CN102952871B - Specific primer and liquid chip for detecting polymorphism of SULT1A1 gene - Google Patents

Abstract

The invention discloses a specific primer and liquid chip for detecting polymorphism of an SULT1A1 gene. The liquid chip mainly comprises ASPE (allele specific primer extension) primers, microspheres and amplification primers, wherein each ASPE primer is formed by tag sequences at the 5' terminal and specific primer sequences which are arranged at the 3' terminal and aim at the polymorphic site of the target gene; the specific primer sequences are SEQ ID NO.5 and SEQ ID NO.6 aiming at the G89A site and/or SEQ ID NO.7 and SEQ ID NO.8 aiming at the G118A site; the tag sequences are selected from SEQ ID NO.1- SEQ ID NO.4; and the microspheres are enveloped by anti-tag sequences. The detecting liquid chip provided by the invention has the advantages that the consistency of the detection result and the sequencing method is as high as 100%, thus parallel detection of wild types and mutant types of a plurality of mutation sites is achieved.

Description

A kind of SULT1A1 gene pleiomorphism detection specificity primer and liquid-phase chip

Technical field

The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of SULT1A1 gene pleiomorphism detection specificity primer and the liquid-phase chip of relating to.

Background technology

Molecular biology and zymochemistry research in recent years shows, in body metabolism involved enzyme and gene pleiomorphism thereof, may develop relevant with hormone, medicine and exogenous carcinogens with the generation of cancer, by studying the polymorphism of these enzyme genes, illustrate the molecular genetics basis that hormone-dependent tumor occurs, become gradually the new direction of tumor aetiology research.

Sulfate transferring enzyme (Sulfotransferases, SULTs) be one of important enzyme of regulating estrogen synthesis and metabolism, sulfating reaction in the main catalysis human body of SULTs, in the biological metabolism of exogenous compounds (medicine, foodstuff additive, carcinogens etc.) and chemical defence process, play a part crucially, also playing an important role regulating aspect the biologic activity of various endogenous compound.This sulfation, at many hormones (comprise and can act on endometrial oestrogenic hormon), is a kind of important metabolic reaction in the biological metabolism of medicine and exogenous mixture and chemical defence process.Research shows at present both at home and abroad, and the polymorphism of SULTs encoding gene SULT1A1 and the generation of cancer development are closely related.

The SULT1A1 gene mutation site of target detect of the present invention, it is as shown in the table:

Sequence number	The content of SULT1A1 site mutation	Write a Chinese character in simplified form
			1	, there is G → A sudden change in the 89th Nucleotide of SEQ ID NO.19	G89A
2	, there is G → A sudden change in the 118th Nucleotide of SEQ ID NO.19	G118A

SEQIDNO.19

GAATCAGTAATCCGAGCCTCCACTGAGGGGCCCTCTGCTGCTCAGAACCCGAAAAGGGAGATTCAAAAGATCCTGGAGTTTGTGGGGCGCTCCCTGCCAGAGGAGACCGTGGACTTCGTGGTTCAGCACACGTCGTTCAAGGAGATGAAGAAGAACCCTATGACCAACTACACCACCGTCCCCCAGGAGTTCATGGACCACAGCATCTCCCCCTTCATGAGGAAAGGTGGGTGCTGGCCAGCACGGGGGTTTGGGGCGGGTGGGAGCAGCAGCTGCAGCCTCCCCATAGGCACTTGGGGCCTCCCCTGGGATGAGACTCCAGCTTTGCTCCCTGCCTTCCTCCCCCAGGCATGGCTGGGGACTGGAAGACCACCTTCACCGTGGCGCAGAATGAGCGCTTCGATGCGGACTATGCGGAGAAGATGGCAGG。

At present, the method for SULT1A1 gene pleiomorphism being carried out to determination and analysis is little, mainly contains direct sequencing and PCR-RFLP analytical method, and wherein the most frequently used method has PCR-RFLP analytical method.PCR-RFLP method is the change of the restriction enzyme enzyme recognition site that causes based on transgenation, as lost or generation novel site in site, by a certain specific fragment of pcr amplification, use again digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, the transgenation that this method changes for detection of restriction enzyme site, can directly judge genotype, but this method can not be used for not producing the detection in Gene Mutation of new restriction enzyme site.Again, above these methods all exist the limitation that detects flux, can only detect a kind of mutation type at every turn, can not meet the needs of practical application.

Summary of the invention

One of object of the present invention is to provide SULT1A1 gene pleiomorphism and detects liquid-phase chip, and this liquid-phase chip can be used for wild-type and the saltant type of individual event or two kinds of common genotype G89A of parallel detection SULT1A1 gene and G118A.

The technical scheme that realizes this object is as follows:

A kind of SULT1A1 gene pleiomorphism detects liquid-phase chip, includes:

(A). the wild-type designing respectively for the different pleomorphism sites of SULT1A1 gene and the ASPE primer of saltant type: every kind of ASPE primer is comprised of for the specific primer sequence of goal gene pleomorphism site tag sequence and the 3 ' end of 5 ' end, and described specific primer sequence is: for SEQ ID NO.5 and the SEQ ID NO.6 in G89A site; And/or for SEQ ID NO.7 and the SEQ ID NO.8 in G118A site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.4;

(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.9～SEQ ID NO.12, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;

(C). for amplifying the primer that needs the target sequence detecting, there is corresponding pleomorphism site.

Preferably, described amplimer is: for SEQ ID NO.13 and the SEQ ID NO.14 in G89A, G118A site.

Preferably, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.5 in G89A site and the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.6; And/or for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.7 in G118A site and the sequence that formed by SEQ ID NO.4 and SEQ ID NO.8.

Another object of the present invention is to provide the Auele Specific Primer detecting for SULT1A1 gene pleiomorphism.

The technical scheme that realizes this object is:

The Auele Specific Primer detecting for SULT1A1 gene pleiomorphism, described specific primer sequence is: for SEQ ID NO.5 and the SEQ ID NO.6 in G89A site; And/or for SEQ ID NO.7 and the SEQ ID NO.8 in G118A site.

Major advantage of the present invention is:

1. the identical rate of detection method provided by the present invention and sequencing is up to 100%, and detects the needed time well below conventional sequencing technologies, and realistic especially application needs.Prepared SULT1A1 gene pleiomorphism detects liquid-phase chip and has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in multiple SNP site.

2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, the also polymorphism situation in the multiple mutational sites of parallel detection simultaneously, detects effect consistent.

3. detection method step of the present invention is simple, two kinds of pleomorphism sites detect the amplification that can complete by a pcr amplification target sequence that contains SNP site, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.

4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.

5. the technical scheme that the SULT1A1 gene mutation detection liquid-phase chip in the present invention provides a kind of difference to conceive for the parallel detection of multiple sites Multi-genotype, and produced significant technique effect.Meanwhile, due to the technical characterictics such as high-throughput high specific, the demand of more realistic application.Liquid-phase chip technology of the present invention is by the technology trends that is representing that biological target detects.

Embodiment

Embodiment 1 SULT1A1 gene pleiomorphism detects liquid-phase chip, mainly includes:

One, ASPE primer

For wild-type and the saltant type of two kinds of common genotype G89A of SULT1A1 gene and G118A, design respectively specific primer sequence.ASPE primer is comprised of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:

The ASPE primer sequence (tag sequence+specific primer sequence) of table 1 SULT1A1 gene

Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.

Two, the coated microballoon of anti-tag sequence

According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 4 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:

Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon

4 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH ₂o is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly (dT), and oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if exist poly (dA) to disturb, can also use poly (TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:

Get respectively 5 × 10 ⁶the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.EDC (N-(3-Dimethylaminopropyl-N-ethylcarbodiimide) (purchased from the Pierce Chemical company) working fluid of preparation 10ng/ml.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris (pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/LEDTA, 2-8 ℃ keeps in Dark Place.

Three, amplify the primer of the target sequence that contains mutational site

For two kinds of common genotype G89A of SULT1A1 gene and G118A, design of amplification primers, to (in Table 3), amplifies the target sequence that contains two pleomorphism sites.

Table 3 amplifies the primer of the target sequence with pleomorphism site

All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.

Embodiment 2 uses the detection to sample of SULT1A1 gene test liquid-phase chip described in embodiment 1

The formula of described various solution is as follows:

MES damping fluid (pH5.0) formula (250ml) of 50mM:

2 × Tm hybridization buffer

Reagent	Source	Final concentration	The consumption of every 250ml
				1MTris-HCl，pH8.0	SigmaT3038	0.2M	50ml

5M NaCl	Sigma S5150	0.4M	20ml
				Triton X-100	Sigma T8787	0.16％	0.4ml

After filtration, be stored in 4 ℃.

ExoSAP-IT test kit is purchased from U.S. USB company.

Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

One, the DNA extraction of sample:

Methods involving with reference to < < molecular cloning > > about DNA extraction, obtains DNA to be detected.

Two, the pcr amplification of testing sample

Design pair of primers, PCR mono-step amplifies the target sequence that simultaneously contains two kinds of common genotype G89A of SULT1A1 gene and G118A, and product size is 430bp, and primer sequence (SEQ IDNO.13-14) is shown in shown in above-mentioned table 3.

First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.13-14 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:

Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.

Three, the enzyme of PCR product is cut processing

1. get the reacted product of 7.5ul PCR, add 1ul 10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;

Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.Enzyme is cut product after treatment and is directly used in follow-up ASPE primer extension reaction.

Four, site-specific primer extension reaction (ASPE)

Utilize the ASPE primer of above-mentioned design to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make multiple biotin labeling on reacted product band.

First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:

Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.

Five, hybridization

1. according to the ASPE primer of design, every group selection is coated microballoon (as described in Example 1) accordingly, and every kind of microballoon concentration is 2.5 × 10 ⁵individual/ml;

2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;

3. microballoon is in >=centrifugal the 1-2min of 10000g;

4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;

5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul ₂o;

6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH ₂o complements to 50ul;

7. with masking foil, encase 96 orifice plates with lucifuge, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;

8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;

9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;

10. microballoon is in >=centrifugal the 2-5min of 3000g;

11. are resuspended in microballoon in 1 × Tm hybridization buffer of 75ul, and adding 15ul concentration is the SA-PE (SA-PE) of 10ug/ml;

Hatch 15min for 12.37 ℃, on Luminex instrument, detect.

Six, result detects and data analysis

Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.

Fluorescent value (MFI) and data processing are had to following requirement:

1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;

2.NET MFI=sample MFI-PCR negative control MFI (NET MFI be less than 0 with 0 expression);

3. meet the data of above two conditions, by following formula, calculate sudden change ratio:

Sudden change ratio=saltant type NET MFI ÷ (saltant type NETMFI+ wild-type NET MFI)

4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.

Use present method to detect 20 increments SULT1A1 gene polymorphism sites originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.With sequencing, detect with liquid-phase chip result and compare, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments SULT1A1 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible SULT1A1 gene pleiomorphism provided by the present invention detects liquid-phase chip can detect SULT1A1 gene polymorphism sites type exactly, and result is reliable and stable.

One of table 4 pattern detection result (MFI)

Table 5 sample SULT1A1 transgenation ratio (%)

Sample number	G89A	G118A
			1	1％	2％
2	1％	1％
			3	2％	2％
4	1％	2％
			5	99％	2％
6	1％	50％
			7	2％	2％
8	3％	2％
			9	2％	2％
10	1％	2％
			11	2％	2％
12	3％	2％
			13	98％	2％
14	2％	1％
			15	1％	2％
16	2％	2％

17	1％	2％
			18	1％	2％
19	1％	3％
			20	2％	1％

Table 6 sample SULT1A1 gene mutation type analytical results

The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to SULT1A1 gene SNP site

One, the design (selection of tag sequence and Anti-tag sequence) that prepared by liquid-phase chip

Take SULT1A1 gene G89A site mutation, detect liquid-phase chip as example, respectively for the wild-type of G89A and the specific primer sequence of saltant type design ASPE primer 3 ' end, the tag sequence of ASPE primer 5 ' end is selected from SEQ IDNO.1-SEQ ID NO.4, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.9-SEQ ID NO.12.Specific design is as shown in following table (table 7).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.

Design prepared by table 7 liquid-phase chip

Two, sample detection

The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:

Table 8 pattern detection result and gene SNP analysis

Other is for the liquid-phase chip in different mutational sites, and ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.

The selection of embodiment 4 SULT1A1 gene SNP detection specific primer sequences

One, the design (selection of wild-type and saltant type specific primer sequence) that prepared by liquid-phase chip

Take the SNP site of SULT1A1 gene G118A, detect liquid-phase chip as example, take the complementary sequence forward or backwards of this place, mutational site target sequence as template, respectively for the wild-type of G118A and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 9.Wherein,

interior base is pleomorphism site.

Table 9 specific primer sequence

Take the SNP site of SULT1A1 gene G118A, detect liquid-phase chip as example, for G118A, select different specific primer sequences, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 10).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.

Two of design prepared by table 10 liquid-phase chip

Two, sample detection

The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:

Table 11 pattern detection result and Polymorphism Analysis

From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 3.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 1 is better from different tag sequence arranging effects, concrete data are omitted.

Other multiple specific primer sequence for different mutational sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detect effect also better, concrete data are omitted.

Be more than for the illustrating of possible embodiments of the present invention, but this embodiment is not in order to limit the scope of the claims of the present invention, allly do not depart from the equivalence that skill spirit of the present invention does and implement or change, all should be contained in the scope of the claims of the present invention.

Claims (6)

1. SULT1A1 gene pleiomorphism detects a liquid-phase chip, it is characterized in that, includes:

(A). the wild-type designing respectively for the different pleomorphism sites of SULT1A1 gene and the ASPE primer of saltant type: every kind of ASPE primer is comprised of for the specific primer sequence of goal gene pleomorphism site tag sequence and the 3 ' end of 5 ' end, and described specific primer sequence is: for SEQ ID NO.5 and the SEQ ID NO.6 in G89A site; With SEQ ID NO.7 and the SEQ ID NO.8 for G118A site; Described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.4; Described G89A site is the 89th Nucleotide of SEQ ID NO.19, and G → A sudden change occurs, and described G118A site is the 118th Nucleotide of SEQ ID NO.19, and G → A sudden change occurs;

(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.9～SEQ ID NO.12, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;

(C). for amplifying the primer that needs the target sequence detecting, there is corresponding pleomorphism site.

2. SULT1A1 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described amplimer is: for SEQ ID NO.13 and the SEQ ID NO.14 in G89A, G118A site.

3. SULT1A1 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that, described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.5 in G89A site and the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.6; With the sequence being formed by SEQ ID NO.3 and SEQ ID NO.7 for G118A site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.8.

4. SULT1A1 gene pleiomorphism according to claim 1 detects liquid-phase chip, it is characterized in that,

(A). described ASPE primer is: for the sequence being comprised of SEQ ID NO.1 and SEQ ID NO.5 in G89A site and the sequence that is comprised of SEQ ID NO.2 and SEQ ID NO.6; With the sequence being formed by SEQ ID NO.3 and SEQ ID NO.7 for G118A site and the sequence being formed by SEQ ID NO.4 and SEQ ID NO.8;

(B). there is microballoon that anti-tag sequence is coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.9～SEQ ID NO.12, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;

(C). described amplimer is: for SEQ ID NO.13 and the SEQ ID NO.14 in G89A, G118A site.

5. according to the SULT1A1 gene pleiomorphism described in claim 1-4 any one, detect liquid-phase chip, it is characterized in that, described spacerarm is 5-10 T.

6. the Auele Specific Primer detecting for SULT1A1 gene pleiomorphism, is characterized in that, described specific primer sequence is: for SEQ ID NO.5 and the SEQ ID NO.6 in G89A site; With SEQ ID NO.7 and the SEQ ID NO.8 for G118A site; Described G89A site is the 89th Nucleotide of SEQ ID NO.19, and G → A sudden change occurs, and described G118A site is the 118th Nucleotide of SEQ ID NO.19, and G → A sudden change occurs.