CN102719447A

CN102719447A - Rapid identification of linum usitatissimum MLO-type powdery mildew resistance genes

Info

Publication number: CN102719447A
Application number: CN2012100950382A
Authority: CN
Inventors: 钱孝英; 袁伟
Original assignee: CHANGSHU ZHITANG TOWN XINSHENG TECHNICAL CONSULTATION SERVICE CO LTD
Current assignee: CHANGSHU ZHITANG TOWN XINSHENG TECHNICAL CONSULTATION SERVICE CO LTD
Priority date: 2012-03-31
Filing date: 2012-03-31
Publication date: 2012-10-10

Abstract

The invention is about rapid identification of linum usitatissimum MLO-type powdery mildew resistance genes, relates to the knowledge of plant comparative genomics, genetics, bioinformatics, and other subjects, and belongs to the field of plant biotechnology science. The rapid identification of linum usitatissimum MLO-type powdery mildew resistance genes of the invention mainly comprises the steps of: 1) downloading the whole genome sequence of linum usitatissimum and collecting MLO-type genes; 2) identifying the MLO-type genes; 3) carrying out an MLO-type gene phylogenetic relationship analysis; and 4) carrying out comparison on the MLO-type powdery mildew genes. The rapid identification of linum usitatissimum MLO-type powdery mildew resistance genes of the invention effectively shortens the mining period of the linum usitatissimum powdery mildew genes, and is beneficial to the rapid identification of powdery mildew genes. By using the identified candidate powdery mildew genes, corresponding co-segregative functional markers (SNP, SCAR, and the like) can be developed, and can be rapidly used for the molecular marker assisted high-accuracy selection of powdery mildew resistance genes. Combined with other resistance gene molecular markers, the creation of multiresistance breeding materials can be carried out to shorten breeding period and improve breeding efficiency. The rapid identification of linum usitatissimum MLO-type powdery mildew resistance genes of the invention lays a foundation for the elaboration of a linum usitatissimum powdery mildew resistance molecular mechanism.

Description

Flax MLO type mildew-resistance gene Rapid identification

Technical field

The present invention is by means of flax order-checking whole genome sequence; Utilize method Rapid identification flax powdery mildew genes such as plant comparative genomics, genetics, information biology and candidate gene strategy, be mainly concerned with the download of flax whole genome sequence, the evaluation of candidate gene; The comparison of gene; Means such as cluster, and then identify powdery mildew gene, belong to the Plant Biotechnology scientific domain.

Background technology

Flax ( Linum usitatissimum) be the annual herb plant of flax family (Linaceae) linum, be phloem fiber crop and the oil crops of extensively cultivating in the world wide.Flax powdery mildew (Flax and Benne powdery mildew) is that flax produces upward a kind of common disease, main flax powder spore bacterium by Deuteromycotina ( Oidium lini Skorie) causing that this germ is mainly infected overground part organs such as flax leaf, stem, flower, disease early period of origination flax leaf, stem and floral organ surface can produce odd pearl powdery spot, i.e. mycelia of germ and conidiophore and conidium; Later stage falls ill when serious, and the pearl meal can expand to whole blade and complete stool on the sick leaf, plant chlorosis or withered.After flax receives the Powdery Mildew infringement; Photosynthetic efficiency reduces, and transpiration intensity increases, and respiration improves; The normal long hair that has had a strong impact on flax is educated; These diseases tend to make flax early withered, and former stem low in glossiness, poor, the numb seed setting percentage of fiber quality is low, thousand seed weight is low, and this produces to flax and brings great loss.For fear of the generation of this type of disease, the grower generally adopts control pathogenic bacteria (as to seed disinfection, field crop rotation, removing invalid thing etc.), improves methods such as cultivation step and chemical prevention in the production.But so not only waste time and energy, fundamentally also can't resolve the generation of disease.Research shows that the most direct method of this type of disease of control is the seed selection disease-resistant varieties; Along with reaching its maturity of molecular engineering; Utilize technological seed selection flax disease-resistant varieties such as molecule marker, transgenic to be developed gradually; We can transfer to fine not in mildew-resistance flax kind with flax mildew-resistance gene for example to utilize transgenic technology, and therefore looking for suitable flax mildew-resistance gene is to utilize molecular engineering to carry out the prerequisite and the guarantee of mildew-resistance breeding.

MLO type disease-resistant gene is one type of special disease-resistant gene of plant.The investigator find the earliest MLO ( MIldew resistance lOcus o ) the gene pairs powder mildew resistance is to start from 1937-1938, gathered the barley of a lot of kinds by the fritz in Ethiopia, two strains systems wherein to the white powder germ ( Blumeria graminisF. sp. Hordei) physiological strains that all oneself know all have efficient resistance.Further research shows, the recessive mutation mlo of MLO gene can make barley that the physiological strain of nearly all oneself knowledge barley powdery mildew bacteria is produced resistance lasting, wide spectrum in the barley.Recently, the investigator finds that the mildew-resistance gene of a lot of plants all is a MLO type Gene Handling, like tomato, and pea, Arabidopis thaliana, rose, capsicum, Root or stem of Littleleaf Indianmulberry or the like.Therefore breeding has important effect to the plant mildew-resistance to excavate MLO type disease-resistant gene in the plant.

At present, the disease-resistant gene method commonly used of excavating commonly used has map based cloning, methods such as transposon tagging.But because the fundamental research of flax is not deep enough, not only the time is long but also very difficult these genes of cloning exactly therefore to utilize these methods.Therefore, how the MLO type disease-resistant gene in Rapid identification flax will become the important prerequisite of flax mildew-resistance breeding.

Plant comparative genomics (Comparative Genomics) is based on Genome Atlas and the order-checking basis, and known gene and genome structure are compared, and understands the subject of function, expression mechanism and the spore of gene.Utilize between model plant genome and other Plant Genome on the coded sequence and structural homology, clone's other plant gene discloses gene function and molecular mechanism, illustrates spore relation and genomic immanent structure.Method that this patent adopted and thinking: the research of model plant arabidopsis gene group has disclosed the function of MLO type gene; Utilize the homology kron MLO type disease-resistant gene on its order of gene; According to the characteristics of meliority on the model plant Arabidopis thaliana experimental system and known MLO type disease-resistant gene, quick " seizure " flax mildew-resistance gene.In recent years, the completion of flax gene order-checking provides condition for our fast mining flax powdery mildew gene.It is prerequisite that this patent has been introduced with flax whole genome sequence, in conjunction with knowledge such as comparative genomics, genetics, genomics, information biology and candidate gene strategy, fast mining powdery mildew gene.

Summary of the invention

Technical problem

The purpose of this invention is to provide a kind of through combining knowledge such as plant comparative genomics, plant genetics, genomics and information biology, fast mining flax mildew-resistance gene.Its result can be used for the exploitation of flax powdery mildew gene compact linkage molecule mark on the one hand, carries out the molecular marker assisted selection breeding, also for other crop powdery mildew gene identification reference frame is provided on the other hand.

Technical scheme

Cardinal principle: first plant mildew-resistance gene (MLO) is cloned from barley, discovers that this gene is one type of special disease-resistant gene, is different from most of NBS (nucleotide-binding site) type disease-resistant gene of previous clone; Subsequently, the investigator has cloned powdery mildew gene in succession from plants such as tomato, Arabidopis thaliana, pea, capsicum, Root or stem of Littleleaf Indianmulberry, and what discover these genes encodings all is MLO type disease-resistant gene.Subsequently, numerous investigators confirm that through test of many times MLO type disease-resistant gene has become one type of mildew-resistance gene of plant specific.Find that further plant MLO type gene is a gene family; And the MLO gene family that derives from different plant species is carried out the Phylogenetic Relationships analysis finds, in the different plant species mildew-resistance gene always cluster become one type together, this type MLO gene all has the characteristic feature of mildew-resistance gene sequence.The completion of flax gene order-checking provides a convenient for excavating powdery mildew gene.Therefore, can identify the flax powdery mildew gene by means of the Phylogenetic Relationships of MLO gene family in the full genome of the flax of having checked order and the MLO powdery mildew gene of having cloned and for the amino acid conservative property of keeping powdery mildew gene MLO critical function.

Key step is following:

1) collection of the download of flax whole genome sequence and MLO type gene thereof

At first download flax whole genome sequence from flax sequenced genes group DB (http://www.phytozome.net/search.php); Use " DNATOOLS " software that the full genome amino acid sequence data of flax that obtains is set up DB; Use pfam DB (protein family DB then; Http:// pfam.janelia.org/search/sequence) hidden Markov model in (HMM) carries out Blastp (E-value=0.001) sequence alignment to the aminoacid sequence of MLO structural domain with the full genome amino acid sequence database of having set up of flax, and preliminary screening goes out candidate gene sequence.Secondly, utilize the MLO type gene order of having announced, flax genome database is carried out the BLAST comparison, obtain candidate gene sequence.

2) evaluation of flax MLO type gene family

With the candidate gene of the homologous nucleotide sequence that obtains in the The above results, analyze through Pfam (E-value=1.0), remove the gene order (Fig. 1) of not having ' MLO ' structural domain.The ClustalW instrument that again candidate's disease-resistant gene sequence is provided through MEGA3.1 software (multisequencing comparison program) carries out the multisequencing comparison, removes Tumor-necrosis factor glycoproteins.

3) Phylogenetic Relationships through plant MLO type gene is identified flax MLO type powdery mildew gene of candidate

Because previous research is verified; Dicotyledons MLO type powdery mildew gene is positioned at the same district of plant MLO Phylogenetic Tree group; Therefore in Phylogenetic Relationships research; We are MLO type mildew-resistance gene and the cluster analysis together of flax MLO type gene of the MLO type gene family of Arabidopis thaliana and some other crops, to obtain flax mildew-resistance gene (Fig. 2) of candidate.

4) comparison of flax powdery mildew gene and known plant MLO powdery mildew gene

Utilize BioXM 2.6 softwares the aminoacid sequence of the MLO powdery mildew gene of flax candidate's MLO type powdery mildew gene and Arabidopis thaliana, tomato, pea, barley to be converted to the file of Fasta form; These files are imported BioEdit 7.0 softwares; Use in this software Clustal software to carry out the multisequencing comparison, disclose the conservative property in candidate's powdery mildew gene important amino acid residue and zone.Thereby further identify flax candidate's powdery mildew gene (Fig. 3).

Positively effect of the present invention:

1) shortens the flax powdery mildew gene excavating cycle, helped the Rapid identification of powdery mildew gene.Employing ordinary method (map based cloning, transposon tagging etc.) excavation mildew-resistance gene not only takes time and effort, efficient is low, and is difficult to successfully.The present invention is based on plant comparative genomics, genetics, bioinformatics method fast mining flax powdery mildew gene, not only can shorten the time, can also improve powdery mildew gene and identify efficient.

2) flax ( Linum usitatissimum) belong to the flax family (Linaceae) linum.Linum usitatissimum is divided into fiber with type, oily with type and sesame oil dual-purpose flax.Flax also cries flax, is one of China 5 big oil crops, and being not only oil crops also is fibre crops, concentrates the arid extremely frigid zones such as Heilungkiang that originate in northwest, North China and northeast.Because flax hereditary basis is narrow, the germ plasm resource variety is low, therefore identifies flax powdery mildew genetic comparison difficulty through conventional molecule marker (RAPD, ISSR, SSR, AFLP etc.).The candidate's powdery mildew gene exploitation that is tested and appraised is divided into from functional mark (SNP, SCAR etc.) accordingly, can be used for the molecular marker assisted selection of disease-resistant gene fast, and accuracy is high.

3) initiative of multiresistance breeding material.Based on the functional molecular marker of the powdery mildew gene of new evaluation exploitation, combine the molecule marker of localized other disease-resistant genes, carry out the initiative of multiresistance breeding material, can shortening the breeding cycle, the raising breeding efficiency.

4) lay a good foundation for setting forth flax mildew-resistance molecular mechanism.The evaluation of flax mildew-resistance gene; Gene silencing (virus induced gene silencing through transgenic technology, RNAi, virus induction; VIGS) molecular mechanism of research mildew-resistance such as technology provides genetic resources, helps setting forth fast the mechanism of action of flax mildew-resistance.

Description of drawings

The evaluation of Fig. 1 flax MLO gene;

That this figure shows is 30 MLO type gene identification results, and each gene all contains ' MLO ' conserved domain.

The evaluation of the Phylogenetic Relationships analysis of Fig. 2 plant MLO gene family and flax MLO type powdery mildew gene thereof;

Arabidopis thaliana is the model plant of plant science research; Grow in the tree at constructing system; The powdery mildew gene (PsMLO) of 15 MLO type genes of Arabidopis thaliana (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12), tomato mildew-resistance gene (SlMLO), barley powdery mildew gene (HvMLO and HvMLO02) and pea is selected and is used for and the cluster analysis of flax MLO type gene.Identify 5 flax candidates' MLO type powdery mildew gene altogether.The gene of italic mark is exactly candidate's flax powdery mildew gene among the figure.

The compare of analysis of Fig. 3 flax MLO type powdery mildew gene;

5 flax powdery mildew genes and barley (HvMLO), tomato (SlMLO), pea (PsMLO), Arabidopis thaliana powdery mildew gene (AtMLO02; AtMLO06 and AtMLO12) compare, identify that powdery mildew infects the amino-acid residue and regional conservative type that plays an important role.TM1-TM7 representes 7 revolving die zones of flax MLO type powdery mildew gene among the figure; The black round dot representes that powdery mildew infects important amino-acid residue; CaMBD representes the calmodulin land; I and II represent powdery mildew is infected important amino acid region.

Embodiment

The evaluation of disease-resistant gene has important effect in research of crop disease-resistant theory of heredity and disease-resistant variety seed selection.Present method can Rapid identification go out the flax powdery mildew gene.The practical implementation process is following:

1) collection and the evaluation of flax MLO type gene

In order to obtain the whole MLO type gene family member of flax; We are at first with the MLO type gene of Arabidopis thaliana; The mildew-resistance MLO gene order of tomato, pea, capsicum, rose, capsicum, Root or stem of Littleleaf Indianmulberry makes up the HMM model, from flax genome sequence, receives rope MLO type gene; Secondly with the MLO gene order delivered in the Different Crop as target sequence (from DFCI DB: TC171015, TC267529, DFCI:TC327983, TC289653, TC312087, TC132500; TC133436, TC317623, TC317025, TC315947, TC325903, TC315944; TC315912, TC322759, TC322059, TC330654, TC282713, TC293173; TC281861, TC283253, TC283383, TC285032, TC290021, TC302716; TC283487, TC282866, TC283441, TC281428, TC285118, TC285090; From GenBank DB: AY967408, AF384145, AF384144; AY029312-AY029315, AY029317-AY029319, Z95352; AF369563-AF369565, AF369567, AF369569-AF369576; Z83834, Z95496, AY581255); Flax DB (http://www.phytozome.net/search.php) is carried out the BLAST comparison, select the highest sequence of similarity to download, obtained 30 candidates' MLO type gene (Lus10043085.g altogether; Lus10025457.g; Lus10036519.g; Lus10036120.g; Lus10036121.g; Lus10040388.g; Lus10042397.g; Lus10032669.g; Lus10016035.g; Lus10019630.g; Lus10011630.g; Lus10011632.g; Lus10012698.g; Lus10041893.g; Lus10012241.g; Lus10041410.g; Lus10012410.g; Lus10027093.g; Lus10022096.g; Lus10013211.g; Lus10030729.g; Lus10028440.g; Lus10008340.g; Lus10001292.g; Lus10015461.g; Lus10026276.g; Lus10015328.g; Lus10023506.g; Lus10001370.g; Lus10001336.g; ).

2) evaluation of flax MLO type gene family

In order further to verify these MLO gene accuracys, we have carried out the evaluation of conserved domain " MLO " to these 30 candidates' MLO gene.Aminoacid sequence with each candidate's MLO type gene is a benchmark, on PFAM (http://pfam.sanger.ac.uk/) website, carries out the evaluation of ' MLO ' conserved domain, and concrete outcome is seen Fig. 1.

3) the Phylogenetic Relationships analysis of flax MLO type gene

In the research formerly, find that the dicotyledons powdery mildew gene aggregates into district's group; Therefore; Grow in the tree at constructing system; We have selected powdery mildew gene and flax MLO type gene cluster analysis cluster analysis together of 15 MLO type genes (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12), tomato mildew-resistance gene, barley powdery mildew gene and the pea of model plant Arabidopis thaliana.Flax MLO type gene and other crop powdery mildew gene protein sequences are carried out the multisequencing couplet join (adopting Clustal X 1.83 softwares to carry out), and utilize Genedoc software (http://www.nrbsc.org/gfx/genedoc/index.html) to show that multisequencing joins the result who joins.The Clustal multisequencing is joined the result who joins output in MEGA 4.0 softwares, and (neighbor-joining NJ), utilizes the Bootstrapping method that these evolutionary trees are assessed to utilize this software to make up the adjacency tree respectively.The result finds in dicotyledons mildew-resistance gene district group, to have 5 flax candidates' MLO type powdery mildew gene (see figure 2).

4) comparison of flax MLO type disease-resistant gene

In the research of barley MLO type powdery mildew gene, found some important areas and single amino acids in the research in succession, they infect big wheat powdery mildew has irreplaceable effect.In the flax powdery mildew gene of identifying 5 candidates; Whether these important areas and amino acid high conservative, and we have carried out compare of analysis to 3 mildew-resistance genes (AtMLO02, AtMLO6 and AtMLO12), tomato powdery mildew gene (SlMLO), the powdery mildew of pea gene (PsMLO) from Arabidopis thaliana.5 candidates' of discovery flax powdery mildew gene and 7 of known MLO type powdery mildew genes are striden the film district, 30 important amino acid, 1 calmodulin land (CaMBD) and two important zone (I and II) high conservatives (Fig. 3).

Claims

1. flax mildew-resistance gene is characterized in that being selected from one of following 5 genes or its:

Lus10036120.g

Amino acid:

MAGATGGRSLEETPTWAVAAVCFVLVLISIIIEHIIHLIGRWLKKKHKRALYQALEKVKAELMLLGFISLLLTVGQDPISRICISKKLGSTWHPCGKTPAHDEHSPTPTDEDEVEGDNRRRLLTKAAAYYASSSSGTNSTNLRRVLAGATEDKCAAKGQVPFVSSDGIHQLHIFIFVLAVFHVIYCILTMALGRAKVCFWRQFVRSVPKVDYLTLRHGFIMAHLAPQSHTKFDFQKYINRSLDEDFKVVVGISPPIWFFAVLFLLFNTHGWYSYLWLPFIPLVMILLVGTKLQVIITKMGRRIQERGEVVVKGVPLVQPGDHLFWFNCPRLLLYLVNFVLFQNAFQLAFFAWTWKEFGLKSCFHEHLEDIIIRISMGVLIQILCSYVTLPLYALVTQMGSTMKPTIFDEKVATALRKWHHTARNNIKHNKSLSSVSPMSSRPTTPSHHQSPIHLLCNHRPLNLAADTIQNSPNIDWYSESPSPVHHYDGDTNHNYCLEESPSTRNTQLQVQTHNHSTLEVPAATYYDGEEKEEEAGGISSQVALNPQPENAQHEIDIIRNEFSFDRRTTL

Nucleotide:

ATGGCCGGAGCGACTGGCGGAAGATCTCTGGAGGAAACGCCGACATGGGCCGTGGCCGCCGTTTGCTTTGTATTGGTCTTGATTTCCATTATCATTGAGCACATCATTCATCTTATTGGAAGGTGGTTAAAGAAGAAGCACAAGCGAGCTCTGTACCAAGCACTTGAGAAAGTTAAAGCAGAGCTGATGCTGCTGGGATTCATATCGTTGCTTCTAACGGTGGGACAGGATCCCATTTCCAGAATATGTATATCGAAGAAACTGGGATCCACGTGGCATCCTTGTGGCAAGACACCAGCTCATGATGAGCACTCACCAACGCCTACCGATGAGGATGAAGTGGAGGGAGATAACCGCCGCCGGCTCTTGACGAAGGCTGCTGCTTATTATGCATCGTCATCTTCCGGCACAAATAGCACCAATCTCAGACGTGTTCTAGCTGGCGCTACAGAAGACAAATGTGCGGCCAAGGGTCAAGTGCCATTTGTGTCTTCTGATGGGATTCATCAGCTCCATATTTTCATATTTGTGTTGGCCGTCTTCCACGTCATCTATTGTATCCTAACTATGGCGTTGGGCAGAGCCAAGGTTTGCTTTTGGAGGCAGTTTGTGAGGTCGGTTCCTAAAGTCGACTACCTGACGTTGAGGCATGGATTTATCATGGCACATTTGGCACCGCAAAGCCACACCAAATTCGACTTCCAGAAATACATCAACCGATCCTTGGATGAAGATTTCAAAGTGGTTGTGGGAATAAGTCCACCAATTTGGTTCTTCGCGGTGCTTTTCCTCCTATTCAACACCCATGGGTGGTATTCGTATCTGTGGCTGCCTTTTATCCCTTTGGTTATGATATTGTTGGTGGGGACGAAGCTACAGGTGATAATAACGAAGATGGGAAGGAGAATACAGGAGAGAGGGGAGGTGGTTGTTAAGGGGGTCCCGTTGGTTCAACCAGGAGACCATCTCTTCTGGTTCAACTGCCCACGCCTCCTCCTCTACCTTGTCAATTTCGTCCTCTTCCAGAATGCTTTCCAACTCGCCTTCTTTGCCTGGACCTGGAAAGAATTTGGGTTAAAGTCATGTTTCCATGAGCATTTGGAGGACATAATCATCAGAATTTCAATGGGGGTGCTCATACAAATACTATGTAGCTACGTTACTCTGCCGCTCTACGCCCTTGTCACCCAGATGGGTTCGACGATGAAGCCAACTATATTCGACGAGAAAGTGGCGACCGCTTTGCGCAAGTGGCACCATACCGCTAGAAACAACATCAAACATAACAAGTCATTAAGCTCCGTGTCCCCAATGTCTAGCAGACCCACCACTCCTTCTCACCATCAATCCCCAATCCACCTCCTCTGTAACCACCGCCCCCTCAATTTGGCTGCTGACACTATTCAGAACTCTCCTAACATCGACTGGTACAGTGAGTCTCCCTCTCCAGTTCACCATTACGACGGAGACACCAACCATAATTATTGCTTGGAGGAGAGCCCGTCGACGCGTAACACTCAATTACAAGTGCAAACACATAATCATAGCACCTTGGAAGTCCCTGCTGCTACATATTACGACGGTGAAGAAAAAGAAGAAGAAGCGGGAGGTATTTCGAGTCAGGTTGCTCTGAACCCGCAGCCAGAGAATGCGCAACATGAAATTGACATCATAAGAAATGAATTTTCATTCGATCGAAGAACAACACTATGA

Lus10036519.g

Amino acid:

MADKANMERTLEETPTWAVAAVCFVLVVISIFIEHIIHLIHKWLHKLHKPALVEALEKVKAELMLLGFLSLLLTVFQSPISSICVSRKIGGTWHPCTKKEEKSVDDSGENRRRLLGFLDSDMIPRRSLATKGVDKCTEQGKVAFVSAYGIHQLHIFIFVLAFFHILYCIITYILGRTKMRKWRQWENKTKTLEYQYHNDPERFRFARDTSFGRRHLKMWSKSTILLWIVSFFRQFFRSVTKVDYMTLRHGFIAAHLAPGSESRFDFQKYVNRSLEDDFKVVVGISPILWFFAVLFLLSNTHGWVAYLWLPFIPLIIILVVGTKLQVIITQLGLSIQDRGDVVKGAPVVQPGDDLFWFGRPRLVLFLIHFCLFQNAFQLAFFIWSVYEFGIKTCFHEKTEDIVIRITMGVIIQVLCSYVVLPLYALVTQMGSNMRPTIFNDRVASALKNWHRTARRQTRHGGSHTPTSSRPATPTHGMSPVHLLHNYRSSTAPDSLMNSPARNSNFDNDHWDPEALNSPSHHQYSSHGGGGHRELDEFHHEFHHDASLRDQPGGEDEDVVVAVRNQELRGAAASEEMQLPPGPGSIRTHHEMNIGLSDFTFRKG

Nucleotide:

ATGGCGGACAAAGCCAACATGGAAAGGACTCTGGAAGAGACGCCTACTTGGGCTGTCGCCGCCGTCTGTTTCGTCCTCGTCGTCATTTCCATCTTCATTGAGCATATCATCCACCTTATCCATAAGTGGTTGCATAAACTGCACAAGCCAGCGCTGGTGGAAGCACTGGAGAAAGTGAAAGCGGAGCTGATGCTGCTGGGATTCCTGTCCTTGCTGCTCACAGTATTTCAATCCCCAATCTCGAGTATTTGCGTCTCTAGAAAGATTGGAGGGACTTGGCATCCTTGTACCAAAAAGGAAGAGAAAAGCGTAGATGATTCAGGGGAAAACCGGCGCCGCCTTCTGGGGTTTTTAGATTCTGATATGATTCCTAGACGAAGCTTAGCGACAAAAGGCGTTGACAAGTGTACTGAACAGGGAAAAGTTGCGTTTGTTTCAGCATACGGTATCCACCAGCTGCATATATTTATCTTTGTGCTGGCGTTTTTCCACATCCTTTACTGCATCATCACCTATATTCTAGGCAGAACCAAGATGCGGAAGTGGAGGCAGTGGGAGAATAAGACCAAAACACTTGAGTATCAGTATCATAACGATCCAGAGAGATTTAGGTTTGCAAGAGATACATCTTTTGGGCGGCGCCACTTGAAAATGTGGAGCAAGTCTACTATTCTGCTTTGGATTGTCAGCTTCTTCAGGCAGTTCTTTAGATCGGTTACCAAAGTCGATTACATGACACTGAGACATGGATTCATAGCGGCACATTTAGCTCCTGGAAGTGAGAGCAGATTCGACTTCCAGAAATACGTCAACAGATCACTTGAGGATGACTTCAAAGTTGTTGTAGGGATCAGTCCGATTCTATGGTTTTTTGCAGTCTTGTTCCTGCTATCCAATACACATGGATGGGTAGCATATCTGTGGCTACCCTTTATTCCACTAATCATAATCCTGGTTGTTGGTACAAAGCTACAAGTGATCATAACCCAGCTAGGACTAAGCATACAAGACAGAGGAGATGTGGTGAAGGGTGCCCCTGTGGTTCAGCCAGGAGATGACCTCTTCTGGTTTGGACGCCCTCGTCTCGTTCTCTTCCTCATCCATTTCTGCCTCTTCCAGAATGCATTTCAACTTGCTTTCTTCATATGGAGTGTGTATGAATTCGGAATCAAAACTTGCTTCCACGAGAAAACCGAGGACATTGTCATCAGAATCACCATGGGGGTGATCATTCAAGTGTTATGCAGTTACGTGGTTCTACCGCTATACGCCCTAGTGACTCAAATGGGTTCAAACATGAGACCCACAATATTCAACGACAGAGTAGCGTCGGCGCTGAAGAACTGGCACAGAACGGCCAGGAGGCAGACGAGACATGGTGGATCCCACACCCCGACTTCAAGCCGGCCTGCAACACCAACCCACGGCATGTCCCCTGTACACCTCCTCCACAATTACCGGAGCAGCACTGCTCCAGACAGCCTCATGAACTCTCCAGCCAGGAATTCCAACTTCGACAACGATCATTGGGACCCTGAGGCTCTCAACTCTCCTTCTCACCACCAATATAGCAGCCACGGTGGCGGCGGCCACAGGGAGCTTGACGAGTTCCACCATGAGTTCCACCACGATGCCAGCCTGAGGGATCAACCAGGAGGGGAGGATGAGGATGTTGTGGTGGCTGTGAGAAATCAAGAGCTCCGGGGAGCGGCTGCCTCTGAGGAGATGCAGCTGCCACCGGGCCCCGGGTCGATCAGGACCCACCATGAGATGAACATTGGGCTGTCGGACTTTACATTCCGGAAAGGATGA

Lus10041410.g

Amino acid:

MADKANMERTLEETPTWAVAAVCFVLVVISIFIEHIIHLIHKWLHKLHKPALVEALEKVKAELMLLGFLSLLLTVFQSPISSICVSREIGGTWHPCTKKEEKSKDDSGENRRRLLGFLDPDMIPRRSLATKGVDKCTEQGKVAFVSAYGIHQLHIFIFVLAFFHILYCIITYILGRTKMRKWRQWEDETKTLEYQYHNDPERFRFARDTSFGRRHLKMWSKSTILLWIVSFFRQFFRSVTKVDYMTLRHGFIAAHLAPGSESRFDFQKYVNRSLEDDFKVVVGISPILWFFAVLFLLSNTHGWVAYLWLPFIPLIIILVVGTKLQVIITQLGLSIQDRGDVVKGAPVVQPGDNLFWFGRPRLVLFLIHFCLFQNAFQLAFFIWSVYEFGIKTCFHEKTEDIVIRITMGVIIQVLCSYVVLPLYALVTQMGSNMRPTIFNDRVASALKNWHRTARRQTRHGGSHTPTSSRPATPTHGMSPVHLLHNYRSSTAPDSLMNSPARNSNFDNDHWDPEALNSPSPHQYSSHGGGDHRELDEFHHEFHHDASLRDQPGGEAEDVVVAVRNQELRGAAASEEMQLPPGPGSIRTQHEMNIGLSDFTFRKG

Nucleotide:

ATGGCAGACAAAGCCAACATGGAAAGGACTCTGGAAGAGACGCCAACTTGGGCTGTCGCCGCCGTCTGTTTCGTCCTCGTCGTCATTTCCATCTTCATTGAGCATATCATCCACCTCATCCATAAGTGGTTGCATAAACTGCACAAGCCAGCGCTGGTGGAAGCGCTGGAGAAAGTGAAAGCGGAGCTGATGCTGCTTGGATTCCTGTCCTTGCTGCTCACAGTATTTCAATCCCCAATATCGAGTATTTGCGTCTCTAGAGAGATTGGAGGGACTTGGCATCCTTGTACCAAAAAGGAAGAGAAAAGCAAAGATGATTCAGGGGAAAACCGGCGCCGCCTCCTGGGGTTCTTAGATCCTGATATGATTCCTAGACGAAGCTTAGCGACAAAAGGCGTTGACAAGTGTACTGAACAGGGAAAAGTTGCGTTTGTTTCAGCATACGGTATCCACCAGCTGCATATATTTATCTTTGTGCTGGCGTTTTTCCACATCCTTTACTGCATCATCACCTATATTCTAGGCAGAACTAAGATGCGGAAGTGGAGGCAGTGGGAGGATGAGACCAAAACACTTGAGTATCAGTATCATAACGATCCAGAGAGATTTAGGTTTGCAAGAGATACATCTTTTGGGCGGCGCCACTTGAAAATGTGGAGCAAGTCTACTATTCTGCTTTGGATTGTCAGCTTCTTCAGGCAGTTCTTTAGATCGGTTACCAAAGTCGATTACATGACGCTGAGACATGGATTCATAGCGGCACATTTGGCTCCTGGAAGTGAGAGCAGATTTGATTTCCAGAAATACGTCAACAGATCACTTGAGGATGATTTCAAAGTTGTTGTAGGGATCAGTCCGATTCTATGGTTTTTTGCAGTCTTGTTCCTACTATCCAATACACATGGATGGGTAGCATATCTGTGGCTACCCTTTATTCCATTAATCATAATCTTGGTTGTTGGTACAAAGCTACAAGTGATCATAACCCAGCTAGGGCTAAGCATACAAGACAGAGGAGATGTGGTAAAGGGTGCCCCTGTGGTTCAGCCAGGAGATAACCTCTTCTGGTTTGGACGCCCTCGCCTCGTTCTCTTCCTCATCCATTTCTGCCTCTTCCAAAATGCATTTCAACTTGCTTTCTTCATATGGAGTGTGTACGAATTCGGAATCAAAACTTGCTTCCACGAGAAAACCGAGGACATTGTCATCCGAATCACCATGGGGGTGATCATTCAAGTGCTATGCAGTTACGTGGTTCTACCGCTATACGCCCTAGTGACTCAAATGGGTTCAAACATGAGACCCACAATATTCAACGACAGAGTAGCGTCGGCTTTGAAGAACTGGCACAGAACGGCTAGAAGACAGACGAGACATGGTGGATCCCACACCCCGACTTCGAGCCGGCCTGCAACGCCAACCCATGGCATGTCCCCTGTACACCTCCTCCACAATTATCGGAGCAGCACTGCTCCAGACAGCCTCATGAACTCTCCAGCTAGGAATTCCAACTTCGACAACGATCATTGGGACCCTGAGGCTCTCAACTCTCCTTCCCCCCACCAATATAGCAGCCACGGTGGCGGCGACCACAGGGAGCTTGACGAGTTCCACCATGAGTTCCACCACGATGCCAGCCTGAGGGATCAACCAGGAGGGGAGGCTGAGGATGTTGTGGTGGCTGTGAGAAATCAAGAGCTCCGGGGAGCGGCTGCCTCTGAGGAGATGCAGCTGCCACCGGGCCCCGGGTCGATCAGGACGCAGCATGAGATGAACATTGGGTTGTCGGACTTCACATTCCGGAAAGGATGA

Lus10040388.g

Amino acid:

MAGGGDYERTLEETPTWAVAAVCFVLVVISIFIEHLIHLAHKSLHKLHKPALVEALEKVKAELMLLGFISLLLTVFQDPISGICISKSAGATWHPCTSKQEKEAEHEEEDGEESHRRRRLLLEFLGPVRRSLASKGGDKCADKGKVAFVSAYGIHQLHIFIFVLAVFHIIYCIITYILGRTKMRKWRAWEDETKTLQYQYHNDPERFRFARDTSFGRRHMNIWSKTTISLWIGCFFRQFYGSVTKVDYMTLRHGFITAHLAPGSENRFDFQKYVNRSLEDDFKEVVGISPVLWFVAVMLLLSNTHGWFAYLWLPFIPLIIILVVGTKLQVIIAQLGLRIQDRGDVVKGAPVVQPGDDLFWFSRPRLVLFLIHFCLFQNAFQLAFFIWSVYEFGISTCFHEKTEDIVLRVVMGVIIQVLCSYVTLPLHALVTQMGSNMRPTIFNDRVATALKNWHRTAKRHTRHGGGAKSGSHTPTSSRPGTPSRGMSPVHLLHNYRDSTGPDSVMSSPARNSYDRWDPESLISPVHHPHHHRYYGSSHGGSNGGYREADEFQQNVGSLGQQMEVEDVVVAVRNQEARVPAATRLPPGLESVRRQQERNVGLADFTFRKG

Nucleotide:

ATGGCGGGAGGCGGCGACTATGAACGGACTTTGGAGGAGACTCCGACGTGGGCCGTCGCCGCCGTCTGCTTTGTGCTGGTCGTCATTTCCATCTTCATTGAACATCTCATCCATCTCGCCCATAAGTCGTTGCATAAGCTGCACAAGCCAGCTCTTGTGGAAGCGTTGGAGAAAGTGAAAGCTGAGCTAATGCTCTTAGGATTCATATCGTTGCTTCTCACAGTATTCCAAGACCCGATCTCAGGAATCTGCATCTCGAAAAGCGCTGGAGCGACTTGGCATCCTTGTACTTCGAAGCAGGAGAAAGAAGCAGAGCATGAGGAAGAAGACGGAGAGGAAAGCCATCGCCGGCGGCGGCTGCTTTTGGAGTTCTTGGGACCTGTCCGGCGTAGCTTGGCATCGAAAGGCGGCGATAAATGCGCAGACAAGGGAAAAGTTGCGTTTGTTTCAGCGTATGGTATCCACCAGCTGCATATATTCATCTTTGTGTTGGCTGTTTTCCACATCATTTACTGCATCATCACCTATATTCTTGGCAGAACCAAGATGAGGAAGTGGAGAGCATGGGAGGATGAGACCAAGACGCTTCAGTATCAGTATCATAATGATCCTGAGAGGTTTAGGTTTGCAAGAGATACATCTTTCGGGAGGCGACATATGAACATATGGAGCAAGACTACGATTTCTCTTTGGATTGGATGCTTCTTTAGGCAGTTTTATGGATCAGTTACCAAGGTCGATTACATGACCTTGAGACATGGATTCATCACGGCACATTTGGCTCCTGGAAGTGAGAACAGATTTGACTTCCAGAAATACGTCAACAGATCACTTGAGGATGACTTCAAAGAAGTTGTAGGGATCAGTCCAGTTTTGTGGTTCGTTGCAGTAATGCTCCTGCTATCTAACACACATGGATGGTTTGCTTATCTGTGGCTACCCTTTATTCCATTAATTATAATCCTGGTGGTTGGTACGAAGCTGCAAGTGATCATAGCCCAGCTGGGTCTGAGGATTCAGGACAGAGGGGATGTGGTTAAAGGAGCTCCGGTGGTTCAGCCGGGAGATGATCTCTTCTGGTTCAGTCGACCTCGTCTCGTTCTCTTCCTCATCCATTTCTGCCTCTTTCAGAACGCTTTCCAGCTCGCTTTCTTCATCTGGAGCGTGTACGAATTTGGAATCAGTACTTGCTTCCACGAGAAAACTGAGGACATTGTCCTCCGAGTTGTAATGGGGGTGATAATCCAAGTGCTGTGCAGTTATGTGACACTGCCACTACACGCATTAGTAACTCAAATGGGATCAAACATGAGGCCAACAATATTCAACGACAGAGTAGCCACAGCGCTCAAGAACTGGCACCGGACGGCCAAGAGACACACCAGGCACGGCGGAGGCGCAAAGTCAGGATCCCACACTCCGACTTCCAGCCGGCCAGGGACGCCAAGCCGCGGCATGTCCCCTGTTCACCTCCTCCACAATTACCGGGACAGCACCGGCCCTGACAGCGTAATGAGTTCTCCGGCCAGGAATTCCTACGACCGGTGGGATCCCGAGTCTCTTATCTCGCCTGTTCACCACCCCCACCACCACCGCTACTACGGAAGCAGCCACGGTGGAAGCAACGGTGGATACCGGGAGGCGGATGAGTTCCAACAGAATGTCGGTAGCTTGGGGCAGCAGATGGAGGTTGAAGACGTTGTGGTGGCGGTGAGGAATCAAGAGGCCAGAGTACCGGCAGCCACGAGGCTTCCGCCGGGGCTGGAGTCTGTGAGGAGGCAGCAGGAGAGAAACGTTGGTTTGGCGGATTTTACGTTCAGGAAAGGATGA

Lus10023506.g

Amino acid:

MAGGGDYERTLEETPTWAVAAVCFVLVVISIFIEHLIHLAHKSLHKLHKPALVEALEKVKAELMLLGFISLLLTVFQDPISGICISKSAGASWHPCTSKQEKEAEEGEEEGEESHRRRRLLLEFLGPVRRSLASKGGDKCADKGKVAFVSAYGIHQLHIFIFVLAVFHIIYCIITYILGRTKMRKWRAWEDETKTLQYQYHNDPERFRFARDTSFGRRHMNIWSKTTISLWIGCFFRQFYGSVTKVDYMTLRHGFITAHLAPGSENRFDFQKYVNRSLEDDFKEVVGISPVLWFVAVMLLLSNTHGWFAYLWLPFIPLIIILVVGTKLQVIIAQLGLRIQDRGDVVKGAPVVQPGDDLFWFSRPRLVLFLIHFCLFQNAFQLAFFIWSVYEFGIKTCFHEKTEDIVIRVVMGVIIQVLCSYVTLPLHALATQMGSNLVTQMGSNMRPTIFNDRVATALKNWHRTAKRHTRHGGAKSGSHTPTSSRPGTPSRGMSPVHLLHNYRGSTGPDSVMSSPARNSYDRWDPESLNSPVHHHHHRYYGSSHGGSNGGYREADEFQQNAARLAQQMEVEDVVVAVRNQEARVPAGGGEAEGGLAAGHEASAGAGVCEEAAGEKRWFGGFYVQERMSERIISCFEKREMYICVSSSLCRS

Nucleotide:

ATGGCGGGAGGTGGCGACTATGAACGGACTTTGGAGGAGACTCCGACGTGGGCCGTCGCCGCCGTCTGCTTTGTGCTGGTCGTCATTTCCATATTCATTGAACACCTCATCCATCTCGCCCATAAGTCGTTGCATAAGCTGCACAAGCCAGCACTGGTGGAAGCATTGGAGAAAGTGAAAGCTGAGCTAATGCTCTTAGGATTCATATCGTTGCTTCTCACAGTGTTCCAAGACCCGATCTCAGGAATCTGCATCTCGAAAAGTGCTGGAGCGAGTTGGCATCCTTGTACTTCGAAGCAGGAGAAAGAAGCAGAAGAGGGTGAAGAAGAAGGCGAGGAAAGCCATCGCCGGCGGCGACTGCTTTTGGAGTTCTTGGGACCTGTCCGGCGTAGCTTGGCGTCGAAAGGCGGCGATAAATGCGCAGACAAGGGAAAAGTTGCGTTTGTTTCAGCGTATGGTATCCACCAGCTGCATATATTCATCTTTGTGTTGGCTGTTTTCCACATCATTTACTGCATCATCACCTATATTCTTGGCAGAACCAAGATGAGGAAGTGGAGGGCATGGGAGGATGAGACCAAGACGCTTCAGTATCAGTACCATAATGATCCTGAGAGGTTTAGGTTTGCAAGAGATACATCTTTCGGGAGGCGACATATGAACATATGGAGCAAGACTACGATTTCTCTTTGGATTGGGTGCTTCTTTAGGCAGTTTTATGGATCAGTTACCAAGGTCGATTACATGACCTTGAGACATGGATTCATCACGGCACATTTGGCTCCTGGAAGTGAGAACAGATTTGACTTCCAGAAATACGTCAACAGATCACTTGAGGATGACTTCAAAGAAGTTGTAGGGATCAGTCCGGTTTTGTGGTTCGTTGCAGTAATGCTCCTGCTATCTAACACACATGGATGGTTTGCTTATCTGTGGCTACCTTTTATTCCATTAATTATAATCCTGGTGGTTGGTACGAAGCTGCAAGTGATCATAGCCCAGCTGGGTCTGAGGATTCAGGACAGAGGGGATGTGGTTAAAGGAGCTCCGGTGGTTCAGCCGGGAGATGATCTCTTCTGGTTCAGTCGACCTCGTCTCGTTCTCTTCCTCATCCATTTCTGCCTCTTTCAGAACGCTTTTCAGCTCGCTTTCTTCATCTGGAGCGTGTACGAATTTGGAATCAAAACTTGCTTCCACGAGAAAACTGAGGACATTGTCATCCGAGTTGTAATGGGGGTGATAATCCAAGTGCTGTGCAGTTACGTGACACTGCCACTACACGCACTAGCAACTCAAATGGGATCAAACCTAGTAACTCAAATGGGATCAAACATGAGGCCAACAATATTCAACGACAGAGTAGCCACAGCGCTCAAGAACTGGCACCGGACGGCGAAGAGACACACCAGGCACGGCGGTGCAAAGTCAGGATCCCACACTCCGACTTCCAGCCGGCCAGGGACGCCAAGTCGCGGCATGTCCCCTGTTCACCTCCTCCACAATTACCGGGGCAGTACCGGCCCCGACAGCGTAATGAGTTCTCCGGCAAGGAATTCCTACGACAGGTGGGACCCCGAGTCTCTTAATTCGCCTGTTCACCACCACCACCACCGTTACTACGGAAGCAGCCACGGTGGAAGCAACGGCGGATACCGGGAGGCGGATGAGTTCCAACAGAATGCTGCGAGGCTGGCGCAGCAGATGGAAGTTGAAGACGTTGTGGTGGCGGTGAGGAATCAAGAGGCCAGAGTACCGGCGGGCGGAGGTGAGGCAGAGGGCGGGCTAGCCGCCGGCCACGAGGCTTCCGCCGGGGCTGGAGTCTGTGAGGAGGCAGCAGGAGAGAAACGTTGGTTTGGCGGATTTTACGTTCAGGAAAGGATGAGTGAAAGGATAATTAGTTGTTTTGAGAAGAGGGAAATGTACATTTGTGTTTCTTCTAGTCTATGTAGATCATGA。

2. the application of the said Rapid identification flax powdery mildew of claim 1 gene comprises:

1) initiative of breeding material.

3.2) breeding practice of mildew-resistance.

4.3) mildew-resistance fundamental research.