CN103571924B - Specific detection primers and liquid phase chip for IKZF1 gene mutation - Google Patents

Specific detection primers and liquid phase chip for IKZF1 gene mutation Download PDF

Info

Publication number
CN103571924B
CN103571924B CN201210250295.9A CN201210250295A CN103571924B CN 103571924 B CN103571924 B CN 103571924B CN 201210250295 A CN201210250295 A CN 201210250295A CN 103571924 B CN103571924 B CN 103571924B
Authority
CN
China
Prior art keywords
seq
site
sequence
primer
ikzf1
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201210250295.9A
Other languages
Chinese (zh)
Other versions
CN103571924A (en
Inventor
许嘉森
刘志明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Surexam Bio Tech Co Ltd
Original Assignee
Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Surexam Bio Tech Co Ltd filed Critical Surexam Bio Tech Co Ltd
Priority to CN201210250295.9A priority Critical patent/CN103571924B/en
Publication of CN103571924A publication Critical patent/CN103571924A/en
Application granted granted Critical
Publication of CN103571924B publication Critical patent/CN103571924B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention discloses a detection liquid phase chip and specific primers for IKZF1 gene mutation. The liquid phase chip mainly comprises: ASPE primers comprising a 5' terminal tag sequence and a 3' terminal target gene mutational site-targeted specific primer sequence, wherein the specific primer sequence comprises T136G site-targeted SEQ ID NO.7, T136G site-targeted SEQ ID NO.8, G75C site-targeted SEQ ID NO.9, G75C site-targeted SEQ ID NO.10, and/or T107C site-targeted SEQ ID NO.11 and T107C site-targeted SEQ ID NO.12; anti-tag sequence coated microspheres; and amplification primers. According to the present invention, coincidence frequency of the detection results of the detection liquid phase chip and the sequencing method is up to 100%, and single and parallel detection on the wild-type with multiple mutational sites and the mutant-type with multiple mutational sites can be achieved.

Description

IKZF1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, particularly relate to a kind of IKZF1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip.
Background technology
KZF1 gene claims Ikaros family zinc finger protein 1, and English name is karos family zinc finger1, is positioned on the galianconism of No. 7 karyomit(e) 7p12.2, and particular location is between No. 7 karyomit(e) 50344377 to 50367357 base pairs.IKZF1 belongs to zinc finger protein family member, is the gene of coding lymph transcription factor IKAROS, and is a kind of very important hematopoietic transcription regulatory factor, is especially that bematogenesis plays key regulating effect in pouring.The high risk factor of the change of IKZF1 gene in signal pathway and acute lymphoblastic leukemia is closely bound up, the acquired change of IKZF1 gene can cause acute lymphoblastic leukemia relapse rate to raise, and new foundation shows that the Genetic Variations of this gene can make acute lymphoblastic leukemia sickness rate raise.IKZF1 has vital role in normal lymphocytes or white corpuscle are grown, if developmental genetics changes, may affect the function of these genes, thus normal lymphocytes development pathway is obstructed, be transformed into cancer cell.Separately studies have found that, IKZF1 gene pleiomorphism and systemic lupus erythematosus susceptibility significant correlation.
At present, IKZF1 detection method of gene mutation mainly contains: Illumina optical fiber superbead chip technology and Affymetrix SNP6.0 chip technology, although Illumina optical fiber superbead chip technology is the high throughput testing system of highly sensitive and accuracy, but level of automation is low, manual operations is many, is difficult to the needs meeting practical application.Although high-throughput makes Affymetrix SNP6.0 chip technology comparative maturity, but this chip technology in low-density clinical diagnosis cake core improper, be difficult to expansion in same reaction system and detect the relevant SNP of numerous biological character or Tag SNP, in addition, Affymetrix SNP6.0 chip is mainly stronger on chip of expression spectrum, and species are more, relatively weak in SNP chip, and detect expensive, can not actual needs be met.
The IKZF1 gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number The content of IKZF1 gene point mutation Write a Chinese character in simplified form
1 , there is T → G sudden change in the 136th Nucleotide of SEQ ID NO.33 T136G
2 , there is G → C sudden change in the 75th Nucleotide of SEQ ID NO.34 G75C
3 , there is T → C sudden change in the 107th Nucleotide of SEQ ID NO.35 T107C
SEQ ID NO.33 mutational site: T136GCAGAAGGGTGTGGCATTTGGAAACGGGAATAAACAAAATTGCTGCACCAAT GCACTGAGTGAAGGAAGAGAGACAGAGGATCAAGGGCTTTAGACAGCACTCCTTCA ATATGCAATCACAGAGAAAGATGCGCCTTATCCAAGTTAATATCTCTAAGGTGAGA GCCTTCTTAGAGTCAGTTTGTTGCAAATTTCACCTACTCTGTTCTTTTCCATCCAT CCCCCTGAGTCAGTTGGTTGAAGGGAGTTATTTTTTCAAGTGGAATTCAAACAAAG CTCAAACCAGAACTGTAAATAGTGATTGCAGGAATTCTTTTCTAAACTGCTTTGCC CTTTC
SEQ ID NO.34 mutational site: G75C
TCACATTGGGATTAGGGTTTCAACCCATGAATTTTGGTGGGGGATGCAAACATTCAGTTTATTGCACTGAACGTGTGTCTACTTGAAAAATTTAATGAGCTAGTGCATTATCTAAAAGAATCAAGTATTTATTTTAATAGGAATATGTTGTTAGTACAGCTCACCAGATACTGGGAGACGGAGGGTGTTAGAGAG
SEQ ID NO.35 mutational site: T107C
TTCAACACATCTGGACTGGGCAGAGGGACAGAACAGTGAGTAAGTGAGAATGGTCCCCATCCTTAGCAGCAGACAGCTACTAGGGGAGGGTAGGTAGAAGTTTATGTGTGATTGCATGGATAATTCCTTCCCATCTGAGAAATCCACGAAGACAAGGGGAGCGTGCCATGAGAGCATTACACAGGTTTCTGATCTTGTAAGAGTCAGCCAGATAAGGAGGGTTGATAAGGAGGGTTTTGTGTCCCAGTGTTGG
Summary of the invention
An object of the present invention is to provide IKZF1 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or parallel detection IKZF1 gene three kinds of Common genes type T136G, the wild-type of G75C and T107C and saltant type.
A kind of IKZF1 gene mutation detection liquid-phase chip, includes
(A). the ASPE primer pair of the wild-type designed respectively for IKZF1 gene mutation site and saltant type: every bar ASPE primer holds the specific primer sequence for goal gene mutational site to form by 5 ' the tag sequence of holding and 3 ', described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in T136G site, for SEQ ID NO.9 and the SEQID NO.10 in G75C site, and/or for the SEQ ID NO.11 in T107C site and SEQ ID NO.12; Described tag sequence is selected from SEQ IDNO.1 ~ SEQ ID NO.6;
(B). microballoon that have anti-tag sequence bag quilt, that have different colours coding, is also provided with spacer sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.13 ~ SEQ ID NO.18, and described anti-tag sequence can correspondingly be matched with selected tag complementary in (A);
(C). for amplifying the primer needing that detect, that there is corresponding mutational site target sequence.
Wherein in an embodiment, described amplimer is SEQ ID NO.19 for T136G site and SEQ ID NO.20, for SEQ ID NO.21 and the SEQ ID NO.22 in G75C site, and/or for the SEQ ID NO.23 in T107C site and SEQ ID NO.24.
Wherein in an embodiment, described ASPE primer is: for the sequence be made up of SEQ ID NO.1 and SEQ IDNO.7 in T136G site and the sequence that is made up of SEQ IDNO.2 and SEQ IDNO.8, for the sequence be made up of SEQ IDNO.3 and SEQ ID NO.9 in G75C site and the sequence that is made up of SEQ ID NO.4 and SEQ ID NO.10, and/or for the sequence be made up of SEQ ID NO.5 and SEQ ID NO.11 in T107C site and the sequence that is made up of SEQ ID NO.6 and SEQ ID NO.12.
Another object of the present invention is to provide the Auele Specific Primer for IKZF1 detection in Gene Mutation.
For the Auele Specific Primer of IKZF1 detection in Gene Mutation, described Auele Specific Primer is SEQ IDNO.7 for T136G site and SEQ ID NO.8, for SEQ ID NO.9 and the SEQ ID NO.10 in G75C site, and/or for the SEQ ID NO.11 in T107C site and SEQ ID NO.12.
Major advantage of the present invention is:
1. the detected result of IKZF1 gene mutation detection liquid-phase chip provided by the present invention and the identical rate of sequencing are up to 100%, and the time required for detecting is well below conventional sequencing technologies, and realistic especially application needs.Prepared IKZF1 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and substantially there is not cross reaction between designed probe and anti-tag sequence, choosing and the combination of tag sequence label and concrete ASPE primer of tag sequence label, anti-tag sequence label, can cross reaction be avoided, realize the parallel detection in multiple mutational site.
2. the present invention passes through the design experiences of contriver's long term accumulation and a large amount of experimental implementation, have chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention's design can the sensitive mutational site identifying target detect specifically, accurately distinguishes the genotype of various type; In same reaction system, substantially there is not cross reaction between different Auele Specific Primers, between the pcr amplification product that detects of Auele Specific Primer and non-targeted, detection specificity is good, and cross reacting rate is lower than 3%; Except Single locus catastrophe can be detected, also can the catastrophe in the simultaneously multiple mutational site of parallel detection, Detection results is consistent.
3. detection method step of the present invention is simple, the amplification that can complete 3 target sequences containing mutational site by One_step PCR is detected in 3 kinds of mutational sites, avoid the many uncertain factors existed in the complex operations processes such as repeated multiple times PCR, thus greatly can improve Detection accuracy, embody accurate qualitative and quantitative analysis feature simultaneously.
4. not only to overcome conventional solid chip susceptibility not high in the present invention, and the defect of the repeatability difference of detected result, improves existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detected improves greatly, thus the sensitivity detected is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1IKZF1 gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
For wild-type and the saltant type of IKZF1 gene three kinds of Common genes type T136G, G75C and T107C, design specific primer sequence respectively.ASPE primer is made up of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (tag sequence+specific primer sequence) of table 1IKZF1 gene
Every bar ASPE primer comprises two parts, and 5 ' end is for for the specificity tag sequence of anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer segments (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every bar primer after synthesis is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer.
Two, the microballoon of anti-tag sequence bag quilt
According to designed ASPE Auele Specific Primer fragment, select tag sequence.Tag sequence of the present invention is when choosing, avoid various tag sequence as far as possible, anti-tag sequence, cross reaction between specific primer sequence, between the anti-tag sequence reducing each microballoon to greatest extent and the tag sequence secondary structure that may be formed from different ASPE primer sequence, simultaneously, the primer in the various mutations site in detection system and the specific requirements of PCR primer parallel detection can also be met, thus realize parallel detection various mutations type in same reaction system, cross reaction is avoided in whole parallel detection system, and make the specificity of liquid-phase chip testing product of the present invention, reach between sensitivity and repeatability and optimize and balance, the genotype of the various type of accurate differentiation.The anti-tag sequence that the 6 kinds of microballoon numberings selected are corresponding on microballoon is as shown in table 2:
The anti-tag sequence that table 2 microballoon numbering is corresponding on microballoon
The 6 kinds of microballoon purchased from American Luminex companies selected, are coated in anti-tag sequence on microballoon.Be connected with the spacer sequence of 5-10 T between anti-tag sequence and microballoon, before each anti-tag sequence, namely add the spacer sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.By the anti-tag sequence sterilizing ddH of synthesis 2o is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in the sequence of hydrophilic environments.By arranging the spacer sequence of suitable length between anti-tag sequence and microballoon, can reduce sterically hindered, improving the efficiency of hybridization and the specificity of hybridization.Common spacer sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) interference, can also poly(TTG be used) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the process of microballoon bag quilt is as follows:
Get 5 × 10 respectively 6the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in (pH4.5) in the MES solution of 50ul0.1mol/L, adds the anti-tag molecule (100nmol/ml) of 10ul synthesis.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from Pierce Chemical company) working fluid.The EDC working fluid of 2.5ul is added, constant-temperature incubation 30 minutes, then the EDC working fluid adding 2.5ul in microsphere suspensions, then constant-temperature incubation 30 minutes.After reaction terminates, the Tween-20 washing with 0.02% once, then is washed once with the SDS liquid of 0.1%.The microballoon being coated with anti-tag sequence after washing is resuspended in the Tris-EDTA solution [10mmol/LTris(pH8.0)] of 100ul, in 1mmol/L EDTA, 2-8 DEG C keeps in Dark Place.
Three, the primer of the target sequence containing mutational site is amplified
For IKZF1 gene three kinds of Common genes type T136G, G75C and T107C, design of amplification primers, to (see table 3), amplifies 3 target sequences containing 3 mutational sites.
Table 3 amplifies the primer of the target sequence with mutational site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every bar primer after synthesis is mixed with the stock solution of 100pmol/mL respectively with 10mmol/L Tris Buffer.
Embodiment 2 uses IKZF1 gene mutation detection liquid-phase chip described in embodiment 1 to the detection of sample
The formula of described various solution is as follows:
The MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 × Tm hybridization buffer
4 DEG C are stored in after filtration.
ExoSAP-IT test kit purchased from American USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
With reference to " molecular cloning " about the methods involving of DNA extraction, obtain DNA to be detected.
Two, the pcr amplification of testing sample
Design 3 pairs of primers, multiplex PCR one step amplifies 3 respectively containing the target sequence of IKZF1 gene three kinds of Common genes type T136G, G75C and T107C, product size is respectively 336bp, 195bp, 253bp, and primer sequence (SEQ IDNO.19-24) is shown in shown in above-mentioned table 3.
First multiple PCR primer working fluid is prepared: the primer stock solution 100ul respectively getting SEQ ID NO.19-24 respectively, in 1.5ml Eppendorf tube, mixes and is multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 DEG C of 3min; 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 40s, 30 circulations; 72 DEG C of 10min; 4 DEG C save backup.
Three, the enzyme of PCR primer cuts process
1. get the reacted product of 7.5ul PCR, add 1ul10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 DEG C, hatch 15min for 80 DEG C, the enzyme that deactivation is unnecessary.Product after enzyme cuts process is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thus make biotin labelings multiple on reacted product band.
First the ASPE primer working fluid of mixing is prepared: get the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul respectively in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 DEG C of 2min; 94 DEG C of 30s, 54 DEG C of 1min, 72 DEG C of 2min, 30 circulations; 4 DEG C save backup.
Five, hybridization
1., according to the ASPE primer of design, the microballoon (as described in Example 1) of the corresponding 6 kinds of bag quilts of every group selection, often kind of microballoon concentration is 2.5 × 10 5individual/ml;
2. get 1ul respectively and often plant the microballoon of numbering in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microsphere suspensions of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul 2o;
6. the ASPE reaction solution getting 5-25ul, in corresponding hole, uses ddH 2o complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 DEG C of 60s, 37 DEG C of 15min hatch hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
Microballoon is resuspended in 1 × Tm hybridization buffer of 75ul by 11., adds the SA-PE (SA-PE) that 15ul concentration is 10ug/ml;
Hatch 15min for 12.37 DEG C, detect on Luminex instrument.
Six, result detects and data analysis
Reaction after product is detected by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Following requirement is had to fluorescent value (MFI) and data processing:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI(NET MFI is less than 0 represent with 0);
3. meet the data of above two conditions, by following formulae discovery sudden change ratio:
Sudden change ratio=saltant type NET MFI ÷ (saltant type NET MFI+ wild-type NET MFI)
4. rule of thumb to the sudden change ratio definite threshold (cut-off value) of each detection site, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments IKZF1 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.Detect with sequencing and compare with liquid-phase chip result, calculate the identical rate of classifying method detected result provided by the present invention.Present method detect 20 increments this IKZF1 genotype call results and the sequencing result rate of coincideing reach 100%.Visible IKZF1 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of IKZF1 exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Table 5 sample IKZF1 transgenation ratio (%)
Sample number T136G G75C T107C
1 1% 2% 2%
2 2% 2% 1%
3 2% 52% 1%
4 2% 1% 2%
5 1% 1% 2%
6 2% 2% 1%
7 2% 2% 2%
8 98% 2% 1%
9 2% 2% 2%
10 2% 2% 2%
11 2% 1% 2%
12 3% 2% 1%
13 2% 2% 2%
14 3% 1% 1%
15 2% 1% 3%
16 1% 3% 98%
17 2% 1% 2%
18 2% 2% 3%
19 1% 2% 2%
20 3% 3% 1%
Table 6 sample IKZF1 gene mutation type analytical results
The liquid-phase chip of the ASPE primer that embodiment 3 is different is to the detection of IKZF1 gene SNP site
One, the design (selection of Tag sequence and Anti-Tag sequence) prepared of liquid-phase chip
Liquid-phase chip is detected for IKZF1 gene T136G, G75C and T107C site mutation, respectively for the specific primer sequence that wild-type and the saltant type design ASPE primer 3 ' of T136G, G75C and T107C are held, the Tag sequence that ASPE primer 5 ' is held then is selected from SEQ ID NO.1-SEQ ID NO.6, accordingly, be coated in and microballoon is selected from SEQ ID NO.13-SEQ ID NO.18 with the anti-tag sequence that corresponding tag complementary matches.Specific design is as shown in following table (table 7).The synthesis of ASPE primer, anti-tag sequence bag by microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 7 liquid-phase chip
One, sample detection
Adopt liquid-phase chip prepared by above-mentioned design, detect sample 21-40 by testing process described in embodiment 2 and method, detected result is as follows:
Table 8 sample IKZF1 gene T136G detected result and Polymorphism Analysis
Table 9 sample IKZF1 gene G75C detected result and Polymorphism Analysis
Table 10 sample IKZF1 gene T107C detected result and Polymorphism Analysis
As can be seen from the present embodiment, for the liquid-phase chip in different mutational sites, the combination of Auele Specific Primer and the different Tag sequences in the present invention, its result is still reliable and stable, but when ASPE primer selects that in liquid-phase chip described in embodiment 1, tag sequence and specific primer sequence are arranged in pairs or groups, effect better (signal to noise ratio is better), see the present embodiment test group 1, test group 5 and test group 9.Other different tag sequence and specific primer sequence are arranged in pairs or groups, and with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4IKZF1 detection in Gene Mutation specific primer sequence
One, the design (selection of wild-type and saltant type specific primer sequence) prepared of liquid-phase chip
Liquid-phase chip is detected for the pleomorphism site of IKZF1 gene T136G and T107C, with the complementary sequence forward or backwards of this place, mutational site target sequence for template, respectively for the specific primer sequence that wild-type and the saltant type design ASPE primer 3 ' of T136G and T107C are held, comprise preferred specific primer sequence in the embodiment of the present invention 1 and 2 alternative specific primer sequences, as shown in table 11.Wherein, in frame, base is pleomorphism site.
Table 11 specific primer sequence
Liquid-phase chip is detected for the pleomorphism site of IKZF1 gene T136G and T107C, different specific primer sequences is selected for T136G and T107C, the tag sequence that ASPE primer 5 ' is held then is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence corresponded, specific design is as shown in following table (table 12).The synthesis of ASPE primer, anti-tag sequence bag by microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design two prepared by table 12 liquid-phase chip
Two, sample detection
Adopt liquid-phase chip prepared by above-mentioned design, detect sample 41-60 by testing process described in embodiment 2 and method, detected result is as follows:
Table 13 sample IKZF1 gene T136G detected result and Polymorphism Analysis
Table 14 sample IKZF1 gene T107C detected result and Polymorphism Analysis
From the present embodiment, when ASPE primer selects that in embodiment 1, specific primer sequence and tag sequence are arranged in pairs or groups, Detection results is much better than other specific primer sequence (signal to noise ratio is better), see the present embodiment test group 10 and test group 13.Other derives from the different specific primer sequence of the complementary sequence forward or backwards of place, target detect site sequence and tag sequence is arranged in pairs or groups, with coming to the same thing of embodiment 2 and the present embodiment, namely be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different SNP site and tag sequence are arranged in pairs or groups, and with coming to the same thing of embodiment 2 and the present embodiment, the Auele Specific Primer namely selected by embodiment 1, has better signal to noise ratio, and Detection results is also better, and concrete data are omitted.
The above embodiment only have expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but therefore can not be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.

Claims (4)

1. an IKZF1 gene mutation detection liquid-phase chip, is characterized in that, includes
(A). the wild-type designed respectively for the different mutational site of IKZF1 gene and the ASPE primer pair of saltant type: every bar ASPE primer holds the specific primer sequence for goal gene mutational site to form by 5 ' the tag sequence of holding and 3 ', described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in T136G site, and select for the SEQID NO.9 in G75C site and SEQ ID NO.10, with at least one group in the SEQ ID NO.11 in T107C site and SEQ ID NO.12; Described tag sequence is selected from SEQ ID NO.1 ~ SEQ ID NO.6;
(B). microballoon that have anti-tag sequence bag quilt, that have different colours coding, is also provided with spacer sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQ ID NO.13 ~ SEQ ID NO.18, and described anti-tag sequence can correspondingly be matched with selected tag complementary in (A);
(C). for amplifying the primer needing that detect, that there is corresponding mutational site target sequence, described amplimer is SEQ ID NO.19 for T136G site and SEQ ID NO.20, and the SEQ ID NO.21 be selected from for G75C site and SEQ ID NO.22, with at least one group in the SEQ ID NO.23 in T107C site and SEQ ID NO.24.
2. IKZF1 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described ASPE primer is: for the sequence be made up of SEQ ID NO.1 and SEQ ID NO.7 in T136G site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.8, and be selected from for the sequence be made up of SEQ ID NO.3 and SEQ ID NO.9 in G75C site and the sequence that is made up of SEQ ID NO.4 and SEQ ID NO.10, with at least one group in the sequence be made up of SEQ ID NO.5 and SEQ ID NO.11 for T107C site and the sequence that is made up of SEQ ID NO.6 and SEQ ID NO.12.
3. IKZF1 gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described spacerarm is 5-10 T.
4. for the Auele Specific Primer of IKZF1 detection in Gene Mutation, it is characterized in that, described Auele Specific Primer is SEQ ID NO.7 for T136G site and SEQ ID NO.8, and the SEQ ID NO.9 be selected from for G75C site and SEQ ID NO.10, with at least one group in the SEQ ID NO.11 in T107C site and SEQ ID NO.12.
CN201210250295.9A 2012-07-18 2012-07-18 Specific detection primers and liquid phase chip for IKZF1 gene mutation Active CN103571924B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210250295.9A CN103571924B (en) 2012-07-18 2012-07-18 Specific detection primers and liquid phase chip for IKZF1 gene mutation

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210250295.9A CN103571924B (en) 2012-07-18 2012-07-18 Specific detection primers and liquid phase chip for IKZF1 gene mutation

Publications (2)

Publication Number Publication Date
CN103571924A CN103571924A (en) 2014-02-12
CN103571924B true CN103571924B (en) 2015-05-13

Family

ID=50044633

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210250295.9A Active CN103571924B (en) 2012-07-18 2012-07-18 Specific detection primers and liquid phase chip for IKZF1 gene mutation

Country Status (1)

Country Link
CN (1) CN103571924B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7622630B2 (en) * 2003-08-28 2009-11-24 Aveo Pharmaceuticals, Inc. Chimeric cancer models

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
中国汉族人群C1qA、IKZF1单核苷酸多肽性与系统性红斑狼疮的相关性研究;栾海霞;《中国优秀硕士学位论文全文数据库 医药卫生科技辑》;20101115(第11期);E065-38 *

Also Published As

Publication number Publication date
CN103571924A (en) 2014-02-12

Similar Documents

Publication Publication Date Title
CN103451271B (en) THADA gene mutation detection specific primer and liquid phase chip
CN103374609B (en) ABO gene mutation detection specific primers and liquid chip
CN103451267B (en) TERT detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN102191337B (en) Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
CN103571924B (en) Specific detection primers and liquid phase chip for IKZF1 gene mutation
CN103571919B (en) Specific detection primers and detection liquid phase chip for HNF1B gene mutation
CN103865986B (en) CDKN1A detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN102912005B (en) CYP2C8 gene polymorphism detection specific primers and liquid chip
CN102191336B (en) MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip
CN102181573B (en) Specific primers and liquid-phase chip for detection of KITLG gene
CN102912002A (en) ABCB2 gene polymorphism detection specific primers and liquid chip
CN103451273B (en) TGM5 gene mutation detection specific primer and liquid phase chip
CN103849675B (en) RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103451266B (en) NKX3.1 gene mutation detection specific primers and liquid chip
CN103451269B (en) PDLIM5 gene mutation detection specific primer and liquid phase chip
CN103571926B (en) Specific detection primers and detection liquid phase chip for chromosome Xp11.22 segment polymorphism
CN103571925B (en) Specific detection primers and detection liquid phase chip for BIM gene mutation
CN103571921B (en) Specific detection primers and detection liquid phase chip for MSMB gene mutation
CN103571922B (en) SLC22A3 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103849941B (en) TYR detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103374608B (en) MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip
CN103451270B (en) ITGA6 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103374611B (en) LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip
CN102191335B (en) Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes
CN102304564B (en) Specific primers and liquid phase chip for single nucleotide polymorphism (SNP) detection in 15 q 25 section of chromosome

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant