NO.66 in G129C site.
Preferably, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.19 in C117T site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.3 and SEQID NO.21 in T198C site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.22; For the sequence being formed by SEQID NO.5 and SEQ ID NO.23 in C86T site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.24; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.25 in C97G site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.26; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.27 in C164T site and the sequence being formed by SEQ ID NO.10 and SEQID NO.28; For the sequence being formed by SEQ ID NO.11 and SEQ ID NO.29 in G123T site and the sequence being formed by SEQID NO.12 and SEQ ID NO.30; For the sequence being formed by SEQ ID NO.13 and SEQ ID NO.31 in G127A site and the sequence being formed by SEQ ID NO.14 and SEQ ID NO.32; For the sequence being formed by SEQ ID NO.15 and SEQ ID NO.33 in A148G site and the sequence being formed by SEQ ID NO.16 and SEQ ID NO.34; And/or for the sequence being formed by SEQ ID NO.17 and SEQ ID NO.35 in G129C site and the sequence being formed by SEQ ID NO.18 and SEQ ID NO.36.
Another object of the present invention is to provide the Auele Specific Primer detecting for SLC22A1 gene pleiomorphism.
The Auele Specific Primer detecting for SLC22A1 gene pleiomorphism, this Auele Specific Primer is: for SEQ IDNO.19 and the SEQ ID NO.20 in C117T site; SEQ ID NO.21 and SEQ ID NO.22 for T198C site; SEQ ID NO.23 and SEQ ID NO.24 for C86T site; SEQ ID NO.25 and SEQ ID NO.26 for C97G site; SEQ ID NO.27 and SEQ ID NO.28 for C164T site; SEQ ID NO.29 and SEQ ID NO.30 for G123T site; SEQ ID NO.31 and SEQ ID NO.32 for G127A site; SEQ ID NO.33 and SEQ IDNO.34 for A148G site; And/or for SEQ ID NO.35 and the SEQ ID NO.36 in G129C site.
Major advantage of the present invention is:
1. the identical rate of detection method provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared SLC22A1 gene pleiomorphism detects liquid-phase chip and has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection of a plurality of pleomorphism sites.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the polymorphism situation in a plurality of mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, nine kinds of pleomorphism sites detect and can complete the amplification of six target sequences that contain pleomorphism site by a step multiplex PCR, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1 SLC22A1 gene pleiomorphism detects liquid-phase chip, mainly includes:
One, ASPE primer
Wild-type and saltant type for SLC22A1 gene nine kinds of common genotype C117T, T198C, C86T, C97G, C164T, G123T, G127A, A148G and G129C, design respectively specific primer sequence.ASPE primer is comprised of " Tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence of table 1 SLC22A1 gene (Tag sequence+specific primer sequence)
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 18 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
18 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH 2o is made into the stock solution of 100nmol/ml.Described spacerarm is for for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 * 10 6the carboxylated microballoon of individual above-mentioned numbering (purchased from Luminex company) is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (purchased from the Pierce Chemical company) working fluid of preparation 10ng/ml.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris (pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For SLC22A1 gene nine kinds of common genotype C117T, T198C, C86T, C97G, C164T, G123T, G127A, A148G and G129C, design of amplification primers is to (in Table 3), amplify respectively six target sequences that contain pleomorphism site, wherein, C117T and T198C are positioned at same amplified production, C86T and C97G are positioned at same amplified production, and G127A and A148G are positioned at same amplified production.
Table 3 amplifies the primer of the target sequence with pleomorphism site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Described in embodiment 2 utilization embodiment 1, SLC22A1 gene pleiomorphism detects the detection of liquid-phase chip to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 * Tm hybridization buffer
Reagent Source Final concentration The consumption of every 250ml
1MTris-HCl，pH8.0 Sigma T3038 0.2M 50ml
5M NaCl Sigma S5150 0.4M 20ml
Triton X-100 Sigma T8787 0.16％ 0.4ml
After filtration, be stored in 4 ℃.
ExoSAP-IT test kit is purchased from U.S. USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to < < molecular cloning > > about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design six pairs of primers, multiplex PCR one step amplifies the amplified production that contains respectively SLC22A1 gene nine kinds of common genotype C117T, T198C, C86T, C97G, C164T, G123T, G127A, A148G and G129C, wherein, C117T and T198C, C86T and C97G, G127A and A148G are positioned at same amplified production, product size is respectively 345bp, 293bp, 313bp, 272bp, 309bp and 409bp, and primer sequence (SEQ ID NO.55-66) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.55-66 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
1. according to the ASPE primer of design, every group selection is coated microballoon (as described in Example 1) accordingly, and every kind of microballoon concentration is 2.5 * 10 5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul 2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH 2o complements to 50ul;
7. with masking foil, encase 96 orifice plates with lucifuge, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 * Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 ℃, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 * PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI (NET MFI be less than 0 with 0 expression);
3. meet the data of above two conditions, by following formula, calculate sudden change ratio:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NETMFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments SLC22A1 gene polymorphism sites originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.With sequencing, detect with liquid-phase chip result and compare, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments SLC22A1 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible SLC22A1 gene pleiomorphism provided by the present invention detects liquid-phase chip can detect SLC22A1 gene polymorphism sites type exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Two of table 5 pattern detection result (MFI)
Table 6 sample SLC22A1 transgenation ratio (%)
Sample number C117T T198C C86T C97G C164T G123T G127A A148G G129C
1 1％ 2％ 2％ 99％ 2％ 1％ 1％ 3％ 1％
2 1％ 1％ 2％ 2％ 1％ 1％ 1％ 2％ 2％
3 2％ 2％ 2％ 2％ 1％ 2％ 2％ 3％ 1％
4 1％ 2％ 2％ 2％ 2％ 2％ 1％ 2％ 99％
5 2％ 2％ 2％ 1％ 2％ 1％ 49％ 2％ 3％
6 98％ 2％ 2％ 2％ 2％ 2％ 3％ 2％ 3％
7 1％ 1％ 2％ 1％ 2％ 2％ 2％ 2％ 2％
8 1％ 1％ 1％ 2％ 2％ 1％ 2％ 1％ 2％
9 1％ 3％ 1％ 3％ 99％ 2％ 1％ 3％ 2％
10 2％ 2％ 2％ 98％ 1％ 3％ 1％ 1％ 2％
11 1％ 51％ 1％ 3％ 2％ 2％ 2％ 2％ 1％
12 1％ 2％ 1％ 1％ 2％ 1％ 1％ 98％ 1％
13 2％ 2％ 2％ 1％ 1％ 98％ 2％ 1％ 2％
14 2％ 2％ 2％ 1％ 2％ 1％ 3％ 3％ 2％
15 1％ 3％ 2％ 1％ 2％ 1％ 98％ 2％ 1％
16 1％ 1％ 1％ 1％ 1％ 2％ 2％ 2％ 2％
17 1％ 2％ 1％ 3％ 2％ 2％ 3％ 2％ 1％
18 2％ 2％ 1％ 2％ 1％ 1％ 2％ 2％ 1％
19 1％ 2％ 2％ 1％ 3％ 1％ 2％ 2％ 1％
20 2％ 3％ 1％ 2％ 2％ 2％ 1％ 3％ 1％
Table 7 sample SLC22A1 gene mutation type analytical results
Catalogue number(Cat.No.) Liquid-phase chip detected result Sequencing result
1 97GG 97GG
2 Wild-type Wild-type
3 Wild-type Wild-type
4 129CC 129CC
5 127GA 127GA
6 117TT 117TT
7 Wild-type Wild-type
8 Wild-type Wild-type
9 164TT 164TT
10 97GG 97GG
11 198TC 198TC
12 148GG 148GG
13 123TT 123TT
14 Wild-type Wild-type
15 127AA 127AA
16 Wild-type Wild-type
17 Wild-type Wild-type
18 Wild-type Wild-type
19 Wild-type Wild-type
20 Wild-type Wild-type
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to SLC22A1 gene polymorphism sites
One, the design that prepared by liquid-phase chip (selection of Tag sequence and Anti-Tag sequence)
Take SLC22A1 gene T198C and G123T site mutation, to detect liquid-phase chip be example, respectively for the wild-type of T198C and G123T and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ ID NO.18, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.37-SEQ ID NO.54.Specific design is as shown in following table (table 8).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 8 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 9 pattern detection result and Polymorphism Analysis
Table 10 pattern detection result and Polymorphism Analysis
From experimental result, ASPE primer uses different Tag sequences, and its result is still reliable and stable, but ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 2 and test group 5.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
Other is for the liquid-phase chip in different mutational sites, and ASPE primer uses different Tag sequences, and its result is still reliable and stable, and while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect is better, and concrete data are omitted.
The selection of embodiment 4 SLC22A1 gene pleiomorphism detection specificity primer sequences
One, the design that prepared by liquid-phase chip (selection of wild-type and saltant type specific primer sequence)
It is example that the pleomorphism site of SLC22A1 gene C 164T and G127A of take detects liquid-phase chip, the complementary sequence forward or backwards of this place, mutational site target sequence of take is template, respectively for the wild-type of C164T and G127A and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 11.Wherein, interior base is pleomorphism site.
Table 11 specific primer sequence
It is example that the pleomorphism site of SLC22A1 gene C 164T and G127A of take detects liquid-phase chip, for C164T and G127A, select different specific primer sequences, the Tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 12).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 12 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 13 pattern detection result and Polymorphism Analysis
Table 14 pattern detection result and Polymorphism Analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 7 and test group 10.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 1 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different mutational sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detect effect also better, concrete data are omitted.
Be more than for the illustrating of possible embodiments of the present invention, but this embodiment is not in order to limit the scope of the claims of the present invention, allly do not depart from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the scope of the claims of the present invention.

Claims (5)

1. SLC22A1 gene pleiomorphism detects a liquid-phase chip, it is characterized in that, includes:
(A). the wild-type designing respectively for the different pleomorphism sites of SLC22A1 gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for goal gene pleomorphism site to form by the tag sequence and 3 ' of 5 ' end, and described specific primer sequence is: for SEQ ID NO.19 and the SEQ ID NO.20 in C117T site; SEQ ID NO.21 and SEQ ID NO.22 for T198C site; SEQ ID NO.23 and SEQ ID NO.24 for C86T site; SEQ ID NO.25 and SEQ ID NO.26 for C97G site; SEQ ID NO.27 and SEQ ID NO.28 for C164T site; SEQ ID NO.29 and SEQ ID NO.30 for G123T site; SEQ ID NO.31 and SEQ ID NO.32 for G127A site; SEQ ID NO.33 and SEQ ID NO.34 for A148G site; And/or for SEQ ID NO.35 and the SEQ ID NO.36 in G129C site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.18;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.37～SEQ ID NO.54, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding pleomorphism site; Described amplimer is: for SEQ ID NO.55 and the SEQ ID NO.56 in C117T, T198C site; SEQ ID NO.57 and SEQ ID NO.58 for C86T, C97G site; SEQ ID NO.59 and SEQ ID NO.60 for C164T site; SEQ ID NO.61 and SEQ ID NO.62 for G123T site; SEQ ID NO.63 and SEQ ID NO.64 for G127A, A148G site; And/or for SEQ ID NO.65 and the SEQ ID NO.66 in G129C site.
2. SLC22A1 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.19 in C117T site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.21 in T198C site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.22; For the sequence being formed by SEQ ID NO.5 and SEQ ID NO.23 in C86T site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.24; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.25 in C97G site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.26; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.27 in C164T site and the sequence being formed by SEQ ID NO.10 and SEQ ID NO.28; For the sequence being formed by SEQ ID NO.11 and SEQ ID NO.29 in G123T site and the sequence being formed by SEQ ID NO.12 and SEQ ID NO.30; For the sequence being formed by SEQ ID NO.13 and SEQ ID NO.31 in G127A site and the sequence being formed by SEQ ID NO.14 and SEQ ID NO.32; For the sequence being formed by SEQ ID NO.15 and SEQ ID NO.33 in A148G site and the sequence being formed by SEQ ID NO.16 and SEQ ID NO.34; And/or for the sequence being formed by SEQ ID NO.17 and SEQ ID NO.35 in G129C site and the sequence being formed by SEQ ID NO.18 and SEQ ID NO.36.
3. SLC22A1 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that,
(A). described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.19 in C117T site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.20; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.21 in T198C site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.22; For the sequence being formed by SEQ ID NO.5 and SEQ ID NO.23 in C86T site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.24; For the sequence being formed by SEQ ID NO.7 and SEQ ID NO.25 in C97G site and the sequence being formed by SEQ ID NO.8 and SEQ ID NO.26; For the sequence being formed by SEQ ID NO.9 and SEQ ID NO.27 in C164T site and the sequence being formed by SEQ ID NO.10 and SEQ ID NO.28; For the sequence being formed by SEQ ID NO.11 and SEQ ID NO.29 in G123T site and the sequence being formed by SEQ ID NO.12 and SEQ ID NO.30; For the sequence being formed by SEQ ID NO.13 and SEQ ID NO.31 in G127A site and the sequence being formed by SEQ ID NO.14 and SEQ ID NO.32; For the sequence being formed by SEQ ID NO.15 and SEQ ID NO.33 in A148G site and the sequence being formed by SEQ ID NO.16 and SEQ ID NO.34; With the sequence being formed by SEQ ID NO.17 and SEQ ID NO.35 for G129C site and the sequence being formed by SEQ ID NO.18 and SEQ ID NO.36;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.37～SEQ ID NO.54, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). described amplimer is: for SEQ ID NO.55 and the SEQ ID NO.56 in C117T, T198C site; SEQ ID NO.57 and SEQ ID NO.58 for C86T, C97G site; SEQ ID NO.59 and SEQ ID NO.60 for C164T site; SEQ ID NO.61 and SEQ ID NO.62 for G123T site; SEQ ID NO.63 and SEQ ID NO.64 for G127A, A148G site; With SEQ ID NO.65 and the SEQ ID NO.66 for G129C site.
4. according to the SLC22A1 gene pleiomorphism described in claim 1-3 any one, detect liquid-phase chip, it is characterized in that, described spacerarm is 5-10 T.
5. the Auele Specific Primer detecting for SLC22A1 gene pleiomorphism, is characterized in that, this Auele Specific Primer is: for SEQ ID NO.19 and the SEQ ID NO.20 in C117T site; SEQ ID NO.21 and SEQ ID NO.22 for T198C site; SEQ ID NO.23 and SEQ ID NO.24 for C86T site; SEQ ID NO.25 and SEQ ID NO.26 for C97G site; SEQ ID NO.27 and SEQ ID NO.28 for C164T site; SEQ ID NO.29 and SEQ ID NO.30 for G123T site; SEQ ID NO.31 and SEQ ID NO.32 for G127A site; SEQ ID NO.33 and SEQ ID NO.34 for A148G site; And/or for SEQ ID NO.35 and the SEQ ID NO.36 in G129C site.
CN201110251737.7A 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene Expired - Fee Related CN102952874B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201110251737.7A CN102952874B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201110251737.7A CN102952874B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene

Publications (2)

Publication Number Publication Date
CN102952874A CN102952874A (en) 2013-03-06
CN102952874B true CN102952874B (en) 2014-07-23

Family

ID=47762255

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201110251737.7A Expired - Fee Related CN102952874B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene

Country Status (1)

Country Link
CN (1) CN102952874B (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005026723A1 (en) * 2003-09-13 2005-03-24 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with organic cation transporter slc22a1 (slc22a1)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Itoda M et al..Seven novel single nucleotide polymorphisms in the human SLC22A1 gene encoding organic cation transporter 1(OCT1).《Drug Metab Pharmacokinet.》.2004,第19卷(第4期),308-312.
Seven novel single nucleotide polymorphisms in the human SLC22A1 gene encoding organic cation transporter 1(OCT1);Itoda M et al.;《Drug Metab Pharmacokinet.》;20040831;第19卷(第4期);308-312 *
SLC22A1和SLC21A6遗传多态性对口服降糖药药代动力学和药效学的影响;冀玮;《中国博士学位论文全文数据库 医药卫生科技辑》;20091103(第02期);全文 *
冀玮.SLC22A1和SLC21A6遗传多态性对口服降糖药药代动力学和药效学的影响.《中国博士学位论文全文数据库 医药卫生科技辑》.2009,(第02期),全文.

Also Published As

Publication number Publication date
CN102952874A (en) 2013-03-06

Similar Documents

Publication Publication Date Title
CN103374609B (en) ABO gene mutation detection specific primers and liquid chip
CN102912002B (en) ABCB2 gene polymorphism detection specific primers and liquid chip
CN103031365B (en) ATM gene mutation detection specific primer and liquid chip
CN102191337B (en) Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
CN102994621A (en) PTPN11 gene mutation detection specificity primer and liquid chip thereof
CN102952874B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene
CN102952866B (en) Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene
CN102181573B (en) Specific primers and liquid-phase chip for detection of KITLG gene
CN103451272A (en) BAT3 gene mutation detection specific primer and liquid phase chip
CN102191336B (en) MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip
CN103374607B (en) ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip
CN102912005B (en) CYP2C8 gene polymorphism detection specific primers and liquid chip
CN102952867B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene
CN102952868B (en) Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene
CN102994625B (en) PIK3R1 gene mutation detection specificity primer and liquid chip thereof
CN102952870B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene
CN102888444B (en) Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip
CN102952872B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene
CN102952869B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene
CN102191335B (en) Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes
CN102952873B (en) Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene
CN103374611B (en) LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip
CN103031371B (en) CDH1 gene mutation detection specific primer and liquid chip
CN102146482B (en) IL-23R gene polymorphism detection specific primer and liquid phase chip
CN102888445A (en) NAT2 genetic polymorphism detection specific primer and liquid-phase chip

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C53 Correction of patent for invention or patent application
CB02 Change of applicant information

Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Applicant after: Surexam Biological Technology Co., Ltd.

Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Applicant before: Guangzhou Yishan Biotechnology Co., Ltd.

COR Change of bibliographic data

Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD.

C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140723

Termination date: 20150829

EXPY Termination of patent right or utility model