CN102952866B - Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene - Google Patents

Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene Download PDF

Info

Publication number
CN102952866B
CN102952866B CN201110251209.1A CN201110251209A CN102952866B CN 102952866 B CN102952866 B CN 102952866B CN 201110251209 A CN201110251209 A CN 201110251209A CN 102952866 B CN102952866 B CN 102952866B
Authority
CN
China
Prior art keywords
seq
sequence
site
primer
tag sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201110251209.1A
Other languages
Chinese (zh)
Other versions
CN102952866A (en
Inventor
许嘉森
吴诗扬
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Surexam Medical Laboratory Co ltd
Original Assignee
Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Surexam Bio Tech Co Ltd filed Critical Surexam Bio Tech Co Ltd
Priority to CN201110251209.1A priority Critical patent/CN102952866B/en
Publication of CN102952866A publication Critical patent/CN102952866A/en
Application granted granted Critical
Publication of CN102952866B publication Critical patent/CN102952866B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a specific primer and liquid chip for detecting polymorphism of a DPYD (dihydropyrimidine dehydrogenase) gene. The liquid chip mainly comprises ASPE (allele specific primer extension) primers, microspheres and amplification primers, wherein each ASPE primer is formed by tag sequences at the 5' terminal and specific primer sequences which are arranged at the 3' terminal and aim at the mutation site of the target gene; the specific primer sequences are SEQ ID NO.7 and SEQ ID NO.8 aiming at the G55A site, SEQ ID NO.9 and SEQ ID NO.10 aiming at the G141A site and/or SEQ ID NO.11 and SEQ ID NO.12 aiming at the G134T site; and the microspheres are enveloped by anti-tag sequences. The detecting liquid chip provided by the invention has the advantages that the consistency of the detection result and the sequencing method is as high as 100%, thus parallel detection of wild types and mutant types of a plurality of mutation sites is achieved.

Description

A kind of DPYD gene pleiomorphism detection specificity primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of DPYD gene pleiomorphism detection specificity primer and the liquid-phase chip of relating to.
Background technology
Fluracil (5-Fu) is one of antitumor drug being most widely used in various oncotherapies.5-Fu more than 80% in body in liver via dihydropyrimidine dehydrogenase (DPD) katabolism.The coded dihydropyrimidine dehydrogenase (DPD enzyme) of dihydropyrimidine dehydrogenase gene (DPYD gene) is the main rate-limiting enzyme of fluoridizing the metabolism of miazines antitumor drug, there is significant individual difference in its activity, therefore and affect curative effect and the toxic side effect of medicine, there are some researches show the polymorphism of DPYD gene and the enzyme of its coding significant correlation alive.
The DPYD gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number The content of DPYD site mutation Write a Chinese character in simplified form
1 , there is G → A sudden change in the 55th Nucleotide of SEQ ID NO.29 G55A
2 , there is G → A sudden change in the 141st Nucleotide of SEQ ID NO.30 G141A
3 , there is G → T sudden change in the 134th Nucleotide of SEQ ID NO.31 G134T
SEQ ID NO.29-SEQ ID NO.31's is composed as follows:
SEQ ID NO.29
CACCAAGGTCCTTCATTAGCTCAATCTCAAAATTCACTACATCATACGGCAGCCGGAACTGAGGAATTTCAGAAGTACTGAAAAGAAAGGAGAAAGAAAAACAGGCATCAGTAGAAAAATGACCAATCTTTGACCAATCTTAAAAAAAGGTAACATGTCTTTATGGATTAGTAGAAAATAAATATCTCTTCCAAGGATATTTATATATCACACAAGATATGCATGAGGACA。
SEQ ID NO.30
TCCCTAGACACACATTTGTTTGTTGATAATATTTATATGTTTATATCTTCCCATTTTTCTCTTCTCTGAGCTAACATGCTTCCTTATTTGTGTGTTTTCCTTTTAGAAACTGCCAAGTTTTGGACCTTATCTGGAACAGCGCAAGAAAATCATAGCAGAAAACAAGATTAGACTGAAAGAACAAAATGTAGCTTTTTCACCACTTAAGAGAAACTGTTTTATCCCCAAAAGGCCTATTCCTACCATCAAGGTAAAAATTATGCCAAC。
SEQ ID NO.31
GGGGACATTGTTGACCTTTGTGGTCAGTGACATCAATACCCTCTATTTCTGTTTGCAGGCTATACAGTTTGATCCAGAAACCCACCTGCCCACCATAACCGACACTTGTACAGGCTGTACTCTGTGTCTCAGTGTTTGCCCTATTGTCGACTGCATCAAAATGGTTTCCAGGACAACACCTTATGAACCAAAGAGAGGCGTACCCTTATCTGTGAATCCGGTGTGTTAAGGTGATTTGTGAAACAGTTGCTGTGAACTTTCATGTCACCTACATATGCTGATCTTTTAAAATCATGATCCTTGTGTTCAGCTCTTTCC。
At present, the method that DPYD gene pleiomorphism is detected, analyzed mainly contains direct sequencing and Real-Time Fluorescent Quantitative PCR Technique, direct sequencing sensitivity only has 20%-25%, complicated operation, poor in timeliness, can not meet the needs of practical application, especially for heterogeneous tumour somatic mutation, muting sensitivity is a large amount of undetected by causing; And Real-Time Fluorescent Quantitative PCR Technique, its sensitivity reaches 1%-2%, and detection efficiency is high, ageing strong, but its false positive rate under being in not is also denounced by practical application.Again, above these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not meet the needs of practical application.
Summary of the invention
One of object of the present invention is to provide DPYD gene pleiomorphism and detects liquid-phase chip, and this liquid-phase chip can be used for wild-type and saltant type parallel or individual event detection DPYD gene three kinds of common genotype G55A, G141A and G134T.
The technical scheme that realizes above-mentioned purpose is as follows.
DPYD gene pleiomorphism detects a liquid-phase chip, includes:
(A). the wild-type designing respectively for the different pleomorphism sites of DPYD gene and the ASPE primer of saltant type: every kind of ASPE primer holds the specific primer sequence for goal gene pleomorphism site to form by the tag sequence and 3 ' of 5 ' end, and described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in G55A site; SEQ ID NO.9 and SEQ ID NO.10 for G141A site; And/or for SEQ ID NO.11 and the SEQ ID NO.12 in G134T site; Described tag sequence is selected from SEQ ID NO.1~SEQ ID NO.6;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.13~SEQ ID NO.18, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.
Preferably, described amplimer is: for SEQ ID NO.19 and the SEQ ID NO.20 in G55A site; SEQ ID NO.21 and SEQ ID NO.22 for G141A site; And/or for SEQ ID NO.23 and the SEQ IDNO.24 in G134T site.
Preferably, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.7 in G55A site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.8; For the sequence being formed by SEQ ID NO.3 and SEQ IDNO.9 in G141A site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.10; And/or for the sequence being formed by SEQID NO.5 and SEQ ID NO.11 in G134T site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.12.
Another object of the present invention is to provide the Auele Specific Primer detecting for DPYD gene pleiomorphism.
The technical scheme that realizes above-mentioned purpose is as follows:
The Auele Specific Primer detecting for DPYD gene pleiomorphism, includes: for SEQ ID NO.7 and the SEQID NO.8 in G55A site; SEQ ID NO.9 and SEQ ID NO.10 for G141A site; And/or for SEQ IDNO.11 and the SEQ ID NO.12 in G134T site.
Major advantage of the present invention is:
1. the identical rate of detection method provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared DPYD gene pleiomorphism detects liquid-phase chip and has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in a plurality of SNP site.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the polymorphism situation in a plurality of mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, three kinds of pleomorphism sites detect and can complete the amplification of three target sequences that contain SNP site by a step multiplex PCR, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1 DPYD gene pleiomorphism detects liquid-phase chip, mainly includes:
One, ASPE primer
Wild-type and saltant type for DPYD gene three kinds of common genotype G55A, G141A and G134T, design respectively specific primer sequence.ASPE primer is comprised of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence of table 1 DPYD gene (tag sequence+specific primer sequence)
Figure BDA0000087114620000041
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Two, the coated microballoon of anti-tag sequence
According to the Auele Specific Primer fragment of designed ASPE, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 6 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
Figure BDA0000087114620000042
Figure BDA0000087114620000051
6 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH 2o is made into the stock solution of 100nmol/ml.Described spacerarm is for for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 * 10 6the carboxylated microballoon of individual above-mentioned numbering (purchased from Luminex company) is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (purchased from the Pierce Chemical company) working fluid of preparation 10ng/ml.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris (pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For DPYD gene three kinds of common genotype G55A, G141A and G134T, design of amplification primers, to (in Table 3), amplifies respectively three target sequences that contain pleomorphism site.
Table 3 amplifies the primer of the target sequence with pleomorphism site
Figure BDA0000087114620000052
Figure BDA0000087114620000061
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Embodiment 2 uses the DPYD gene pleiomorphism described in embodiment 1 to detect the detection of liquid-phase chip to sample
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
Figure BDA0000087114620000062
2 * Tm hybridization buffer
Reagent Source Final concentration The consumption of every 250ml
1MTris-HCl,pH8.0 Sigma T3038 0.2M 50ml
5MNaCl Sigma S5150 0.4M 20ml
Triton X-100 Sigma T8787 0.16% 0.4ml
After filtration, be stored in 4 ℃.
ExoSAP-IT test kit is purchased from U.S. USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to < < molecular cloning > > about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design three pairs of primers, multiplex PCR one step amplifies the three objective sequences that contain respectively DPYD gene three kinds of common genotype G55A, G141A and G134T, product size is respectively 231bp, 192bp and 134bp, and primer sequence (SEQ ID NO.19-24) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.19-24 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Figure BDA0000087114620000071
Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after processing is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make a plurality of biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Figure BDA0000087114620000072
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
1. according to the ASPE primer of design, the corresponding 6 kinds of coated microballoons of every group selection (as described in Example 1).Every kind of microballoon concentration is 2.5 * 10 5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul 2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH 2o complements to 50ul;
7. with masking foil, encase 96 orifice plates with lucifuge, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 * Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;
Hatch 15min for 12.37 ℃, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 * PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI (NET MFI be less than 0 with 0 expression);
3. meet the data of above two conditions, by following formula, calculate sudden change ratio:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NETMFI+ wild-type NET MFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments DPYD gene polymorphism sites originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.With sequencing, detect with liquid-phase chip result and compare, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments DPYD genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible DPYD gene pleiomorphism provided by the present invention detects liquid-phase chip can detect DPYD gene polymorphism sites type exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Figure BDA0000087114620000091
Table 5 sample DPYD transgenation ratio (%)
Sample number G55A G141A G134T
1 2% 2% 2%
2 2% 51% 1%
3 1% 2% 2%
4 2% 2% 1%
5 2% 1% 1%
6 2% 2% 2%
7 2% 2% 1%
8 1% 2% 2%
9 3% 3% 1%
10 98% 2% 2%
11 1% 2% 1%
12 3% 1% 99%
13 2% 2% 2%
14 3% 1% 1%
15 1% 2% 2%
16 1% 2% 1%
17 1% 2% 54%
18 2% 3% 2%
19 2% 2% 1%
20 2% 2% 2%
Table 6 sample DPYD gene mutation type analytical results
Catalogue number(Cat.No.) Liquid-phase chip detected result Sequencing result
1 Wild-type Wild-type
2 141GA 141GA
3 Wild-type Wild-type
4 Wild-type Wild-type
5 Wild-type Wild-type
6 Wild-type Wild-type
7 Wild-type Wild-type
8 Wild-type Wild-type
9 Wild-type Wild-type
10 55AA 55AA
11 Wild-type Wild-type
12 134TT 134TT
13 Wild-type Wild-type
14 Wild-type Wild-type
15 Wild-type Wild-type
16 Wild-type Wild-type
17 134GT 134GT
18 Wild-type Wild-type
19 Wild-type Wild-type
20 Wild-type Wild-type
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to DPYD gene SNP site
One, the design that prepared by liquid-phase chip (selection of tag sequence and Anti-tag sequence)
It is example that the DPYD gene G55A site mutation of take detects liquid-phase chip, respectively for the wild-type of G55A and the specific primer sequence of saltant type design ASPE primer 3 ' end, the tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ IDNO.6, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.13-SEQ ID NO.18.Specific design is as shown in following table (table 7).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 7 liquid-phase chip
Figure BDA0000087114620000111
Figure BDA0000087114620000121
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 8 pattern detection result and gene SNP analysis
Figure BDA0000087114620000131
Other is for the liquid-phase chip in different mutational sites, and ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4DPYD gene pleiomorphism detection specificity primer sequence
One, the design that prepared by liquid-phase chip (selection of wild-type and saltant type specific primer sequence)
Take the SNP site of DPYD gene G141A, to detect liquid-phase chip be example, the complementary sequence forward or backwards of this place, mutational site target sequence of take is template, respectively for the wild-type of G141A and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 9.Wherein, interior base is pleomorphism site.
Table 9 specific primer sequence
Figure BDA0000087114620000133
Take the SNP site of DPYD gene G141A, to detect liquid-phase chip be example, for G141A, select different specific primer sequences, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 10).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 10 liquid-phase chip
Figure BDA0000087114620000134
Figure BDA0000087114620000141
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 11 pattern detection result and Polymorphism Analysis
Figure BDA0000087114620000142
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 4.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 1 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different mutational sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detect effect also better, concrete data are omitted.
Be more than for the illustrating of possible embodiments of the present invention, but this embodiment is not in order to limit the scope of the claims of the present invention, allly do not depart from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the scope of the claims of the present invention.
Figure IDA0000087114670000011
Figure IDA0000087114670000021
Figure IDA0000087114670000031
Figure IDA0000087114670000051
Figure IDA0000087114670000061

Claims (5)

1. DPYD gene pleiomorphism detects a liquid-phase chip, it is characterized in that, includes:
(A). the wild-type designing respectively for the different pleomorphism sites of DPYD gene and the ASPE primer of saltant type: every kind of ASPE primer holds the specific primer sequence for goal gene pleomorphism site to form by the tag sequence and 3 ' of 5 ' end, and described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in G55A site; SEQ ID NO.9 and SEQ ID NO.10 for G141A site; And/or for SEQ ID NO.11 and the SEQ ID NO.12 in G134T site; Described tag sequence is selected from SEQ ID NO.1~SEQ ID NO.6;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.13~SEQ ID NO.18, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site;
Described amplimer is: for SEQ ID NO.19 and the SEQ ID NO.20 in G55A site; SEQ ID NO.21 and SEQ ID NO.22 for G141A site; And/or for SEQ ID NO.23 and the SEQ ID NO.24 in G134T site.
2. DPYD gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.7 in G55A site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.8; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.9 in G141A site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.10; And/or for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.11 in G134T site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.12.
3. DPYD gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that,
(A). described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.7 in G55A site and the sequence being comprised of SEQ ID NO.2 and SEQ ID NO.8; For the sequence being formed by SEQ ID NO.3 and SEQ ID NO.9 in G141A site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.10; With the sequence being formed by SEQ ID NO.5 and SEQ ID NO.11 for G134T site and the sequence being formed by SEQ ID NO.6 and SEQ ID NO.12;
(B). there is anti-tag sequence microballoon coated, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.13~SEQ ID NO.18, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). described amplimer is: for SEQ ID NO.19 and the SEQ ID NO.20 in G55A site; SEQ ID NO.21 and SEQ ID NO.22 for G141A site; With SEQ ID NO.23 and the SEQ ID NO.24 for G134T site.
4. according to the DPYD gene pleiomorphism described in claim 1-3 any one, detect liquid-phase chip, it is characterized in that, described spacerarm is 5-10 T.
5. the Auele Specific Primer detecting for DPYD gene pleiomorphism, is characterized in that, described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in G55A site; SEQ ID NO.9 and SEQ ID NO.10 for G141A site; And/or for SEQ ID NO.11 and the SEQ ID NO.12 in G134T site.
CN201110251209.1A 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene Active CN102952866B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201110251209.1A CN102952866B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201110251209.1A CN102952866B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene

Publications (2)

Publication Number Publication Date
CN102952866A CN102952866A (en) 2013-03-06
CN102952866B true CN102952866B (en) 2014-04-16

Family

ID=47762247

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201110251209.1A Active CN102952866B (en) 2011-08-29 2011-08-29 Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene

Country Status (1)

Country Link
CN (1) CN102952866B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105567811A (en) * 2015-12-30 2016-05-11 广州金域检测科技股份有限公司 Primers for DPYD gene polymorphism and detection method thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101928765A (en) * 2009-06-26 2010-12-29 上海主健生物工程有限公司 Kit for detecting anti-tumor therapeutic effect and safety of 5-FU (Fluorouracil)

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101928765A (en) * 2009-06-26 2010-12-29 上海主健生物工程有限公司 Kit for detecting anti-tumor therapeutic effect and safety of 5-FU (Fluorouracil)

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Genetic variations and haplotype structures of the DPYD gene encoding dihydropyrimidine dehydrogenase in Japanese and their ethnic differences;Keiko Maekawa et al.;《Journal of Human Genetics》;20070909(第52期);804-819 *
Keiko Maekawa et al..Genetic variations and haplotype structures of the DPYD gene encoding dihydropyrimidine dehydrogenase in Japanese and their ethnic differences.《Journal of Human Genetics》.2007,(第52期),804-819.
文思远等.用基因芯片检测DPYD等位基因在受试人群中的发生频率.《生物化学与生物物理进展》.2004,第31卷(第11期),1031-1037.
用基因芯片检测DPYD等位基因在受试人群中的发生频率;文思远等;《生物化学与生物物理进展》;20041231;第31卷(第11期);1031-1037 *

Also Published As

Publication number Publication date
CN102952866A (en) 2013-03-06

Similar Documents

Publication Publication Date Title
CN102533948B (en) apoB (apolipoprotein B) gene SNP (Single Nucleotide Polymorphism) detection specific primer and liquid-phase chip
CN103374609B (en) ABO gene mutation detection specific primers and liquid chip
CN102994621B (en) PTPN11 gene mutation detection specificity primer and liquid chip thereof
CN102912002B (en) ABCB2 gene polymorphism detection specific primers and liquid chip
CN102191337B (en) Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
CN102952866B (en) Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene
CN103374607B (en) ABCC (ATP (adenosine triphosphate)-binding cassette, sub-family C)1 gene mutation detection specific primers and liquid chip
CN103451272A (en) BAT3 gene mutation detection specific primer and liquid phase chip
CN102181573B (en) Specific primers and liquid-phase chip for detection of KITLG gene
CN102191336B (en) MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip
CN102912005B (en) CYP2C8 gene polymorphism detection specific primers and liquid chip
CN102952867B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene
CN102952874B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A1 gene
CN102952870B (en) Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene
CN102888444B (en) Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip
CN102912008B (en) ABCG2 gene polymorphism detection specific primer and liquid phase chip
CN102952868B (en) Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene
CN102952872B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene
CN102994625B (en) PIK3R1 gene mutation detection specificity primer and liquid chip thereof
CN103374611B (en) LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip
CN102191335B (en) Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes
CN103374608B (en) MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip
CN102952873B (en) Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene
CN102952869B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene
CN102912007B (en) CYP2B6 gene polymorphism detection specific primers and liquid chip

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C53 Correction of patent of invention or patent application
CB02 Change of applicant information

Address after: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Applicant after: SUREXAM BIO-TECH Co.,Ltd.

Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Applicant before: GUANGZHOU SUREXAM BIO-TECH Co.,Ltd.

COR Change of bibliographic data

Free format text: CORRECT: APPLICANT; FROM: GUANGZHOU YISHAN BIOTECHNOLOGY CO., LTD. TO: SUREXAM BIOTECHNOLOGY CO., LTD.

C14 Grant of patent or utility model
GR01 Patent grant
TR01 Transfer of patent right

Effective date of registration: 20230726

Address after: 510700, 8th floor, No. 29 Helix 3 Road, Guangzhou International Biological Island, Huangpu District, Guangzhou City, Guangdong Province

Patentee after: GUANGZHOU SUREXAM MEDICAL LABORATORY Co.,Ltd.

Address before: Five 510663 Guangdong city of Guangzhou province Guangzhou Science City Moon Road No. 80, Guangzhou technology innovation base B, C

Patentee before: SUREXAM BIO-TECH Co.,Ltd.

TR01 Transfer of patent right