CN103451266B

CN103451266B - NKX3.1 gene mutation detection specific primers and liquid chip

Info

Publication number: CN103451266B
Application number: CN201210177487.1A
Authority: CN
Inventors: 许嘉森; 何嘉英
Original assignee: Surexam Bio Tech Co Ltd
Current assignee: Surexam Bio Tech Co Ltd
Priority date: 2012-05-31
Filing date: 2012-05-31
Publication date: 2015-02-04
Anticipated expiration: 2032-05-31
Also published as: CN103451266A

Abstract

The invention discloses an NKX3.1 (the human NK-3 prostate specific gene) gene mutation detection liquid chip and specific primers. The liquid chip mainly comprises the following parts: each ASPE primer contains a tag sequence at the 5' terminal and a specific primer sequence aiming at target gene mutation locus at the 3' terminal, and the specific primer sequences are as below: a SEQ ID NO.9 and a SEQ ID NO.10 aiming at a C95T locus, a SEQ ID NO.11 and a SEQ ID NO.12 aiming at a G189A locus, a SEQ ID NO.13 and a SEQ ID NO.14 aiming at an A49G locus, and / or a SEQ ID NO.15 and a SEQ ID NO.16 aiming at a G133A locus; microballoons coated with anti-tag sequences; and amplification primers. The detection results from the detection liquid chip provided by the invention are 100% identical with those from a sequencing method, so as to realize parallel detection on wild types and mutants of a plurality of mutation loci.

Description

NKX3.1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Technical field

The invention belongs to biology field, relate to medical science and biotechnology, particularly relate to a kind of NKX3.1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip.

Background technology

NKX3.1 English name is the human NK-3 prostate specific gene 1, and being positioned on No. 8 chromosome 8ps 21, is the member of homeodomain protein NK family, and the NK-3 albumen of Drosophila has close ties.NKX3.1 gene is made up of 2 exons, and this gene pairs prostate epithelial cell plays suppression and the differentiation effect of enhancing.NKX3.1 is the hox genes that prostate-specific is expressed, regulated by male sex hormone, plays an important role in prostate gland fetal development, epithelial differentiation and tumor development.In embry ogenesis process, the expression of NKX3.1 can be used as the important symbol of prostatic epithelium differentiation.NKX3.1 has high-caliber expression on adult prostate gland, plays low expression level at testis and other tissue several.With it prostate cancer patients, found the disappearance that NKX3.1 expresses, NKX3.1 gene plays keying action at prostatic function with regulating in the propagation of prostate epithelial cell.

At present, NKX3.1 detection method of gene mutation mainly contains: Illumina optical fiber superbead chip technology, Matrix Assisted Laser Desorption ionization time-of-flight mass-spectrometric technique (MALDI-TOF-MS) and fluorescent quantitative PCR technique, although Illumina optical fiber superbead chip technology is the high throughput testing system of highly sensitive and accuracy, but level of automation is low, manual operations is many, be difficult to the needs meeting practical application, it is low to there is sensitivity in fluorescent quantitative PCR technique, sample easily pollutes, the shortcoming that false positive rate is high, Matrix Assisted Laser Desorption ionization time-of-flight mass-spectrometric technique is a kind of Soft ionization techniques, powerful and the function of maturation is had in the detection of protein and other, but in field of nucleic acid detection, due to the singularity of nucleic acid molecule itself, detection is subject to certain restrictions.

The NKX3.1 gene mutation site of target detect of the present invention, it is as shown in the table:

Sequence number	The content of NKX3.1 gene point mutation	Write a Chinese character in simplified form
			1	, there is C → T sudden change in the 95th Nucleotide of SEQ ID NO.41	C95T
2	, there is G → A sudden change in the 189th Nucleotide of SEQ ID NO.42	G189A
			3	, there is A → G sudden change in the 49th Nucleotide of SEQ ID NO.43	A49G
6	, there is G → A sudden change in the 133rd Nucleotide of SEQ ID NO.44	G133A

SEQ ID NO.41 mutational site: C95T

AGTAAGGATGCCTGTTTGCTATCAAATTACTCTAACAGCATTATTTCCTTTGACTCTATTTA ACAGTCATGTGAAGCAAACCCTTTCTGTAGAT GTGCAAATTTAACTCAATCTGCATTGGGCTGGACATTGTGATAAATTACTAGGGATCTACTTGAATGACACTTTACATGCAAACTTTATTTTTACATTTTAATATATTCAAACTTATATGGTTAGGAGAGGAGTGTGACAGCTTCAAAAATAGAAGAAAAATCATTAAATGTTGACTGGTAGAGCTGGAAGAGATCTCAGCAACTACTTTATAGATGAGGAAACTAAGACATAGAGAAGTGGATAACTTTCCAACATCATACAGCCTTTG。

SEQ ID NO.42 mutational site: G189A

CATTGAGAGTCCTTGACCGCAACAGAAAAACCTGAGGACTCAAGGCCAATGCCCAAGCTTCAGCGGCTTTGGTCTAAGACTACAAAAACATCACCAGCCTGGAAACTGGTAATACCTAAGTGCTAGGAGCTTCCTTGGGTTTTTGCATAGTCTCTAGCACATCCAGTGATCCATTCAGGGTTTCGTGT TATCCATAACAATGGAACTCCATGGTCATTTCACAATCTTTAGGTAGGGTCCAACGTCTGAGGGCAAATTGTCCTGCATGACTCCCTCTCACATTTCCCCTCAAGCTCACAAATGAGTAAAATCTGGATAAATTACACATGAAGGGGGTTATGGTTAACGAGACTGAGAGGCAGTCATACTGGGAAGAGCAGCCAGGAGAAAAGAATGTT。

SEQ ID NO.43 mutational site: A49G

AGGCGGAAAGTGAAAGCGGTGCGGGCCGGGCGGGTGCATTCAGGCCAA GCGGGGCCGCCGGGATGCTCAGGGTTCCGGAGCCGCGGCCCGGGGAGGCGAAAGCGGAGGGGGCCGCGCCGCCGACCCCGTCCAAGCCGCTCACGTCCTTCCTCATCCAGG。

SEQ ID NO.44 mutational site: G133A

GCAGAACAGAATCCTTGGGTGTACAACTCATCCAAAATCATACAAAGTGCTGGAAAATACCACTTGATTTTCCCTCTCTCCCCTTCAAACAGGTAGCCAGAAGCAAAAAAAATGACCTACAGTATGCACTGG GGAATGACTTAGGTATTAAAACTTTCACTGTCTCTGTTGTTTCATTGTCTCACCAGTGAAGAATCTGAGATTTCCACGCAAATCTCCAATAGCTTTGGTGTGCACACCTCTTGCTCCCTGACCT。

Summary of the invention

An object of the present invention is to provide NKX3.1 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or parallel detection NKX3.1 gene four kinds of Common genes type C95T, the wild-type of G189A, A49G and G133A and saltant type.

The technical scheme realizing above-mentioned purpose is as follows:

A kind of NKX3.1 gene mutation detection liquid-phase chip, include: (A). the wild-type designed respectively for the different mutational site of NKX3.1 gene and the ASPE primer pair of saltant type: every bar ASPE primer holds the specific primer sequence for goal gene mutational site to form by 5 ' the tag sequence of holding and 3 ', described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C95T site, for SEQ ID NO.11 and the SEQ ID NO.12 in G189A site, for SEQ ID NO.13 and the SEQ ID NO.14 in A49G site, and/or for the SEQ ID NO.15 in G133A site and SEQ ID NO.16, described tag sequence is selected from SEQ ID NO.1 ~ SEQ ID NO.8,

(B). microballoon that have anti-tag sequence bag quilt, that have different colours coding, is also provided with spacer sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.17 ~ SEQ ID NO.24, and described anti-tag sequence can correspondingly be matched with selected tag complementary in (A);

(C). for amplifying the primer needing that detect, that there is corresponding mutational site target sequence.

Wherein in some embodiments, described amplimer is: for SEQ ID NO.25 and the SEQ ID NO.26 in C95T site, for SEQ ID NO.27 and the SEQ ID NO.28 in G189A site, for SEQ ID NO.29 and the SEQ ID NO.30 in A49G site, and/or for the SEQ ID NO.31 in G133A site and SEQ ID NO.32.

Wherein in some embodiments, described ASPE primer is: for the sequence be made up of SEQ ID NO.1 and SEQ ID NO.9 in C95T site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.10, for the sequence be made up of SEQ ID NO.3 and SEQ ID NO.11 in G189A site and the sequence that is made up of SEQ ID NO.4 and SEQ ID NO.12, for the sequence be made up of SEQ ID NO.5 and SEQ ID NO.13 in A49G site and the sequence that is made up of SEQ ID NO.6 and SEQ ID NO.14, and/or for the sequence be made up of SEQ ID NO.7 and SEQ ID NO.15 in G133A site and the sequence that is made up of SEQ ID NO.8 and SEQ ID NO.16.

Another object of the present invention is to provide the Auele Specific Primer for NKX3.1 detection in Gene Mutation.

Concrete technical scheme is as follows:

For the Auele Specific Primer of NKX3.1 detection in Gene Mutation, described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C95T site, for SEQ ID NO.11 and the SEQ ID NO.12 in G189A site, for SEQ ID NO.13 and the SEQ ID NO.14 in A49G site, and/or for the SEQ ID NO.15 in G133A site and SEQ ID NO.16.

Major advantage of the present invention is:

1. the detected result of NKX3.1 gene mutation detection liquid-phase chip provided by the present invention and the identical rate of sequencing are up to 100%, and the time required for detecting is well below conventional sequencing technologies, and realistic especially application needs.Prepared NKX3.1 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and substantially there is not cross reaction between designed probe and anti-tag sequence, choosing and the combination of tag sequence label and concrete ASPE primer of tag sequence label, anti-tag sequence label, can cross reaction be avoided, realize the parallel detection in multiple mutational site.

2. the present invention passes through the design experiences of contriver's long term accumulation and a large amount of experimental implementation, have chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention's design can the sensitive mutational site identifying target detect specifically, accurately distinguishes the genotype of various type; In same reaction system, substantially there is not cross reaction between different Auele Specific Primers, between the pcr amplification product that detects of Auele Specific Primer and non-targeted, detection specificity is good, and cross reacting rate is lower than 3%; Except Single locus catastrophe can be detected, also can the catastrophe in the simultaneously multiple mutational site of parallel detection, Detection results is consistent.

3. detection method step of the present invention is simple, the amplification that can complete 4 target sequences containing mutational site by One_step PCR is detected in 4 kinds of mutational sites, avoid the many uncertain factors existed in the complex operations processes such as repeated multiple times PCR, thus greatly can improve Detection accuracy, embody accurate qualitative and quantitative analysis feature simultaneously.

4. not only to overcome conventional solid chip susceptibility not high in the present invention, and the defect of the repeatability difference of detected result, improves existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detected improves greatly, thus the sensitivity detected is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.

Embodiment

Embodiment 1NKX3.1 gene mutation detection liquid-phase chip, mainly includes:

One, ASPE primer

For wild-type and the saltant type of NKX3.1 gene four kinds of Common genes type C95T, G189A, A49G and G133A, design specific primer sequence respectively.ASPE primer is made up of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:

The ASPE primer sequence (tag sequence+specific primer sequence) of table 1NKX3.1 gene

Every bar ASPE primer comprises two parts, and 5 ' end is for for the specificity tag sequence of anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer segments (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every bar primer after synthesis is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer.

Two, the microballoon of anti-tag sequence bag quilt

According to designed ASPE Auele Specific Primer fragment, select tag sequence, between the anti-tag sequence reducing each microballoon to greatest extent and tag and the ASPE Auele Specific Primer fragment secondary structure that may be formed, the anti-tag sequence that 8 kinds of microballoons numberings of selection are corresponding on microballoon is as shown in table 2:

The anti-tag sequence that table 2 microballoon numbering is corresponding on microballoon

The 8 kinds of microballoon purchased from American Luminex companies selected, are coated in anti-tag sequence on microballoon.Be connected with the spacer sequence of 5-10 T between anti-tag sequence and microballoon, before each anti-tag sequence, namely add the spacer sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By the anti-tag sequence sterilizing ddH of synthesis ₂o is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in the sequence of hydrophilic environments.By arranging the spacer sequence of suitable length between anti-tag sequence and microballoon, can reduce sterically hindered, improving the efficiency of hybridization and the specificity of hybridization.Common spacer sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) interference, can also poly(TTG be used) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the process of microballoon bag quilt is as follows:

Get 5 × 10 respectively ⁶the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in (pH4.5) in the MES solution of 50ul 0.1mol/L, adds the anti-tag molecule (100nmol/ml) of 10ul synthesis.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from Pierce Chemical company) working fluid.The EDC working fluid of 2.5ul is added, constant-temperature incubation 30 minutes, then the EDC working fluid adding 2.5ul in microsphere suspensions, then constant-temperature incubation 30 minutes.After reaction terminates, the Tween-20 washing with 0.02% once, then is washed once with the SDS liquid of 0.1%.The microballoon being coated with anti-tag sequence after washing is resuspended in the Tris-EDTA solution [10mmol/L Tris(pH8.0)] of 100ul, in 1mmol/L EDTA, 2-8 DEG C keeps in Dark Place.

Three, the primer of the target sequence containing mutational site is amplified

For NKX3.1 gene four kinds of Common genes type C95T, G189A, A49G and G133A, design of amplification primers, to (see table 3), amplifies 4 target sequences containing 4 mutational sites.

Table 3 amplifies the primer of the target sequence with mutational site

All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every bar primer after synthesis is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer.

Embodiment 2 uses the formula of the described various solution of the detection of NKX3.1 gene mutation detection liquid-phase chip to sample described in embodiment 1 as follows:

The MES damping fluid (pH5.0) formula (250ml) of 50mM:

2 × Tm hybridization buffer

4 DEG C are stored in after filtration.

ExoSAP-IT test kit purchased from American USB company.

Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

One, the DNA extraction of sample:

With reference to " molecular cloning " about the methods involving of DNA extraction, obtain DNA to be detected.

Two, the pcr amplification of testing sample

Design 4 pairs of primers, multiplex PCR one step amplifies the target sequence that 4 contain NKX3.1 gene four kinds of Common genes type C95T and G189A, A49G and G133A respectively, product size is respectively 365bp, 399bp, 160bp, 257bp, and primer sequence (SEQ ID NO.25-32) is shown in shown in above-mentioned table 3.

First multiple PCR primer working fluid is prepared: the primer stock solution 100ul respectively getting SEQ ID NO.25-32 respectively, in 1.5ml Eppendorf tube, mixes and is multiple PCR primer working fluid.Multi-PRC reaction system is as follows:

Pcr amplification program is: 95 DEG C of 3min; 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 40s, 30 circulations; 72 DEG C of 10min; 4 DEG C save backup.

Three, the enzyme of PCR primer cuts process

1. get the reacted product of 7.5ul PCR, add 1ul 10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;

Hatch 15min for 2.37 DEG C, hatch 15min for 80 DEG C, the enzyme that deactivation is unnecessary.Product after enzyme cuts process is directly used in follow-up ASPE primer extension reaction.

Four, site-specific primer extension reaction (ASPE)

Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thus make biotin labelings multiple on reacted product band.

First the ASPE primer working fluid of mixing is prepared: get the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul respectively in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:

Response procedures is: 96 DEG C of 2min; 94 DEG C of 30s, 54 DEG C of 1min, 72 DEG C of 2min, 30 circulations; 4 DEG C save backup.

Five, hybridization

1., according to the ASPE primer of design, the microballoon (as described in Example 1) of the corresponding 8 kinds of bag quilts of every group selection, often kind of microballoon concentration is 2.5 × 10 ⁵individual/ml;

2. get 1ul respectively and often plant the microballoon of numbering in the Eppendorf tube of 1.5ml;

3. microballoon is in >=centrifugal the 1-2min of 10000g;

4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;

5. get the above-mentioned microsphere suspensions of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul ₂o;

6. the ASPE reaction solution getting 5-25ul, in corresponding hole, uses ddH ₂o complements to 50ul;

7. encase 96 orifice plates with lucifuge with masking foil, 95 DEG C of 60s, 37 DEG C of 15min hatch hybridization;

8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;

9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;

10. microballoon is in >=centrifugal the 2-5min of 3000g;

Microballoon is resuspended in 1 × Tm hybridization buffer of 75ul by 11., adds the SA-PE (SA-PE) that 15ul concentration is 10ug/ml;

Hatch 15min for 12.37 DEG C, detect on Luminex instrument.

Six, result detects and data analysis

Reaction after product is detected by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.

Following requirement is had to fluorescent value (MFI) and data processing:

1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;

2.NET MFI=sample MFI-PCR negative control MFI(NET MFI is less than 0 represent with 0);

3. meet the data of above two conditions, by following formulae discovery sudden change ratio:

Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)

4. rule of thumb to the sudden change ratio definite threshold (cut-off value) of each detection site, to divide wild-type homozygote, heterozygote and saltant type homozygote.

Use present method to detect 20 increments NKX3.1 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.Detect with sequencing and compare with liquid-phase chip result, calculate the identical rate of classifying method detected result provided by the present invention.Present method detect 20 increments this NKX3.1 genotype call results and the sequencing result rate of coincideing reach 100%.Visible NKX3.1 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of NKX3.1 exactly, and result is reliable and stable.

One of table 4 pattern detection result (MFI)

Table 5 sample NKX3.1 transgenation ratio (%)

Table 6 sample NKX3.1 gene mutation type analytical results

Catalogue number(Cat.No.)	Liquid-phase chip detected result	Sequencing result
			1	Wild-type	Wild-type
2	Wild-type	Wild-type
			3	133AA	133AA
4	Wild-type	Wild-type
			5	Wild-type	Wild-type
6	Wild-type	Wild-type
			7	Wild-type	Wild-type
8	Wild-type	Wild-type
			9	Wild-type	Wild-type
10	95TT	95TT
			11	Wild-type	Wild-type
12	Wild-type	Wild-type
			13	Wild-type	Wild-type
14	Wild-type	Wild-type
			15	189AA	189AA
16	Wild-type	Wild-type
			17	Wild-type	Wild-type
18	Wild-type	Wild-type
			19	49AG	49AG
20	Wild-type	Wild-type

The liquid-phase chip of the ASPE primer that embodiment 3 is different is to the detection of NKX3.1 gene SNP site

5 one, the design (selection of Tag sequence and Anti-Tag sequence) prepared of liquid-phase chip

Liquid-phase chip is detected for NKX3.1 gene C 95T, G189A, A49G and G133A site mutation, respectively for the specific primer sequence that wild-type and the saltant type design ASPE primer 3 ' of C95T, G189A, A49G and G133A are held, the Tag sequence that ASPE primer 5 ' is held then is selected from SEQ ID NO.1-SEQ ID NO.8, accordingly, be coated in and microballoon is selected from SEQ ID NO.17-SEQ ID NO.24 with the anti-tag sequence that corresponding tag complementary matches.Specific design is as shown in following table (table 7).The synthesis of ASPE primer, anti-tag sequence bag by microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.

Design prepared by table 7 liquid-phase chip

One, sample detection

Adopt liquid-phase chip prepared by above-mentioned design, detect sample 21-40 by testing process described in embodiment 2 and method, detected result is as follows:

Table 8 sample NKX3.1 gene C 95T detected result and Polymorphism Analysis

Table 9 sample NKX3.1 gene G189A detected result and Polymorphism Analysis

Table 10 sample NKX3.1 Gene A 49G detected result and Polymorphism Analysis

Table 11 sample NKX3.1 gene G133A detected result and Polymorphism Analysis

From above-described embodiment, other is for the liquid-phase chip in different mutational site, and ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And ASPE primer is when selecting that in embodiment 1, tag sequence and specific primer sequence are arranged in pairs or groups, effect better (signal to noise ratio is better), see the present embodiment test group 1, test group 5, test group 8 and test group 12.Other different tag sequence and specific primer sequence are arranged in pairs or groups, and with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.The selection of embodiment 4NKX3.1 detection in Gene Mutation specific primer sequence

One, the design (selection of wild-type and saltant type specific primer sequence) prepared of liquid-phase chip

Liquid-phase chip is detected for the pleomorphism site of NKX3.1 Gene A 49G and G133A, with the complementary sequence forward or backwards of this place, mutational site target sequence for template, respectively for the specific primer sequence that wild-type and the saltant type design ASPE primer 3 ' of A49G and G133A are held, comprise preferred specific primer sequence in the embodiment of the present invention 1 and 2 alternative specific primer sequences, as shown in table 12.Wherein, interior base is pleomorphism site.

Table 12 specific primer sequence

Liquid-phase chip is detected for the pleomorphism site of NKX3.1 Gene A 49G and G133A, different specific primer sequences is selected for A49G and G133A, the tag sequence that ASPE primer 5 ' is held then is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence corresponded, specific design is as shown in following table (table 13).The synthesis of ASPE primer, anti-tag sequence bag by microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.

Design two prepared by table 13 liquid-phase chip

Two, sample detection

Adopt liquid-phase chip prepared by above-mentioned design, detect sample 41-60 by testing process described in embodiment 2 and method, detected result is as follows:

Table 14 sample NKX3.1 Gene A 49G detected result and Polymorphism Analysis

Table 15 sample NKX3.1 gene G139T detected result and Polymorphism Analysis

From the present embodiment, when ASPE primer selects that in embodiment 1, specific primer sequence and tag sequence are arranged in pairs or groups, effect better (signal to noise ratio is better), see the present embodiment test group 13 and test group 16.Other derives from the different specific primer sequence of the complementary sequence forward or backwards of place, target detect site sequence and tag sequence is arranged in pairs or groups, with coming to the same thing of embodiment 2 and the present embodiment, namely be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.

Other multiple specific primer sequence for different SNP site and tag sequence are arranged in pairs or groups, and with coming to the same thing of embodiment 2 and the present embodiment, the Auele Specific Primer namely selected by embodiment 1, has better signal to noise ratio, and Detection results is also better, and concrete data are omitted.

The above embodiment only have expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but therefore can not be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.

Claims

1. a NKX3.1 gene mutation detection liquid-phase chip, it is characterized in that, include: (A). the wild-type designed respectively for the different mutational site of NKX3.1 gene and the ASPE primer pair of saltant type: every bar ASPE primer holds the specific primer sequence for goal gene mutational site to form by 5 ' the tag sequence of holding and 3 ', described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C95T site, and the SEQ ID NO.11 be selected from for G189A site and SEQ ID NO.12, for SEQ ID NO.13 and the SEQ ID NO.14 in A49G site, with at least one group in the SEQ ID NO.15 in G133A site and SEQ ID NO.16, described tag sequence is selected from SEQ ID NO.1 ~ SEQ ID NO.8,

(C). for amplifying the primer needing that detect, that there is corresponding mutational site target sequence,

Described amplimer is: for SEQ ID NO.25 and the SEQ ID NO.26 in C95T site, and the SEQ ID NO.27 be selected from for G189A site and SEQ ID NO.28, for SEQ ID NO.29 and the SEQ ID NO.30 in A49G site, with at least one in the SEQ ID NO.31 in G133A site and SEQ ID NO.32.

2. NKX3.1 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described ASPE primer is: for the sequence be made up of SEQ ID NO.1 and SEQ ID NO.9 in C95T site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.10, and be selected from for the sequence be made up of SEQ ID NO.3 and SEQ ID NO.11 in G189A site and the sequence that is made up of SEQ ID NO.4 and SEQ ID NO.12, for the sequence be made up of SEQ ID NO.5 and SEQ ID NO.13 in A49G site and the sequence that is made up of SEQ ID NO.6 and SEQ ID NO.14, with at least one group in the sequence be made up of SEQ ID NO.7 and SEQ ID NO.15 for G133A site and the sequence that is made up of SEQ ID NO.8 and SEQ ID NO.16.

3. NKX3.1 gene mutation detection liquid-phase chip according to claim 1, is characterized in that, described spacerarm is 5-10 T.

4. for the Auele Specific Primer of NKX3.1 detection in Gene Mutation, it is characterized in that, described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C95T site, and the SEQ ID NO.11 be selected from for G189A site and SEQ ID NO.12, for SEQ ID NO.13 and the SEQ ID NO.14 in A49G site, at least one group in the SEQ ID NO.15 in G133A site and SEQ ID NO.16.