CN103849675B - RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip - Google Patents

RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip Download PDF

Info

Publication number
CN103849675B
CN103849675B CN201210512218.6A CN201210512218A CN103849675B CN 103849675 B CN103849675 B CN 103849675B CN 201210512218 A CN201210512218 A CN 201210512218A CN 103849675 B CN103849675 B CN 103849675B
Authority
CN
China
Prior art keywords
seqidno
sequence
site
rtel1
phase chip
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201210512218.6A
Other languages
Chinese (zh)
Other versions
CN103849675A (en
Inventor
刘志明
林丽
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Surexam Bio Tech Co Ltd
Original Assignee
Surexam Bio Tech Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Surexam Bio Tech Co Ltd filed Critical Surexam Bio Tech Co Ltd
Priority to CN201210512218.6A priority Critical patent/CN103849675B/en
Publication of CN103849675A publication Critical patent/CN103849675A/en
Application granted granted Critical
Publication of CN103849675B publication Critical patent/CN103849675B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a kind of RTEL1 gene mutation detection liquid-phase chip and Auele Specific Primer, this liquid-phase chip mainly includes: often kind of ASPE primer holding the specific primer sequence for goal gene mutational site to form by 5 ' the tag sequence of holding and 3 ', does is described specific primer sequence: for the SEQ in A74G site ID NO.7 and SEQ ID NO.8, for the SEQ in A77G site ID NO.9 and SEQ ID NO.10, and/or for the SEQ in T122C site ID NO.11 and SEQ ID NO.12; There is the microballoon of anti-tag sequence bag quilt; Amplimer.The detected result of detection liquid-phase chip provided by the present invention and the identical rate of sequencing, up to 100%, realize wild-type and the saltant type parallel detection in multiple mutational site.

Description

RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, particularly relate to a kind of RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip.
Background technology
Regulation and control telomere extends helicase 1(regulatoroftelomereelongationhelicase1, RTEL1) be positioned on No. 20 karyomit(e) 20q13.33.RTEL1 gene is stablized by suppressing homologous recombination to maintain genome as a kind of gene of helicase of encoding, the function that RTEL1 loses homologous recombination can cause homologous recombination behavior uncontrolled, excessive homologous recombination out of control will cause Genome stability to decline, and more serious meeting causes canceration.Research finds, the single nucleotide polymorphism on RTEL1 and allergy and glioma have certain dependency.
At present, RTEL1 detection method of gene mutation mainly contains: Matrix Assisted Laser Desorption ionization time-of-flight mass-spectrometric technique (MALDI-TOF-MS), Illumina optical fiber superbead chip technology and double cross probe method, matter Assisted Laser Desorption ionization time-of-flight mass-spectrometric technique is a kind of Soft ionization techniques, powerful and the function of maturation is had in the detection of protein and other, but in field of nucleic acid detection, due to the singularity of nucleic acid molecule itself, detection is subject to certain restrictions, although Illumina optical fiber superbead chip technology is the high throughput testing system of highly sensitive and accuracy, but level of automation is low, manual operations is many, be difficult to the needs meeting practical application, because double cross probe method method needs synthesis 2 probes, the end of probe will be closed to avoid reaction, so the cost of synthesis can be higher, also cumbersome, and amplification efficiency is low, also be difficult to meet practical application needs.
The RTEL1 gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number The content of RTEL1 gene point mutation Write a Chinese character in simplified form
1 , there is A → G sudden change in the 74th Nucleotide of SEQ ID NO.33 A74G
2 , there is A → G sudden change in the 77th Nucleotide of SEQ ID NO.34 A77G
3 , there is T → C sudden change in the 122nd Nucleotide of SEQ ID NO.35 T122C
SEQIDNO.33 mutational site: A74G
AGTCCTGGGCTGTCACATCACGAGTGAGGCCTGTTTTCAGGCCTGTTTTCCCTTTTTGAGACCTGGGAGGAGC CCTGCTTTGCATGATCTGGTTGCTGAGATGTTGAGAGGAGCAGC
ACACACTCCCACGGGACAGCACACAGCCCCCCACGGAACGGCACACACACCCATGGAACAGCACACACACTCCCACGAACAGCACACACACTC
SEQIDNO.34 mutational site: A77G
CTCATTTCCTACAAACGCCCAGTGCAGGGAGTGGCTGCTTCTGAGAAGTCAAGTGACATCAGAGGTCAATGGAACA ACAGATTCCAGGCCCTTGGAATCTGTGCACCGGCTGCCTCAGGCACGCACTGCCTCCCGCAACCCCAACTGCGTGAGGGGCGCCGGCCTCCCCCCGGGATGGACGCTTCCTGCTGGGAGAGGCCTTGCTGCAGGACCATCACC
SEQIDNO.35 mutational site: T122C
GCCCCTACACCACCTGTTTCTGATTGGCAAACTCTCGGCTCCTTTCCAGTGCCCTAAACCCACACTGGGCCTCCTGCAGGGATGGGGGAGGACGAGGTCTGGTGGCACATGCCCAGGGTGA GCTGGTGAGGGAGGACGCAAAGGACAGTGGGGGCCGGGGAGCCGCTCCTGCCCTGTCCGGGCCCTCAGGCCAGGGGGGACCCACTGCTGGCAGCCCCAGCAGCCCCAGCTGCACGCAGATGAAGAGCTCTGGACACACGCGGCTTCCTGAACAGCTTCTCCAGGGACAGACAAATGGGGAC。
Summary of the invention
An object of the present invention is to provide RTEL1 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or parallel detection RTEL1 gene three kinds of Common genes type A74G, the wild-type of A77G and T122C and saltant type.
The technical scheme realizing above-mentioned purpose is as follows.
A kind of RTEL1 gene mutation detection liquid-phase chip, includes:
(A). the wild-type designed respectively for the different mutational site of RTEL1 gene and the ASPE primer pair of saltant type: every bar ASPE primer holds the specific primer sequence for goal gene mutational site to form by 5 ' the tag sequence of holding and 3 ', described specific primer sequence is: for SEQIDNO.7 and SEQIDNO.8 in A74G site, for SEQIDNO.9 and SEQIDNO.10 in A77G site, and/or for SEQIDNO.11 and SEQIDNO.12 in T122C site; Described tag sequence is selected from SEQIDNO.1 ~ SEQIDNO.6;
(B). microballoon that have different anti-tag sequence bag quilt, that have different colours coding, is also provided with spacer sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQIDNO.13 ~ SEQIDNO.18, and described anti-tag sequence can correspondingly be matched with selected tag complementary in (A);
(C). for amplifying the primer needing that detect, that there is corresponding mutational site target sequence.
Wherein in an embodiment, described amplimer is: for SEQIDNO.19 and SEQIDNO.20 in A74G site, for SEQIDNO.21 and SEQIDNO.22 in A77G site, and/or for SEQIDNO.23 and SEQIDNO.24 in T122C site.
Wherein in an embodiment, described ASPE primer pair is: described ASPE primer is: for the sequence be made up of SEQIDNO.1 and SEQIDNO.7 in A74G site and the sequence that is made up of SEQIDNO.2 and SEQIDNO.8, for the sequence be made up of SEQIDNO.3 and SEQIDNO.9 in A77G site and the sequence that is made up of SEQIDNO.4 and SEQIDNO.10, and/or for the sequence be made up of SEQIDNO.5 and SEQIDNO.11 in T122C site and the sequence that is made up of SEQIDNO.6 and SEQIDNO.12.
Another object of the present invention is to provide the Auele Specific Primer for RTEL1 detection in Gene Mutation.
The technical scheme realizing this object is as follows.
For the Auele Specific Primer of RTEL1 detection in Gene Mutation, described Auele Specific Primer is: for SEQIDNO.7 and SEQIDNO.8 in A74G site, for SEQIDNO.9 and SEQIDNO.10 in A77G site, and/or for SEQIDNO.11 and SEQIDNO.12 in T122C site.
Major advantage of the present invention is:
1. the identical rate of RTEL1 gene mutation detection liquid-phase chip detected result provided by the present invention and sequencing is up to 100%, and the time required for detecting is well below conventional sequencing technologies, and realistic especially application needs.Prepared RTEL1 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and substantially there is not cross reaction between designed probe and anti-tag sequence, choosing and the combination of tag sequence label and concrete ASPE primer of tag sequence label, anti-tag sequence label, can cross reaction be avoided, realize the parallel detection in multiple mutational site.
2. the present invention passes through the design experiences of contriver's long term accumulation and a large amount of experimental implementation, have chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention's design can the sensitive mutational site identifying target detect specifically, accurately distinguishes the genotype of various type; In same reaction system, substantially there is not cross reaction between different Auele Specific Primers, between the pcr amplification product that detects of Auele Specific Primer and non-targeted, detection specificity is good, and cross reacting rate is lower than 3%; Except Single locus catastrophe can be detected, also can the catastrophe in the simultaneously multiple mutational site of parallel detection, Detection results is consistent.
3. detection method step of the present invention is simple, the amplification that can complete 3 target sequences containing mutational site by One_step PCR is detected in 3 kinds of mutational sites, avoid the many uncertain factors existed in the complex operations processes such as repeated multiple times PCR, thus greatly can improve Detection accuracy, embody accurate qualitative and quantitative analysis feature simultaneously.
4. not only to overcome conventional solid chip susceptibility not high in the present invention, and the defect of the repeatability difference of detected result, improves existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detected improves greatly, thus the sensitivity detected is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1RTEL1 gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
For wild-type and the saltant type of RTEL1 gene three kinds of Common genes type A74G, A77G and T122C, design specific primer sequence respectively.ASPE primer is made up of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (tag sequence+specific primer sequence) of table 1RTEL1 gene
Every bar ASPE primer comprises two parts, and 5 ' end is for for the specificity tag sequence of anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer segments (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every bar primer after synthesis is mixed with the stock solution of 100pmol/mL respectively with 10mmol/LTrisBuffer.
Two, the microballoon of anti-tag sequence bag quilt
According to designed ASPE Auele Specific Primer fragment, select tag sequence, between the anti-tag sequence reducing each microballoon to greatest extent and tag and the ASPE Auele Specific Primer fragment secondary structure that may be formed, the anti-tag sequence that 6 kinds of microballoons numberings of selection are corresponding on microballoon is as shown in table 2:
The anti-tag sequence that table 2 microballoon numbering is corresponding on microballoon
The 6 kinds of microballoon purchased from American Luminex companies selected, are coated in anti-tag sequence on microballoon.Be connected with the spacer sequence of 5-10 T between anti-tag sequence and microballoon, before each anti-tag sequence, namely add the spacer sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.The anti-tag sequence sterilizing ddH2O of synthesis is made into the stock solution of 100nmol/ml.Described spacerarm is for by anti-tag and microsphere surface is spaced apart or anti-tag is placed in the sequence of hydrophilic environments.By arranging the spacer sequence of suitable length between anti-tag sequence and microballoon, can reduce sterically hindered, improving the efficiency of hybridization and the specificity of hybridization.Common spacer sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) interference, can also poly(TTG be used) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the process of microballoon bag quilt is as follows:
Get 5 × 10 respectively 6the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in (pH4.5) in the MES solution of 50ul0.1mol/L, adds the anti-tag molecule (100nmol/ml) of 10ul synthesis.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from PierceChemical company) working fluid.The EDC working fluid of 2.5ul is added, constant-temperature incubation 30 minutes, then the EDC working fluid adding 2.5ul in microsphere suspensions, then constant-temperature incubation 30 minutes.After reaction terminates, the Tween-20 washing with 0.02% once, then is washed once with the SDS liquid of 0.1%.The microballoon being coated with anti-tag sequence after washing is resuspended in the Tris-EDTA solution [10mmol/LTris(pH8.0)] of 100ul, in 1mmol/LEDTA, 2-8 DEG C keeps in Dark Place.
Three, the primer of the target sequence containing mutational site is amplified
For RTEL1 gene three kinds of Common genes type A74G, A77G and T122C, design of amplification primers, to (see table 3), amplifies 3 target sequences containing 3 mutational sites.
Table 3 amplifies the primer of the target sequence with mutational site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every bar primer after synthesis is mixed with the stock solution of 100pmol/mL respectively with 10mmol/LTrisBuffer.
Embodiment 2 uses RTEL1 gene mutation detection liquid-phase chip described in embodiment 1 to the detection of sample
The formula of described various solution is as follows:
The MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 × Tm hybridization buffer
4 DEG C are stored in after filtration.
ExoSAP-IT test kit purchased from American USB company.
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
With reference to " molecular cloning " about the methods involving of DNA extraction, obtain DNA to be detected.
Two, the pcr amplification of testing sample
Design 3 pairs of primers, multiplex PCR one step amplifies 3 respectively containing the target sequence of RTEL1 gene three kinds of Common genes type A74G, A77G and T122C, product size is respectively 211bp, 220bp, 303bp, and primer sequence (SEQIDNO.19-24) is shown in shown in above-mentioned table 3.
First multiple PCR primer working fluid is prepared: the primer stock solution 100ul respectively getting SEQIDNO.19-24 respectively, in 1.5ml Eppendorf tube, mixes and is multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 DEG C of 3min; 94 DEG C of 30s, 56 DEG C of 30s, 72 DEG C of 40s, 30 circulations; 72 DEG C of 10min; 4 DEG C save backup.
Three, the enzyme of PCR primer cuts process
1. get the reacted product of 7.5ulPCR, add 1ul10 × SAP damping fluid, 1ulSAP enzyme and 0.5ulExo-I enzyme;
Hatch 15min for 2.37 DEG C, hatch 15min for 80 DEG C, the enzyme that deactivation is unnecessary.Product after enzyme cuts process is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thus make biotin labelings multiple on reacted product band.
First the ASPE primer working fluid of mixing is prepared: get the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul respectively in 1.5ml Eppendorf tube, add 10mmol/LTrisBuffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 DEG C of 2min; 94 DEG C of 30s, 54 DEG C of 1min, 72 DEG C of 2min, 30 circulations; 4 DEG C save backup.
Five, hybridization
1., according to the ASPE primer of design, the microballoon (as described in Example 1) of the corresponding 6 kinds of bag quilts of every group selection, often kind of microballoon concentration is 2.5 × 10 5individual/ml;
2. get 1ul respectively and often plant the microballoon of numbering in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microsphere suspensions of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul 2o;
6. the ASPE reaction solution getting 5-25ul, in corresponding hole, uses ddH 2o complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 DEG C of 60s, 37 DEG C of 15min hatch hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
Microballoon is resuspended in 1 × Tm hybridization buffer of 75ul by 11., adds the SA-PE (SA-PE) that 15ul concentration is 10ug/ml;
Hatch 15min for 12.37 DEG C, detect on Luminex instrument.
Six, result detects and data analysis
Reaction after product is detected by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Following requirement is had to fluorescent value (MFI) and data processing:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;
2.NETMFI=sample MFI-PCR negative control MFI(NETMFI is less than 0 represent with 0);
3. meet the data of above two conditions, by following formulae discovery sudden change ratio:
Sudden change ratio=saltant type NETMFI ÷ (saltant type NETMFI+ wild-type NETMFI)
4. rule of thumb to the sudden change ratio definite threshold (cut-off value) of each detection site, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments RTEL1 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.Detect with sequencing and compare with liquid-phase chip result, calculate the identical rate of classifying method detected result provided by the present invention.Present method detect 20 increments this RTEL1 genotype call results and the sequencing result rate of coincideing reach 100%.Visible RTEL1 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of RTEL1 exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Table 5 sample RTEL1 transgenation ratio (%)
Table 6 sample RTEL1 gene mutation type analytical results
The liquid-phase chip of the ASPE primer that embodiment 3 is different is to the detection of RTEL1 gene SNP site
One, the design (selection of Tag sequence and Anti-Tag sequence) prepared of liquid-phase chip
Liquid-phase chip is detected for RTEL1 Gene A 74G, A77G and T122C site mutation, respectively for the specific primer sequence that wild-type and the saltant type design ASPE primer 3 ' of A74G, A77G and T122C are held, the Tag sequence that ASPE primer 5 ' is held then is selected from SEQIDNO.1-SEQIDNO.6, accordingly, be coated in and microballoon is selected from SEQIDNO.13-SEQIDNO.18 with the anti-tag sequence that corresponding tag complementary matches.Specific design is as shown in following table (table 7).The synthesis of ASPE primer, anti-tag sequence bag by microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 7 liquid-phase chip
One, sample detection
Adopt liquid-phase chip prepared by above-mentioned design, detect sample 21-40 by testing process described in embodiment 2 and method, detected result is as follows:
Table 8 sample RTEL1 Gene A 74G detected result and Polymorphism Analysis
Table 9 sample RTEL1 Gene A 77G detected result and Polymorphism Analysis
Table 10 sample RTEL1 gene T122C detected result and Polymorphism Analysis
From above-described embodiment, other is for the liquid-phase chip in different mutational site, and ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And ASPE primer is when selecting that in embodiment 1, tag sequence and specific primer sequence are arranged in pairs or groups, effect better (signal to noise ratio is better), see the present embodiment test group 1, test group 5 and test group 9.Other different tag sequence and specific primer sequence are arranged in pairs or groups, and with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4RTEL1 detection in Gene Mutation specific primer sequence
One, the design (selection of wild-type and saltant type specific primer sequence) prepared of liquid-phase chip
Liquid-phase chip is detected for the pleomorphism site of RTEL1 Gene A 74G and T122C, with the complementary sequence forward or backwards of this place, mutational site target sequence for template, respectively for the specific primer sequence that wild-type and the saltant type design ASPE primer 3 ' of A74G and T122C are held, comprise preferred specific primer sequence in the embodiment of the present invention 1 and 2 alternative specific primer sequences, as shown in table 11.Wherein, interior base is pleomorphism site.
Table 11 specific primer sequence
Liquid-phase chip is detected for the pleomorphism site of RTEL1 Gene A 74G and T122C, different specific primer sequences is selected for A74G and T122C, the tag sequence that ASPE primer 5 ' is held then is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence corresponded, specific design is as shown in following table (table 12).The synthesis of ASPE primer, anti-tag sequence bag by microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design two prepared by table 12 liquid-phase chip
Two, sample detection
Adopt liquid-phase chip prepared by above-mentioned design, detect sample 41-60 by testing process described in embodiment 2 and method, detected result is as follows:
Table 13 sample RTEL1 Gene A 74G detected result and Polymorphism Analysis
Table 14 sample RTEL1 gene T122C detected result and Polymorphism Analysis
From the present embodiment, when ASPE primer selects that in embodiment 1, specific primer sequence and tag sequence are arranged in pairs or groups, effect better (signal to noise ratio is better), see the present embodiment test group 10 and test group 13.Other derives from the different specific primer sequence of the complementary sequence forward or backwards of place, target detect site sequence and tag sequence is arranged in pairs or groups, with coming to the same thing of embodiment 2 and the present embodiment, namely be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different SNP site and tag sequence are arranged in pairs or groups, and with coming to the same thing of embodiment 2 and the present embodiment, the Auele Specific Primer namely selected by embodiment 1, has better signal to noise ratio, and Detection results is also better, and concrete data are omitted.
The above embodiment only have expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but therefore can not be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.

Claims (3)

1. a RTEL1 gene mutation detection liquid-phase chip, is characterized in that, includes:
(A). the wild-type designed respectively for the different mutational site of RTEL1 gene and the ASPE primer pair of saltant type: every bar ASPE primer holds the specific primer sequence for goal gene mutational site to form by 5 ' the tag sequence of holding and 3 ', described specific primer sequence is: described ASPE primer pair is: for the sequence be made up of SEQIDNO.1 and SEQIDNO.7 in A74G site and the sequence that is made up of SEQIDNO.2 and SEQIDNO.8, and be selected from for the sequence be made up of SEQIDNO.3 and SEQIDNO.9 in A77G site and the sequence that is made up of SEQIDNO.4 and SEQIDNO.10, with at least one pair of in the sequence be made up of SEQIDNO.5 and SEQIDNO.11 for T122C site and the sequence that is made up of SEQIDNO.6 and SEQIDNO.12,
(B). microballoon that have different anti-tag sequence bag quilt, that have different colours coding, is also provided with spacer sequence in the middle of described anti-tag sequence is connected with microballoon; Described anti-tag sequence is selected from SEQIDNO.13 ~ SEQIDNO.18, and described anti-tag sequence can correspondingly be matched with selected tag complementary in (A);
(C). for amplifying the primer needing that detect, that there is corresponding mutational site target sequence;
Described amplimer is: for SEQIDNO.19 and SEQIDNO.20 in A74G site, and is selected from SEQIDNO.21 and SEQIDNO.22 for A77G site, and at least one group in SEQIDNO.23 and SEQIDNO.24 in T122C site.
2. RTEL1 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described ASPE primer pair is: for the sequence be made up of SEQIDNO.1 and SEQIDNO.7 in A74G site and the sequence that is made up of SEQIDNO.2 and SEQIDNO.8, and for the sequence be made up of SEQIDNO.3 and SEQIDNO.9 in A77G site and the sequence that is made up of SEQIDNO.4 and SEQIDNO.10, with for the sequence be made up of SEQIDNO.5 and SEQIDNO.11 in T122C site and the sequence that is made up of SEQIDNO.6 and SEQIDNO.12.
3. RTEL1 gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described spacerarm is 5-10 T.
CN201210512218.6A 2012-12-04 2012-12-04 RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip Active CN103849675B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201210512218.6A CN103849675B (en) 2012-12-04 2012-12-04 RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201210512218.6A CN103849675B (en) 2012-12-04 2012-12-04 RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Publications (2)

Publication Number Publication Date
CN103849675A CN103849675A (en) 2014-06-11
CN103849675B true CN103849675B (en) 2016-04-27

Family

ID=50857797

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201210512218.6A Active CN103849675B (en) 2012-12-04 2012-12-04 RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip

Country Status (1)

Country Link
CN (1) CN103849675B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102010906A (en) * 2010-11-09 2011-04-13 广州益善生物技术有限公司 Emb B gene mutation detection specific primers and liquid phase chip

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Genetic Risk Profiles Identify Different Molecular Etiologies for Glioma;Matthias Simon等;《Clin Cancer Res》;20101101;第16卷(第21期);5252-5259 *
液相芯片技术的原理与应用进展;陈玮;《成都医学院学报》;20080931(第03期);225-231 *

Also Published As

Publication number Publication date
CN103849675A (en) 2014-06-11

Similar Documents

Publication Publication Date Title
CN103451271B (en) THADA gene mutation detection specific primer and liquid phase chip
CN103451267B (en) TERT detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103374609B (en) ABO gene mutation detection specific primers and liquid chip
CN102191337B (en) Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene
CN103849675B (en) RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103571919B (en) Specific detection primers and detection liquid phase chip for HNF1B gene mutation
CN103865986B (en) CDKN1A detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103451272A (en) BAT3 gene mutation detection specific primer and liquid phase chip
CN103374606B (en) CHEK1 (checkpoint kinase 1) gene mutation detection specific primers and liquid chip
CN102912005B (en) CYP2C8 gene polymorphism detection specific primers and liquid chip
CN102181573B (en) Specific primers and liquid-phase chip for detection of KITLG gene
CN103451273B (en) TGM5 gene mutation detection specific primer and liquid phase chip
CN103571924B (en) Specific detection primers and liquid phase chip for IKZF1 gene mutation
CN103571922B (en) SLC22A3 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103571921B (en) Specific detection primers and detection liquid phase chip for MSMB gene mutation
CN103451266B (en) NKX3.1 gene mutation detection specific primers and liquid chip
CN103571926B (en) Specific detection primers and detection liquid phase chip for chromosome Xp11.22 segment polymorphism
CN103849676B (en) CCDC26 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN102191335B (en) Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes
CN102888445B (en) A kind of NAT2 genetic polymorphism detection Auele Specific Primer and liquid-phase chip
CN103451270B (en) ITGA6 detection in Gene Mutation Auele Specific Primer and liquid-phase chip
CN103451269B (en) PDLIM5 gene mutation detection specific primer and liquid phase chip
CN103374611B (en) LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip
CN102304564B (en) Specific primers and liquid phase chip for single nucleotide polymorphism (SNP) detection in 15 q 25 section of chromosome
CN102952869B (en) Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant