CN103451266A

CN103451266A - NKX3.1 gene mutation detection specific primers and liquid chip

Info

Publication number: CN103451266A
Application number: CN2012101774871A
Authority: CN
Inventors: 许嘉森; 何嘉英
Original assignee: Surexam Bio Tech Co Ltd
Current assignee: Surexam Bio Tech Co Ltd
Priority date: 2012-05-31
Filing date: 2012-05-31
Publication date: 2013-12-18
Anticipated expiration: 2032-05-31
Also published as: CN103451266B

Abstract

The invention discloses an NKX3.1 (the human NK-3 prostate specific gene) gene mutation detection liquid chip and specific primers. The liquid chip mainly comprises the following parts: each ASPE primer contains a tag sequence at the 5' terminal and a specific primer sequence aiming at target gene mutation locus at the 3' terminal, and the specific primer sequences are as below: a SEQ ID NO.9 and a SEQ ID NO.10 aiming at a C95T locus, a SEQ ID NO.11 and a SEQ ID NO.12 aiming at a G189A locus, a SEQ ID NO.13 and a SEQ ID NO.14 aiming at an A49G locus, and / or a SEQ ID NO.15 and a SEQ ID NO.16 aiming at a G133A locus; microballoons coated with anti-tag sequences; and amplification primers. The detection results from the detection liquid chip provided by the invention are 100% identical with those from a sequencing method, so as to realize parallel detection on wild types and mutants of a plurality of mutation loci.

Description

NKX3.1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Technical field

The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of NKX3.1 detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.

Background technology

The NKX3.1 English name is the human NK-3 prostate specific gene 1, is positioned on No. 8 chromosome 8ps 21, and be the member of homeodomain protein NK family, and the NK-3 albumen of Drosophila have close ties.The NKX3.1 gene is comprised of 2 exons, and this gene pairs prostate epithelial cell is being brought into play inhibition and the differentiation effect strengthened.NKX3.1 is the hox genes that prostate-specific is expressed, regulated by male sex hormone, in prostate gland fetal development, epithelium differentiation and tumor development, plays an important role.In embryo's forming process, the expression of NKX3.1 can be used as the important symbol of prostatic epithelium differentiation.NKX3.1 has high-caliber expression on the prostate gland of growing up, and at testis and several other tissue, is bringing into play low expression level.With it the carcinoma of prostate patient, found the disappearance that NKX3.1 expresses, the NKX3.1 gene is being brought into play keying action aspect the propagation of prostatic function and adjusting prostate epithelial cell.

At present, the NKX3.1 detection method of gene mutation mainly contains: Illumina optical fiber superbead chip technology, ground substance assistant laser desorption ionization time-of-fight mass spectrometry technology (MALDI-TOF-MS) and fluorescent quantitative PCR technique, although Illumina optical fiber superbead chip technology is the high throughput testing system of highly sensitive and accuracy, but level of automation is low, manual operations is many, be difficult to meet the needs of practical application, fluorescent quantitative PCR technique exists sensitivity low, sample easily pollutes, the shortcoming that false positive rate is high, ground substance assistant laser desorption ionization time-of-fight mass spectrometry technology is a kind of soft ionization technology, powerful and ripe function is arranged in the detection of protein and other, but in the detection of nucleic acids field, singularity due to nucleic acid molecule itself, detection is subject to certain restrictions.

The NKX3.1 gene mutation site of target detect of the present invention, it is as shown in the table:

Sequence number	The content of NKX3.1 gene point mutation	Write a Chinese character in simplified form
			1	C → T sudden change, occur in the 95th Nucleotide of SEQ ID NO.41	C95T
2	G → A sudden change, occur in the 189th Nucleotide of SEQ ID NO.42	G189A
			3	A → G sudden change, occur in the 49th Nucleotide of SEQ ID NO.43	A49G
6	G → A sudden change, occur in the 133rd Nucleotide of SEQ ID NO.44	G133A

SEQ ID NO.41 mutational site: C95T

AGTAAGGATGCCTGTTTGCTATCAAATTACTCTAACAGCATTATTTCCTTTGACTCTATTTA ACAGTCATGTGAAGCAAACCCTTTCTGTAGAT

GTGCAAATTTAACTCAATCTGCATTGGGCTGGACATTGTGATAAATTACTAGGGATCTACTTGAATGACACTTTACATGCAAACTTTATTTTTACATTTTAATATATTCAAACTTATATGGTTAGGAGAGGAGTGTGACAGCTTCAAAAATAGAAGAAAAATCATTAAATGTTGACTGGTAGAGCTGGAAGAGATCTCAGCAACTACTTTATAGATGAGGAAACTAAGACATAGAGAAGTGGATAACTTTCCAACATCATACAGCCTTTG。

SEQ ID NO.42 mutational site: G189A

CATTGAGAGTCCTTGACCGCAACAGAAAAACCTGAGGACTCAAGGCCAATGCCCAAGCTTCAGCGGCTTTGGTCTAAGACTACAAAAACATCACCAGCCTGGAAACTGGTAATACCTAAGTGCTAGGAGCTTCCTTGGGTTTTTGCATAGTCTCTAGCACATCCAGTGATCCATTCAGGGTTTCGTGT

TATCCATAACAATGGAACTCCATGGTCATTTCACAATCTTTAGGTAGGGTCCAACGTCTGAGGGCAAATTGTCCTGCATGACTCCCTCTCACATTTCCCCTCAAGCTCACAAATGAGTAAAATCTGGATAAATTACACATGAAGGGGGTTATGGTTAACGAGACTGAGAGGCAGTCATACTGGGAAGAGCAGCCAGGAGAAAAGAATGTT。

SEQ ID NO.43 mutational site: A49G

AGGCGGAAAGTGAAAGCGGTGCGGGCCGGGCGGGTGCATTCAGGCCAA

GCGGGGCCGCCGGGATGCTCAGGGTTCCGGAGCCGCGGCCCGGGGAGGCGAAAGCGGAGGGGGCCGCGCCGCCGACCCCGTCCAAGCCGCTCACGTCCTTCCTCATCCAGG。

SEQ ID NO.44 mutational site: G133A

GCAGAACAGAATCCTTGGGTGTACAACTCATCCAAAATCATACAAAGTGCTGGAAAATACCACTTGATTTTCCCTCTCTCCCCTTCAAACAGGTAGCCAGAAGCAAAAAAAATGACCTACAGTATGCACTGG

GGAATGACTTAGGTATTAAAACTTTCACTGTCTCTGTTGTTTCATTGTCTCACCAGTGAAGAATCTGAGATTTCCACGCAAATCTCCAATAGCTTTGGTGTGCACACCTCTTGCTCCCTGACCT。

Summary of the invention

One of purpose of the present invention is to provide the NKX3.1 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the saltant type of parallel detection NKX3.1 gene four kinds of common genotype C95T, G189A, A49G and G133A.

The technical scheme that realizes above-mentioned purpose is as follows:

A kind of NKX3.1 gene mutation detection liquid-phase chip, including: (A). the wild-type designed respectively for the different mutational sites of NKX3.1 gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for the goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C95T site, SEQ ID NO.11 and SEQ ID NO.12 for the G189A site, SEQ ID NO.13 and SEQ ID NO.14 for the A49G site, and/or for SEQ ID NO.15 and the SEQ ID NO.16 in G133A site, described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.8,

(B). that the anti-tag sequence is coated with, as to have different colours coding microballoon is arranged, in the middle of described anti-tag sequence is connected with microballoon, also be provided with the spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.17～SEQ ID NO.24, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;

(C). for amplifying the primer that needs target sequence detection, that there is corresponding mutational site.

Therein in some embodiment, described amplimer is: for SEQ ID NO.25 and the SEQ ID NO.26 in C95T site, SEQ ID NO.27 and SEQ ID NO.28 for the G189A site, for SEQ ID NO.29 and the SEQ ID NO.30 in A49G site, and/or for SEQ ID NO.31 and the SEQ ID NO.32 in G133A site.

Therein in some embodiment, described ASPE primer is: for the sequence be comprised of SEQ ID NO.1 and SEQ ID NO.9 in C95T site and the sequence be comprised of SEQ ID NO.2 and SEQ ID NO.10, for the sequence formed by SEQ ID NO.3 and SEQ ID NO.11 in G189A site and the sequence formed by SEQ ID NO.4 and SEQ ID NO.12, for the sequence formed by SEQ ID NO.5 and SEQ ID NO.13 in A49G site and the sequence formed by SEQ ID NO.6 and SEQ ID NO.14, and/or for the sequence formed by SEQ ID NO.7 and SEQ ID NO.15 in G133A site and the sequence formed by SEQ ID NO.8 and SEQ ID NO.16.

Another object of the present invention is to provide the Auele Specific Primer for the NKX3.1 detection in Gene Mutation.

Concrete technical scheme is as follows:

Auele Specific Primer for the NKX3.1 detection in Gene Mutation, described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C95T site, SEQ ID NO.11 and SEQ ID NO.12 for the G189A site, for SEQ ID NO.13 and the SEQ ID NO.14 in A49G site, and/or for SEQ ID NO.15 and the SEQ ID NO.16 in G133A site.

Major advantage of the present invention is:

1. the identical rate of the detected result of NKX3.1 gene mutation detection liquid-phase chip provided by the present invention and sequencing is up to 100%, and detects the needed time well below sequencing technologies commonly used, and realistic especially application needs.Prepared NKX3.1 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and basically there do not is cross reaction between designed probe and anti-tag sequence, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in a plurality of mutational sites.

2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, between the pcr amplification product of Auele Specific Primer and non-target detect, basically do not have cross reaction, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, also the sudden change situation in a plurality of mutational sites of parallel detection simultaneously, detect effect consistent.

3. detection method step of the present invention is simple, 4 kinds of mutational sites are detected and can be completed the amplification of 4 target sequences that contain mutational site by a step PCR, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR have been avoided, thereby can greatly improve Detection accuracy, embodied accurate while qualitative and quantitative analysis feature.

4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the defect that the repeatability of detected result is poor is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detected improves greatly, thereby makes the sensitivity of detection be further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.

Embodiment

Embodiment 1NKX3.1 gene mutation detection liquid-phase chip mainly includes:

One, ASPE primer

Wild-type and saltant type for NKX3.1 gene four kinds of common genotype C95T, G189A, A49G and G133A, design respectively specific primer sequence.The ASPE primer is comprised of " tag sequence+specific primer sequence ".The ASPE primer sequence is as shown in the table:

The ASPE primer sequence (tag sequence+specific primer sequence) of table 1NKX3.1 gene

Every the ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.

Two, the coated microballoon of anti-tag sequence

According to designed ASPE Auele Specific Primer fragment, select the tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 8 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:

Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon

8 kinds of microballoons selecting, purchased from U.S. Luminex company, are coated in the anti-tag sequence on microballoon.Be connected with the spacerarm sequence of 5-10 T between anti-tag sequence and microballoon, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, the anti-tag sequence is synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By synthetic anti-tag sequence sterilizing ddH ₂o is made into the stock solution of 100nmol/ml.Described spacerarm is for for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in to the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) disturb, can also use poly(TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:

Get respectively 5 * 10 ⁶the carboxylated microballoon of individual above-mentioned numbering (purchased from Luminex company) is suspended in the MES solution of 50ul 0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from Pierce Chemical company) working fluid.Toward the EDC working fluid that adds 2.5ul in the microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The microballoon that is coated with the anti-tag sequence after washing is resuspended in to the Tris-EDTA solution [10mmol/L Tris(pH8.0)] of 100ul, in 1mmol/L EDTA, 2-8 ℃ keeps in Dark Place.

Three, amplify the primer of the target sequence that contains mutational site

For NKX3.1 gene four kinds of common genotype C95T, G189A, A49G and G133A, design of amplification primers, to (in Table 3), amplifies 4 target sequences that contain 4 mutational sites.

Table 3 amplifies the primer of the target sequence with mutational site

All primers are synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.

Embodiment 2 uses the described NKX3.1 gene mutation detection liquid-phase chip of embodiment 1 as follows to the formula of the described various solution of detection of sample:

MES damping fluid (pH5.0) formula (250ml) of 50mM:

2 * Tm hybridization buffer

Be stored in 4 ℃ after filtration.

The ExoSAP-IT test kit is purchased from U.S. USB company.

Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

One, the DNA extraction of sample:

Methods involving with reference to " molecular cloning " about DNA extraction, obtain DNA to be detected.

Two, the pcr amplification of testing sample

Design 4 pairs of primers, multiplex PCR one step amplifies 4 target sequences that contain respectively four kinds of common genotype C95T of NKX3.1 gene and G189A, A49G and G133A, the product size is respectively 365bp, 399bp, 160bp, 257bp, and primer sequence (SEQ ID NO.25-32) is shown in shown in above-mentioned table 3.

At first prepare the multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.25-32 in the 1.5ml Eppendorf tube, mix and be the multiple PCR primer working fluid.The multi-PRC reaction system is as follows:

The pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.

Three, the enzyme of PCR product is cut processing

1. get the reacted product of 7.5ul PCR, add 1ul 10 * SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;

2.37 ℃ hatch 15min, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.The product that enzyme is cut after processing is directly used in follow-up ASPE primer extension reaction.

Four, site-specific primer extension reaction (ASPE)

Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, mix biotin labeled dCTP in reaction process, thereby make a plurality of biotin labeling on reacted product band.

At first the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in the 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:

Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.

Five, hybridization

According to the design the ASPE primer, the corresponding 8 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 * 10 ⁵individual/ml;

2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;

3. microballoon is in >=centrifugal the 1-2min of 10000g;

4. supernatant discarded, microballoon is resuspended in 2 * Tm hybridization buffer of 100ul, and vortex mixes;

5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul ₂o;

6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH ₂o complements to 50ul;

7. encase 96 orifice plates with lucifuge with masking foil, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;

8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;

9. remove supernatant, microballoon is resuspended in 1 * Tm hybridization buffer of 75ul;

10. microballoon is in >=centrifugal the 2-5min of 3000g;

11. microballoon is resuspended in 1 * Tm hybridization buffer of 75ul, adds the SA-PE (SA-PE) that 15ul concentration is 10ug/ml;

12.37 ℃ hatch 15min, detect on the Luminex instrument.

Six, result detects and data analysis

The reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.

Fluorescent value (MFI) and data processing are had to following requirement:

1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 * PCR negative control MFI;

2.NET MFI=sample MFI-PCR negative control MFI(NET MFI be less than 0 with 0 expression);

3. meet the data of above two conditions, by following formula, calculate sudden change ratio:

Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)

4. rule of thumb to the sudden change ratio definite threshold (cut-off value) of each detection site, to divide wild-type homozygote, heterozygote and saltant type homozygote.

Use present method to detect 20 increments NKX3.1 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: the sudden change ratio range is considered as the wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as the anomaly homozygote.Detect with the liquid-phase chip result and compare with sequencing, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments NKX3.1 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible NKX3.1 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of NKX3.1 exactly, and result is reliable and stable.

One of table 4 pattern detection result (MFI)

Table 5 sample NKX3.1 transgenation ratio (%)

Table 6 sample NKX3.1 gene mutation type analytical results

Catalogue number(Cat.No.)	The liquid-phase chip detected result	Sequencing result
			1	Wild-type	Wild-type
2	Wild-type	Wild-type
			3	133AA	133AA
4	Wild-type	Wild-type
			5	Wild-type	Wild-type
6	Wild-type	Wild-type
			7	Wild-type	Wild-type
8	Wild-type	Wild-type
			9	Wild-type	Wild-type
10	95TT	95TT
			11	Wild-type	Wild-type
12	Wild-type	Wild-type
			13	Wild-type	Wild-type
14	Wild-type	Wild-type
			15	189AA	189AA
16	Wild-type	Wild-type
			17	Wild-type	Wild-type
18	Wild-type	Wild-type
			19	49AG	49AG
20	Wild-type	Wild-type

The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to the NKX3.1 gene SNP site

5 one, the design that prepared by liquid-phase chip (selection of Tag sequence and Anti-Tag sequence)

Take NKX3.1 gene C 95T, G189A, A49G and G133A site mutation, to detect liquid-phase chip be example, respectively for the wild-type of C95T, G189A, A49G and G133A and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ ID NO.1-SEQ ID NO.8, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing be coated on microballoon is selected from SEQ ID NO.17-SEQ ID NO.24.Specific design is as shown in following table (table 7).Synthetic, the coated microballoon of anti-tag sequence of ASPE primer, amplimer, detection method are described like embodiment 1 and embodiment 2.

Design prepared by table 7 liquid-phase chip

One, sample detection

The liquid-phase chip that adopts above-mentioned design to prepare, detected sample 21-40 by the described testing process of embodiment 2 and method, and detected result is as follows:

Table 8 sample NKX3.1 gene C 95T detected result and Polymorphism Analysis

Table 9 sample NKX3.1 gene G189A detected result and Polymorphism Analysis

Table 10 sample NKX3.1 Gene A 49G detected result and Polymorphism Analysis

Table 11 sample NKX3.1 gene G133A detected result and Polymorphism Analysis

From above-described embodiment, other is for the liquid-phase chip in different mutational sites, and the ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And the ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1, test group 5, test group 8 and test group 12.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.The selection of embodiment 4NKX3.1 detection in Gene Mutation specific primer sequence

One, the design that prepared by liquid-phase chip (selection of wild-type and saltant type specific primer sequence)

It is example that the pleomorphism site of NKX3.1 Gene A 49G and G133A of take detects liquid-phase chip, the complementary sequence forward or backwards of this place, mutational site target sequence of take is template, respectively for the wild-type of A49G and G133A and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 12.Wherein,

interior base is pleomorphism site.

Table 12 specific primer sequence

It is example that the pleomorphism site of NKX3.1 Gene A 49G and G133A of take detects liquid-phase chip, select different specific primer sequences for A49G and G133A, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 13).Synthetic, the coated microballoon of anti-tag sequence of ASPE primer, amplimer, detection method are described like embodiment 1 and embodiment 2.

Two of design prepared by table 13 liquid-phase chip

Two, sample detection

The liquid-phase chip that adopts above-mentioned design to prepare, detected sample 41-60 by the described testing process of embodiment 2 and method, and detected result is as follows:

Table 14 sample NKX3.1 Gene A 49G detected result and Polymorphism Analysis

Table 15 sample NKX3.1 gene G139T detected result and Polymorphism Analysis

From the present embodiment, when the ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 13 and test group 16.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.

Other multiple specific primer sequence for different SNP sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, have better signal to noise ratio, detects effect also better, and concrete data are omitted.

The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.

Claims

1. a NKX3.1 gene mutation detection liquid-phase chip, it is characterized in that, including: (A). the wild-type designed respectively for the different mutational sites of NKX3.1 gene and the ASPE primer pair of saltant type: every ASPE primer holds the specific primer sequence for the goal gene mutational site to form by the tag sequence and 3 ' of 5 ' end, described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C95T site, SEQ ID NO.11 and SEQ ID NO.12 for the G189A site, SEQ ID NO.13 and SEQ ID NO.14 for the A49G site, and/or for SEQ ID NO.15 and the SEQ ID NO.16 in G133A site, described tag sequence is selected from SEQ ID NO.1～SEQ ID NO.8,

2. NKX3.1 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described amplimer is: for SEQ ID NO.25 and the SEQ ID NO.26 in C95T site, SEQ ID NO.27 and SEQ ID NO.28 for the G189A site, for SEQ ID NO.29 and the SEQ ID NO.30 in A49G site, and/or for SEQ ID NO.31 and the SEQ ID NO.32 in G133A site.

3. NKX3.1 gene mutation detection liquid-phase chip according to claim 1 and 2, it is characterized in that, described ASPE primer is: for the sequence be comprised of SEQ ID NO.1 and SEQ ID NO.9 in C95T site and the sequence be comprised of SEQ ID NO.2 and SEQ ID NO.10, for the sequence formed by SEQ ID NO.3 and SEQ ID NO.11 in G189A site and the sequence formed by SEQ ID NO.4 and SEQ ID NO.12, for the sequence formed by SEQ ID NO.5 and SEQ ID NO.13 in A49G site and the sequence formed by SEQ ID NO.6 and SEQ ID NO.14, and/or for the sequence formed by SEQ ID NO.7 and SEQ ID NO.15 in G133A site and the sequence formed by SEQ ID NO.8 and SEQ ID NO.16.

4. NKX3.1 gene mutation detection liquid-phase chip according to claim 1, is characterized in that, described spacerarm is 5-10 T.

5. for the Auele Specific Primer of NKX3.1 detection in Gene Mutation, it is characterized in that, described specific primer sequence is: for SEQ ID NO.9 and the SEQ ID NO.10 in C95T site, SEQ ID NO.11 and SEQ ID NO.12 for the G189A site, for SEQ ID NO.13 and the SEQ ID NO.14 in A49G site, and/or for SEQ ID NO.15 and the SEQ ID NO.16 in G133A site.