CN103849938A - Specific primer and liquid phase chip for detecting MAP3K1 gene mutation - Google Patents
Specific primer and liquid phase chip for detecting MAP3K1 gene mutation Download PDFInfo
- Publication number
- CN103849938A CN103849938A CN201210512189.3A CN201210512189A CN103849938A CN 103849938 A CN103849938 A CN 103849938A CN 201210512189 A CN201210512189 A CN 201210512189A CN 103849938 A CN103849938 A CN 103849938A
- Authority
- CN
- China
- Prior art keywords
- seq
- sequence
- site
- primer
- map3k1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a liquid phase chip and a specific primer for detecting MAP3K1 gene mutation. The liquid phase chip mainly comprises: ASPE primers, microspheres coated by different anti-tag sequences, and an amplification primer, wherein each ASPE primer is composed of a tag sequence at a 5' end and specific primer sequences at a 3' end and aiming at target gene mutation sites, and the specific primer sequences are as follows: SEQ ID NO.7 and SEQ ID NO.8 aiming at a T148G site, SEQ ID NO.9 and SEQ ID NO.10 aiming at an C87A site, and/or SEQ ID NO.11 and SEQ ID NO.12 aiming at a G260A site. The coincidence rate of the detection result of the detection liquid phase chip disclosed by the invention with that of a sequencing method reaches as high as 100%, and parallel detection of a wild type and a mutant of a plurality of mutation sites is achieved.
Description
Technical field
The invention belongs to biology field, relate to medical science and biotechnology, concrete a kind of MAP3K1 detection in Gene Mutation Auele Specific Primer and the liquid-phase chip of relating to.
Background technology
Mitogen-activated protein kinase kinase kinases 1(mitogenactivated protein kinase kinase kinase1, MAP3K1) also there are the another names such as MAPKKK1, MEKK or MEKK1, be positioned at the long-armed upper of No. 5 karyomit(e) 5q11.2, specifically between No. 5 karyomit(e) 56110899 to 56191978 base pairs.The protein of MAP3K1 genes encoding is a kind of serine/threonine kinase, it is a part for some signal transduction cascades, except comprising NF-κ B signal transduction path, also comprise extracellular regulated protein kinase (ERK) and N terminal kinase (JNK) approach.The protein of coding is activated by autophosphorylation, needs the participation of cofactor magnesium in the time making other protein phosphorylations.Research discovery, MAP3K1 gene has been brought into play keying action in sex is grown.
At present, MAP3K1 detection method of gene mutation mainly contains: Illumina optical fiber superbead chip technology, Affymetrix SNP6.0 chip technology, fluorescent quantitative PCR technique and PCR-RFLP, although Illumina optical fiber superbead chip technology is the high throughput testing system of highly sensitive and accuracy, but level of automation is low, manual operations is many, is difficult to meet the needs of practical application.Although high-throughput makes Affymetrix SNP6.0 chip technology comparative maturity, but this chip technology in low-density clinical diagnosis cake core improper, be difficult to expansion in same reaction system and detect relevant SNP or the Tag SNP of numerous biological characters, in addition, Affymetrix SNP6.0 chip is mainly more intense on chip of expression spectrum, and species are more, on SNP chip relatively a little less than, and detect expensively, can not meet actual needs.Fluorescent quantitative PCR technique has highly sensitive, high specificity, the feature that level of automation is high, but also exist sample easily to pollute, the shortcoming that false positive rate is high, and can only detect a kind of mutation type at every turn, PCR-RFLP method is the change of the restriction enzyme enzyme recognition site that causes based on transgenation, as lost or generation novel site in site, by a certain specific fragment of pcr amplification, use again digestion with restriction enzyme amplified production, the size of electrophoresis observation fragment, the transgenation that this method changes for detection of restriction enzyme site, can directly judge genotype, but this method can not be used for not producing the detection in Gene Mutation of new restriction enzyme site
The MAP3K1 gene mutation site of target detect of the present invention, it is as shown in the table:
Sequence number | The content of MAP3K1 gene point mutation | Write a Chinese character in simplified form |
1 | , there is T → G sudden change in the 148th Nucleotide of SEQ ID NO.33 | T148G |
2 | , there is C → A sudden change in the 87th Nucleotide of SEQ ID NO.34 | C87A |
3 | , there is G → A sudden change in the 260th Nucleotide of SEQ ID NO.35 | G260A |
SEQ IDNO.33 mutational site: T148G
TTCTAGCACGTAAGCTTCATGGGGAAACTGATTTTGCTTTACCCACTGCTATTTTCCCAGCACAGAGAGTACCTGGCATATAGTTGGTGCTCAGTAAATATTTGCTGAATAAAGAAATTATTAAAGAAACTTGCCCAAGGCCAGCTT
TAATTGGTGGACCCAGTATTTGCAGCTGGACTGTTGCCCTGAAGCCACACATTTTGGTTACTTGAGGTCACTTAGCGTCTTAGTCCATTTGGGTTGCTATACAAGATACCATGGACTGGGTGGTTTATAAACAACAGACATTTATTTCTTACAGTTCTGGAAGCTGGAAAGTCCATGATCAAGGCACTGGCAGATTAGG
SEQ IDNO.34 mutational site: C87A
TTTACCAACCTGGATTCTTTCACTCATCACACAAGTCAGGCCCCATTACTTGAGATGATCTCTGAGATGCCCCTGCTGGAGAAAGG
ATGTGCAAATTAAGAGACTACAAATCAGTTTGAAAACTCAACGACTCCTTCCCATAAATCTGTGTCCTTAATATTAAAAATCATTTGGAGGTGCTGAAAAGAAAGAGAACTGATAGCTACAGAAAACAACAGCCCTACTCACTTCAG
SEQ ID NO.35 mutational site: G260A
AAAGACTCAGAGCATGAATAGGTTGCTGATACCTTAATATTTGATTGACATATGAAAACCCAAAGTCTGGGCTCTTTAATTAAAAATTCATAGATACTTTATGCTGAAATGGTTTTTGAAGTATACATGCTGTAAATTACTACCATTTTTTAAGTTTCCATGTATTTTTCAGTAATTGGAACTTATATGGTAATGAATGTTTTTTTCTTTCAGGTATAAGAAGCTGCTGTCCCTCTTAACCTTTGCTTTGCAGTCCATT
ATAATTCCCACTCAATGGTTGGCAAACTTTCCAGAAGGATCTACTTGAGTTCTGCAAGAATGGTTACTACAGTACCCCATGTGTTTTCAAAACTGTTAGAAATGCTGAGTGTTTCCAGTTCCACTCACTTCACCAGGATGCGTC。
Summary of the invention
One of object of the present invention is to provide MAP3K1 gene mutation detection liquid-phase chip, and this liquid-phase chip can be used for separately or wild-type and the saltant type of parallel detection MAP3K1 gene three kinds of common genotype T148G, C87A and G260A.
The technical scheme that realizes above-mentioned purpose is as follows.
A kind of MAP3K1 gene mutation detection liquid-phase chip, includes:
(A). the wild-type designing respectively for the different mutational sites of MAP3K1 gene and the ASPE primer pair of saltant type: every ASPE primer is made up of for the specific primer sequence in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in T148G site, for SEQ ID NO.9 and the SEQ ID NO.10 in C87A site, and/or for SEQ ID NO.11 and the SEQ ID NO.12 in G260A site; Described tag sequence is selected from SEQ ID NO.1~SEQ ID NO.6;
(B). there is microballoon that different anti-tag sequences are coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.13~SEQ ID NO.18, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs the target sequence detecting, there is corresponding mutational site.
Therein in an embodiment, described amplimer is: for SEQ ID NO.19 and the SEQ ID NO.20 in T148G site, for SEQ ID NO.21 and the SEQ ID NO.22 in C87A site, and/or for SEQ ID NO.23 and the SEQID NO.24 in G260A site.
Therein in an embodiment, described ASPE primer is: for the sequence being made up of SEQ ID NO.1 and SEQ ID NO.7 in T148G site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.8, for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.9 in C87A site and the sequence that formed by SEQ ID NO.4 and SEQ ID NO.10, and/or for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.11 in G260A site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.12.
Another object of the present invention is to provide the Auele Specific Primer for MAP3K1 detection in Gene Mutation.
The technical scheme that realizes this object is as follows.
For the Auele Specific Primer of MAP3K1 detection in Gene Mutation, described Auele Specific Primer is: for SEQID NO.7 and the SEQ ID NO.8 in T148G site, for SEQ ID NO.9 and the SEQ ID NO.10 in C87A site, and/or for SEQ ID NO.11 and the SEQ ID NO.12 in G260A site
Major advantage of the present invention is:
1. the identical rate of the detected result of MAP3K1 gene mutation detection liquid-phase chip provided by the present invention and sequencing is up to 100%.And detect the needed time well below conventional sequencing technologies, realistic especially application needs.Prepared MAP3K1 gene mutation detection liquid-phase chip has extraordinary signal-noise ratio, and between designed probe and anti-tag sequence, substantially there is not cross reaction, choosing and tag sequence label and the specifically combination of ASPE primer of tag sequence label, anti-tag sequence label, can avoid cross reaction, realize the parallel detection in multiple mutational sites.
2. the present invention, by the design experiences of the long-term accumulation of contriver and a large amount of experimental implementation, has chosen optimum combination from numerous Auele Specific Primers.The ASPE primer specificity primer of the present invention design can the sensitive mutational site of identifying specifically target detect, accurately distinguishes the genotype of various types; In same reaction system, between different Auele Specific Primers, substantially there is not cross reaction between Auele Specific Primer and the pcr amplification product of non-target detect, detection specificity is good, and cross reacting rate is lower than 3%; Except detecting Single locus sudden change situation, the also sudden change situation in the multiple mutational sites of parallel detection simultaneously, detects effect consistent.
3. detection method step of the present invention is simple, the amplification that can complete by a step PCR 3 target sequences that contain mutational site is detected in 3 kinds of mutational sites, the many uncertain factors that exist in the complex operations processes such as repeated multiple times PCR are avoided, thereby can greatly improve Detection accuracy, embody accurate while qualitative and quantitative analysis feature.
4. not only to have overcome traditional solid phase chip susceptibility not high in the present invention, and the poor defect of repeatability of detected result is improved existing liquid-phase chip technology simultaneously, makes prepared microballoon can be applicable to different test items, has very strong expansion.The fluorescent signal value detecting improves greatly, thereby the sensitivity detecting is further enhanced, and signal to noise ratio strengthens, and detected result more accurately and reliably.
Embodiment
Embodiment 1MAP3K1 gene mutation detection liquid-phase chip, mainly includes:
One, ASPE primer
For wild-type and the saltant type of MAP3K1 gene three kinds of common genotype T148G, C87A and G260A, design respectively specific primer sequence.ASPE primer is made up of " tag sequence+specific primer sequence ".ASPE primer sequence is as shown in the table:
The ASPE primer sequence (tag sequence+specific primer sequence) of table 1MAP3K1 gene
Every ASPE primer comprises two parts, and 5 ' end is the specificity tag sequence for anti-tag sequence on corresponding microballoon, and 3 ' end is saltant type or the special primer fragment (as shown in Table 1 above) of wild-type.All ASPE primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/LTris Buffer.
Two, the coated microballoon of anti-tag sequence
According to designed ASPE Auele Specific Primer fragment, select tag sequence, reduce to greatest extent between the anti-tag sequence of each microballoon and secondary structure that tag and ASPE Auele Specific Primer fragment may form, on 6 kinds of microballoons numberings of selection and microballoon, corresponding anti-tag sequence is as shown in table 2:
Corresponding anti-tag sequence on table 2 microballoon numbering and microballoon
6 kinds of microballoons selecting, purchased from Luminex company of the U.S., are coated in anti-tag sequence on microballoon.Between anti-tag sequence and microballoon, be connected with the spacerarm sequence of 5-10 T, before each anti-tag sequence, add the spacerarm sequence of the preceding paragraph 5-10 T, anti-tag sequence is synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Synthetic anti-tag sequence is made into the stock solution of 100nmol/ml with sterilizing ddH2O.Described spacerarm be for by anti-tag and microsphere surface is spaced apart or by anti-tag stomach in the sequence of hydrophilic environments.By the spacerarm sequence of suitable length is set between anti-tag sequence and microballoon, can reduce sterically hinderedly, improve the efficiency of hybridization and the specificity of hybridization.Common spacerarm sequence comprises poly dT, i.e. poly(dT), oligomerization four polyoxyethylene glycol and (CH2) n spacerarm (n >=3), as (CH2) 12, (CH2) 18 etc.In addition, if there is poly(dA) disturb, can also use poly(TTG) as spacerarm.Spacerarm of the present invention is preferably 5-10 T, and the coated process of microballoon is as follows:
Get respectively 5 × 10
6the carboxylated microballoon (purchased from Luminex company) of individual above-mentioned numbering is suspended in the MES solution of 50ul0.1mol/L (pH4.5), adds the synthetic anti-tag molecule (100nmol/ml) of 10ul.The EDC(N-(3-Dimethylaminopropyl-N-ethylcarbodiimide of preparation 10ng/ml) (purchased from Pierce Chemical company) working fluid.Toward the EDC working fluid that adds 2.5ul in microballoon suspension, constant-temperature incubation 30 minutes, then add the EDC working fluid of 2.5ul, then constant-temperature incubation 30 minutes.After reaction finishes, the Tween-20 with 0.02% washs once, then washs once with 0.1% SDS liquid.The Tris-EDTA solution [10mmol/L Tris(pH8.0)] that the microballoon that is coated with anti-tag sequence after washing is resuspended in to 100ul, in 1mmol/LEDTA, 2-8 ℃ keeps in Dark Place.
Three, amplify the primer of the target sequence that contains mutational site
For MAP3K1 gene three kinds of common genotype T148G, C87A and G260A, design of amplification primers, to (in table 3), amplifies 3 target sequences that contain 3 mutational sites.
Table 3 amplifies the primer of the target sequence with mutational site
All primers are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.Every primer after synthetic is mixed with respectively the stock solution of 100pmol/mL with 10mmol/L Tris Buffer.
Embodiment 2 uses the detection to sample of MAP3K1 gene mutation detection liquid-phase chip described in embodiment 1
The formula of described various solution is as follows:
MES damping fluid (pH5.0) formula (250ml) of 50mM:
2 × Tm hybridization buffer
After filtration, be stored in 4 ℃.
ExoSAP-IT test kit is purchased from USB company of the U.S..
Biotin labeled dCTP is purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
One, the DNA extraction of sample:
Methods involving with reference to " molecular cloning " about DNA extraction, obtains DNA to be detected.
Two, the pcr amplification of testing sample
Design 3 pairs of primers, multiplex PCR one step amplifies 3 target sequences that contain respectively MAP3K1 gene three kinds of common genotype T148G, C87A and G260A, product size is respectively 347bp, 234bp, 404bp, and primer sequence (SEQ IDNO.19-24) is shown in shown in above-mentioned table 3.
First prepare multiple PCR primer working fluid: respectively get respectively the primer stock solution 100ul of SEQ ID NO.19-24 in 1.5ml Eppendorf tube, mix and be multiple PCR primer working fluid.Multi-PRC reaction system is as follows:
Pcr amplification program is: 95 ℃ of 3min; 94 ℃ of 30s, 56 ℃ of 30s, 72 ℃ of 40s, 30 circulations; 72 ℃ of 10min; 4 ℃ save backup.
Three, the enzyme of PCR product is cut processing
1. get the reacted product of 7.5ulPCR, add 1ul10 × SAP damping fluid, 1ul SAP enzyme and 0.5ul Exo-I enzyme;
Hatch 15min for 2.37 ℃, hatch 15min for 80 ℃, the enzyme that deactivation is unnecessary.Enzyme is cut product after treatment and is directly used in follow-up ASPE primer extension reaction.
Four, site-specific primer extension reaction (ASPE)
Utilize the ASPE primer of design in embodiment 1 to carry out primer extension reaction, in reaction process, mix biotin labeled dCTP, thereby make multiple biotin labeling on reacted product band.
First the ASPE primer working fluid that preparation mixes: get respectively the corresponding wild-type of gene to be detected and saltant type ASPE primer stock solution 10ul in 1.5ml Eppendorf tube, add 10mmol/L Tris Buffer to mend to 200ul, mix and be ASPE mix primer working fluid.The system of ASPE reaction is as follows:
Response procedures is: 96 ℃ of 2min; 94 ℃ of 30s, 54 ℃ of 1min, 72 ℃ of 2min, 30 circulations; 4 ℃ save backup.
Five, hybridization
According to design ASPE primer, the corresponding 6 kinds of coated microballoons of every group selection (as described in Example 1), every kind of microballoon concentration is 2.5 × 10
5individual/ml;
2. get respectively the microballoon of every kind of numbering of 1ul in the Eppendorf tube of 1.5ml;
3. microballoon is in >=centrifugal the 1-2min of 10000g;
4. supernatant discarded, microballoon is resuspended in 2 × Tm hybridization buffer of 100ul, and vortex mixes;
5. get the above-mentioned microballoon suspension of 25ul in the 96 corresponding holes of hole filter plate, control wells adds the ddH of 25ul
2o;
6. get the ASPE reaction solution of 5-25ul in corresponding hole, use ddH
2o complements to 50ul;
7. encase 96 orifice plates with lucifuge with masking foil, 95 ℃ of 60s, 37 ℃ of 15min are hatched hybridization;
8. the microballoon after hybridization is in >=centrifugal the 2-5min of 3000g;
9. remove supernatant, microballoon is resuspended in 1 × Tm hybridization buffer of 75ul;
10. microballoon is in >=centrifugal the 2-5min of 3000g;
11. are resuspended in microballoon in 1 × Tm hybridization buffer of 75ul, and adding 15ul concentration is that Streptavidin-algae of 10ug/ml is red
Albumen (SA-PE);
Hatch 15min for 12.37 ℃, on Luminex instrument, detect.
Six, result detects and data analysis
Reaction after product detects by Luminex serial analysis instrument.Detected result is as shown in table 4, table 5 and table 6.
Fluorescent value (MFI) and data processing are had to following requirement:
1. each site need have at least an allelotrope MFI to be greater than 300 and be greater than 10 × PCR negative control MFI;
2.NET MFI=sample MFI-PCR negative control MFI(NET MFI is less than 0 represent with 0);
3. meet the data of above two conditions, calculate sudden change ratio by following formula:
Sudden change ratio=saltant type NETMFI ÷ (saltant type NETMFI+ wild-type NETMFI)
4. the sudden change ratio definite threshold (cut-off value) to each detection site rule of thumb, to divide wild-type homozygote, heterozygote and saltant type homozygote.
Use present method to detect 20 increments MAP3K1 gene SNP site originally, experimental data meets above-mentioned requirements, therefore can calculate their sudden change ratio.Arranging of threshold value (cut-off value) is as follows: sudden change ratio range is considered as wild-type homozygote at 0%-20%; 30%-70% is considered as heterozygote; 80%-100% is considered as anomaly homozygote.Detect with liquid-phase chip result and compare with sequencing, calculate the identical rate of classifying method detected result provided by the present invention.Present method detects 20 increments MAP3K1 genotype detection result and the sequencing result rate of coincideing originally and reaches 100%.Visible MAP3K1 gene SNP detection liquid-phase chip provided by the present invention can detect the SNP type of MAP3K1 exactly, and result is reliable and stable.
One of table 4 pattern detection result (MFI)
Table 5 sample MAP3K1 transgenation ratio (%)
Sample number | T148G | C87A | G260A |
1 | 1% | 2% | 1% |
2 | 2% | 2% | 1% |
3 | 1% | 1% | 1% |
4 | 2% | 2% | 3% |
5 | 2% | 2% | 3% |
6 | 2% | 2% | 2% |
7 | 98% | 2% | 1% |
8 | 1% | 1% | 2% |
9 | 2% | 2% | 1% |
10 | 2% | 2% | 3% |
11 | 2% | 2% | 98% |
12 | 3% | 2% | 2% |
13 | 2% | 2% | 1% |
14 | 1% | 1% | 1% |
15 | 2% | 2% | 2% |
16 | 2% | 48% | 2% |
17 | 1% | 2% | 2% |
18 | 1% | 2% | 1% |
19 | 2% | 2% | 2% |
20 | 2% | 2% | 3% |
Table 6 sample MAP3K1 gene mutation type analytical results
The detection of the liquid-phase chip of the ASPE primer that embodiment 3 is different to MAP3K1 gene SNP site
One, the design (selection of Tag sequence and Anti-Tag sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example take MAP3K1 gene T148G, C87A and G260A site mutation, respectively for the wild-type of T148G, C87A and G260A and the specific primer sequence of saltant type design ASPE primer 3 ' end, the Tag sequence of ASPE primer 5 ' end is selected from SEQ IDNO.1-SEQ IDNO.6, accordingly, the anti-tag sequence with corresponding tag sequence complementary pairing being coated on microballoon is selected from SEQ ID NO.13-SEQ ID NO.18.Specific design is as shown in following table (table 7).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Design prepared by table 7 liquid-phase chip
One, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 21-40 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 8 sample MAP3K1 gene T148G detected result and Polymorphism Analysis
Table 9 sample MAP3K1 gene C 87A detected result and Polymorphism Analysis
Table 10 sample MAP3K1 gene G260A detected result and Polymorphism Analysis
From above-described embodiment, other is for the liquid-phase chip in different mutational sites, and ASPE primer uses different tag sequences, and its result is still reliable and stable, and concrete data are omitted.And ASPE primer is while selecting in embodiment 1 collocation of tag sequence and specific primer sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 1, test group 5 and test group 9.Other different tag sequences and specific primer sequence collocation, with coming to the same thing of embodiment 2 and the present embodiment, concrete data are omitted.
The selection of embodiment 4MAP3K1 detection in Gene Mutation specific primer sequence
One, the design (selection of wild-type and saltant type specific primer sequence) that prepared by liquid-phase chip
Detect liquid-phase chip as example take the pleomorphism site of MAP3K1 gene T148G and G260A, take the complementary sequence forward or backwards of this place, mutational site target sequence as template, respectively for the wild-type of T148G and G260A and the specific primer sequence of saltant type design ASPE primer 3 ' end, comprise preferred specific primer sequence and 2 alternative specific primer sequences in the embodiment of the present invention 1, as shown in table 11.Wherein,
interior base is pleomorphism site.
Table 11 specific primer sequence
Detect liquid-phase chip as example take the pleomorphism site of MAP3K1 gene T148G and G260A, select different specific primer sequences for T148G and G260A, the tag sequence of ASPE primer 5 ' end is fixed as the best effect sequence in embodiment 1, and select the anti-tag sequence of answering in contrast, specific design is as shown in following table (table 12).Synthetic, the anti-tag sequence of ASPE primer are coated with microballoon, amplimer, detection method etc. as described in embodiment 1 and embodiment 2.
Two of design prepared by table 12 liquid-phase chip
Two, sample detection
The liquid-phase chip that adopts above-mentioned design to prepare, detects sample 41-60 by testing process described in embodiment 2 and method, and detected result is as follows:
Table 13 sample MAP3K1 gene T148G detected result and Polymorphism Analysis
Table 14 sample MAP3K1 gene G260A detected result and Polymorphism Analysis
From the present embodiment, when ASPE primer is selected in embodiment 1 collocation of specific primer sequence and tag sequence, effect better (signal to noise ratio is better), referring to the present embodiment test group 10 and test group 13.Other derives from different specific primer sequences and the collocation of tag sequence of the complementary sequence forward or backwards of place, target detect site sequence, with coming to the same thing of embodiment 2 and the present embodiment, be still that the specific primer sequence described in embodiment 2 is better from different tag sequence arranging effects, concrete data are omitted.
Other multiple specific primer sequence for different SNP sites and the collocation of tag sequence, with coming to the same thing of embodiment 2 and the present embodiment, the selected Auele Specific Primer of embodiment 1, has better signal to noise ratio, detects effect also better, and concrete data are omitted.
The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Claims (5)
1. a MAP3K1 gene mutation detection liquid-phase chip, is characterized in that, includes:
(A). the wild-type designing respectively for the different mutational sites of MAP3K1 gene and the ASPE primer pair of saltant type: every ASPE primer is made up of for the specific primer sequence in goal gene mutational site tag sequence and the 3 ' end of 5 ' end, described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in T148G site, for SEQ ID NO.9 and the SEQ ID NO.10 in C87A site, and/or for SEQ ID NO.11 and the SEQ ID NO.12 in G260A site; Described tag sequence is selected from SEQ ID NO.1~SEQ ID NO.6;
(B). there is microballoon that different anti-tag sequences are coated with, that there is different colours coding, in the middle of described anti-tag sequence is connected with microballoon, be also provided with spacerarm sequence; Described anti-tag sequence is selected from SEQ ID NO.13~SEQ ID NO.18, and described anti-tag sequence can be correspondingly with (A) in selected tag sequence complementary pairing;
(C). for amplifying the primer that needs the target sequence detecting, there is corresponding mutational site.
2. MAP3K1 gene mutation detection liquid-phase chip according to claim 1, it is characterized in that, described amplimer is: for SEQ ID NO.19 and the SEQ ID NO.20 in T148G site, for SEQ ID NO.21 and the SEQ ID NO.22 in C87A site, and/or for SEQ ID NO.23 and the SEQ ID NO.24 in G260A site.
3. MAP3K1 gene mutation detection liquid-phase chip according to claim 1 and 2, it is characterized in that, described ASPE primer is: for the sequence being made up of SEQ ID NO.1 and SEQ ID NO.7 in T148G site and the sequence that is made up of SEQ ID NO.2 and SEQ ID NO.8, for the sequence being formed by SEQ ID NO.3 and SEQ ID NO.9 in C87A site and the sequence that formed by SEQ ID NO.4 and SEQ ID NO.10, and/or for the sequence being formed by SEQ ID NO.5 and SEQ ID NO.11 in G260A site and the sequence that formed by SEQ ID NO.6 and SEQ ID NO.12.
4. MAP3K1 gene mutation detection liquid-phase chip according to claim 1 and 2, is characterized in that, described spacerarm is 5-10 T.
5. for the Auele Specific Primer of MAP3K1 detection in Gene Mutation, it is characterized in that, described specific primer sequence is: for SEQ ID NO.7 and the SEQ ID NO.8 in T148G site, for SEQ ID NO.9 and the SEQ ID NO.10 in C87A site, and/or for SEQ ID NO.11 and the SEQ ID NO.12 in G260A site.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210512189.3A CN103849938B (en) | 2012-12-04 | 2012-12-04 | MAP3K1 detection in Gene Mutation specific primer and liquid-phase chip |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201210512189.3A CN103849938B (en) | 2012-12-04 | 2012-12-04 | MAP3K1 detection in Gene Mutation specific primer and liquid-phase chip |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103849938A true CN103849938A (en) | 2014-06-11 |
CN103849938B CN103849938B (en) | 2016-08-03 |
Family
ID=50858052
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201210512189.3A Active CN103849938B (en) | 2012-12-04 | 2012-12-04 | MAP3K1 detection in Gene Mutation specific primer and liquid-phase chip |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103849938B (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002059354A2 (en) * | 2001-01-25 | 2002-08-01 | Tm Bioscience Corporation | Polynucleotides for use as tags and tag complements, manufacture and use thereof |
WO2005047533A1 (en) * | 2003-11-17 | 2005-05-26 | Tm Bioscience Corporation | Method of detecting mutations associated with thrombosis |
-
2012
- 2012-12-04 CN CN201210512189.3A patent/CN103849938B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2002059354A2 (en) * | 2001-01-25 | 2002-08-01 | Tm Bioscience Corporation | Polynucleotides for use as tags and tag complements, manufacture and use thereof |
WO2005047533A1 (en) * | 2003-11-17 | 2005-05-26 | Tm Bioscience Corporation | Method of detecting mutations associated with thrombosis |
Non-Patent Citations (2)
Title |
---|
FERGUS J. COUCH ET AL.: "Association of Breast Cancer Susceptibility Variants with Risk of Pancreatic Cancer", 《CANCER EPIDEMIOL BIOMARKERS PREV》, vol. 18, no. 11, 20 October 2009 (2009-10-20), pages 3044 - 3048 * |
吴刘成等: "角膜混浊小鼠突变候选基因Map3k1克隆与序列分析", 《动物医学进展》, vol. 32, no. 4, 31 December 2011 (2011-12-31), pages 1 - 5 * |
Also Published As
Publication number | Publication date |
---|---|
CN103849938B (en) | 2016-08-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103451271A (en) | THADA gene mutation detection specific primer and liquid phase chip | |
CN103374609B (en) | ABO gene mutation detection specific primers and liquid chip | |
CN102191337B (en) | Specific primers and liquid phase chip for detecting polymorphism of cyckin-dependent kinase 5 regulatorysubunit-associated protein 1-like 1(CDKAL1) gene | |
CN102912002B (en) | ABCB2 gene polymorphism detection specific primers and liquid chip | |
CN102191336B (en) | MYC gene single nucleotide polymorphism (SNP) detection specific primer and liquid-phase chip | |
CN102181573B (en) | Specific primers and liquid-phase chip for detection of KITLG gene | |
CN103451272A (en) | BAT3 gene mutation detection specific primer and liquid phase chip | |
CN102952866B (en) | Specific primer and liquid chip for detecting polymorphism of DPYD (dihydropyrimidine dehydrogenase) gene | |
CN103849938B (en) | MAP3K1 detection in Gene Mutation specific primer and liquid-phase chip | |
CN103451266B (en) | NKX3.1 gene mutation detection specific primers and liquid chip | |
CN102888444B (en) | Factor II and Factor V genetic polymorphism detection specific primer and liquid-phase chip | |
CN102191335B (en) | Specific primer and liquid-phase chip for SNP (single nucleotide polymorphism) detection of PIGU (phosphatidylinositol glycan anchor biosynthesis, class U) genes | |
CN102952872B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B3 gene | |
CN102952869B (en) | Specific primer and liquid chip for detecting polymorphism of SLCO1B1 gene | |
CN103849942A (en) | Specific primer and liquid phase chip for detecting TOX3 gene mutation | |
CN102952868B (en) | Specific primer and liquid chip for detecting polymorphism of SLC15A2 gene | |
CN103451273B (en) | TGM5 gene mutation detection specific primer and liquid phase chip | |
CN102952867B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A6 gene | |
CN102952873B (en) | Specific primer and liquid chip for detecting polymorphism of NAT1 (N-acetyltransferase 1) gene | |
CN102304568B (en) | Specific primers and liquid phase chip for polymorphic detection of fibroblast growth factor (FGFR2) gene | |
CN103374611B (en) | LIG3 (DNA (deoxyribonucleic acid) Ligase III) gene mutation detection specific primers and liquid chip | |
CN103374608B (en) | MTRR (5-methyltetrahydrofolate-homocysteine methyltransferase reductase) gene mutation detection specific primers and liquid chip | |
CN103849675B (en) | RTEL1 detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
CN102952870B (en) | Specific primer and liquid chip for detecting polymorphism of SLC22A2 gene | |
CN103849940A (en) | Specific primer and liquid phase chip for detecting BARD1 gene mutation |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |