CN104561033A

CN104561033A - Rapid identification on wheat MLO type powdery mildew gene

Info

Publication number: CN104561033A
Application number: CN201310524992.3A
Authority: CN
Inventors: 钱孝英; 钱春桃
Original assignee: Changshu City Duqiao Rice Professional Cooperatives
Current assignee: Changshu City Duqiao Rice Professional Cooperatives
Priority date: 2013-10-28
Filing date: 2013-10-28
Publication date: 2015-04-29

Abstract

The invention discloses a method for rapid identification on a wheat MLO type powdery mildew gene, relates to subject knowledge of plant comparative genomics, genetics, bioinformatics and the like, and belongs to the scientific field of plant biological techniques. The method mainly comprises the following steps: 1) downloading of a wheat whole genome sequence, and acquiring the MLO type gene; 2) identifying the MLO type gene; 3) confirming the phylogenetic relationship of the MLO type gene; and 4) comparing the MLO type powdery mildew gene. By adopting the method, the wheat downy mildew resistance gene discovery period is effectively shortened, and rapid identification on a downy mildew gene is facilitated; corresponding co-separation functional markers (SNP, SCAR and the like) can be developed through the identified downy mildew gene, and rapid auxiliary molecular marker selection on the downy mildew gene can be also implemented with high accuracy; with the combination of other anti-disease gene molecular markers, multi-resistance breeding materials can be innovated, the breeding years are reduced, and the breeding efficiency is improved; and basis is made for expressing the wheat downy mildew resistance gene molecule mechanism.

Description

The Rapid identification of wheat MLO type powdery mildew gene

Technical field

The present invention utilizes the method Rapid identification gene of wheat powdery mildews such as plant comparative genomics, genetics, information biology and candidate gene strategy, be mainly concerned with the download of wheat MLO type gene order, the qualification of candidate gene, the comparison of gene, the means such as cluster, and then identify powdery mildew gene, belong to Plant Biotechnology scientific domain.

Background technology

Wheat powdery mildew is by Gramineae dlumeria graminis (Blumeria graminif.sp.tritici, Bgt) cause, it is one of Major Diseases affecting world wheat production, also be a kind of Common Diseases threatening China's Wheat Production, generally occurring in China various places, is the Major Diseases in producing.The blade of Powdery Mildew main harm wheat, also can endanger stem stalk and fringe portion time serious, and in recent years, can cause the underproduction of 5-10% to Wheat Production, time serious, the underproduction can reach 30-50%.It is because China is in recent years of short stem and the popularization of Semi-dwarf cultivar, and the raising of fertilization and irrigation level, and the increasing of field planting density, wheat powdery mildew has the trend of increasing, becomes a kind of disease of serious restriction Wheat Production.By suitable field planting management measure, wheat powdery mildew can be prevented and treated to a certain extent.As considered Wheat Varieties, the fertility of soil and the weather condition of locality, suitably control strain number, the rational application of fertilizer, stubble-cleaning of turning in time after wheat harvest, to eliminate the bacterium source in more summer.Although can prevent and treat wheat powdery mildew to a certain extent by the improvement of cultivation management measure, facts have proved, control wheat powdery mildew method that is most economical, effective, environmental protection cultivates the wheat breed of mildew-resistance.And the qualification of wheat powdery mildew disease-resistant gene, location and clone, be the important foundation of cultivating disease-resistant variety, therefore excavate new mildew-resistance gene resource significant.

MLO type disease-resistant gene is the special class disease-resistant gene of plant.Investigator find the earliest MLO ( mildewresistance locus o) gene pairs powder mildew resistance starts from 1937-1938, acquired the barley of a lot of kind in Ethiopia by fritz, two strains wherein all have efficient resistance to Powdery Mildew (Blumeria graminis f.sp.hordei) all known physiological strains.Further research shows, in barley, the recessive mutation mlo of MLO gene can make barley produce resistance that is lasting, wide spectrum to the physiological strain of nearly all known barley powdery mildew bacteria.Recently, investigator finds that the mildew-resistance gene of a lot of plant is all MLO type Gene Handling, as tomato, and pea, Arabidopis thaliana, rose, capsicum, Root or stem of Littleleaf Indianmulberry etc.Therefore the MLO type disease-resistant gene excavated in plant has important effect to Biology of Plant-Powdery Mildew Interaction breeding.

At present, the conventional method excavating disease-resistant gene conventional has map based cloning, the methods such as transposon tagging.But because the fundamental research of wheat is not deep enough, not only the time is grown but also is difficult to clone these genes exactly therefore to utilize these methods.Therefore, the MLO type disease-resistant gene how in Rapid identification wheat will become the important prerequisite of wheat anti-powdery mildew breeding.

Plant comparative genomics (Comparative Genomics) is based on Genome Atlas and order-checking basis, compares, understand the subject of the function of gene, expression mechanisms and spore to known gene and genome structure.Between Land use models Plant Genome and other Plant Genome on coded sequence and structural homology, clone's other plant gene, discloses gene function and molecular mechanism, illustrates spore relation and genomic immanent structure.The method that this patent adopts and thinking: the research of model plant arabidopsis gene group has disclosed the function of MLO type gene, utilize the homology clone wheat MLO type disease-resistant gene in its order of gene, according to the feature of the superiority in model plant Arabidopis thaliana experimental system and known MLO type disease-resistant gene, " seizure " powdery mildew resistance gene in wheat fast.The knowledge such as this patent Application comparison genomics, genetics, genomics, information biology and genetic strategies, excavate powdery mildew gene fast.

Summary of the invention

Technical problem

The object of this invention is to provide a kind of by conjunction with knowledge such as plant comparative genomics, plant genetics, genomics and information biology, excavate powdery mildew resistance gene in wheat fast.Its result can be used for the exploitation of gene of wheat powdery mildew compact linkage molecule mark on the one hand, carries out molecular marker assisted selection breeding, on the other hand also for other crop powdery mildew gene identification provide reference frame.

Technical scheme

Cardinal principle: first Biology of Plant-Powdery Mildew Interaction gene (MLO) is cloned from barley, research finds that this gene is the special disease-resistant gene of a class, is different from most of NBS (nucleotide-binding site) the type disease-resistant gene of previously clone; Subsequently, investigator has cloned powdery mildew gene in succession from the plants such as tomato, Arabidopis thaliana, pea, capsicum, Root or stem of Littleleaf Indianmulberry, and what research found these genes encodings is all MLO type disease-resistant gene.Subsequently, by test of many times, numerous investigator confirms that MLO type disease-resistant gene has become the distinctive class mildew-resistance gene of plant.Further discovery, plant MLO type gene is a gene family; And Phylogenetic Relationships analysis discovery is carried out to the MLO gene family deriving from different plant species, in different plant species mildew-resistance gene always cluster together, become a class, this class MLO gene all has the characteristic feature of mildew-resistance gene sequence.Completing of Wheat volatiles order-checking provides a convenient approach for excavating powdery mildew gene.Therefore, can by means of the Phylogenetic Relationships of the wheat MLO gene family of having cloned and the MLO powdery mildew gene of having cloned and for maintaining the conservation of amino acids of powdery mildew gene MLO critical function to identify gene of wheat powdery mildew.

Key step is as follows:

1) collection of wheat MLO type gene

Utilize the MLO type gene order announced, BLAST comparison is carried out to NCBI genome database, obtain gene order.

2) qualification of wheat MLO type gene family

By the gene of homologous nucleotide sequence obtained in the above results, analyzed by Pfam (E-value=1.0), remove the gene order (Fig. 1) without ' MLO ' structural domain.The ClustalW instrument (Multiple Sequence Alignment program) disease-resistant gene sequence provided by MEGA3.1 software again carries out Multiple Sequence Alignment, removes tumor-necrosis factor glycoproteins.

3) by the Phylogenetic Relationships qualification wheat MLO type powdery mildew gene of plant MLO type gene

Because previous research is verified, dicotyledons MLO type powdery mildew gene is positioned at plant MLO Phylogenetic Tree same district group, therefore in Phylogenetic Relationships research, we are MLO type mildew-resistance gene with wheat MLO type gene together with the cluster analysis of the MLO type gene family of Arabidopis thaliana with some other crops, to obtain powdery mildew resistance gene in wheat (Fig. 2).

4) comparison of gene of wheat powdery mildew and known plant MLO powdery mildew gene

BioXM2.6 software is utilized to convert the aminoacid sequence of the MLO powdery mildew gene of wheat MLO type powdery mildew gene and Arabidopis thaliana, tomato, pea, barley the file of Fasta form to, these files are imported BioEdit7.0 software, use Clustal software in this software to carry out Multiple Sequence Alignment, disclose the conservative property in powdery mildew gene important amino acid residue and region.Thus identify gene of wheat powdery mildew (Fig. 3) further.

Positively effect of the present invention:

1) shorten gene of wheat powdery mildew and excavate the cycle, be conducive to the Rapid identification of powdery mildew gene.Mildew-resistance gene not only takes time and effort, efficiency is low to adopt ordinary method (map based cloning, transposon tagging etc.) to excavate, and is difficult to successfully.The present invention is based on plant comparative genomics, genetics, bioinformatics method excavate gene of wheat powdery mildew fast, not only can shorten the time, powdery mildew gene determination rates can also be improved.

2) wheat (Triticum aestivum) is one of important trees in the whole world.Because wheat genetic basis is narrow, Germplasm Resources Diversity is low, therefore more difficult by conventional molecule marker (RAPD, ISSR, SSR, AFLP etc.) qualification gene of wheat powdery mildew.The powdery mildew gene exploitation be tested and appraised is divided into from functional indicia (SNP, SCAR etc.) accordingly, can fast for the molecular marker assisted selection of disease-resistant gene, carry out the initiative of multiresistance breeding material, can shortening the breeding cycle, improve breeding efficiency.

3) lay a good foundation for setting forth wheat anti-powdery mildew molecular mechanism.The qualification of powdery mildew resistance gene in wheat, by transgenic technology, RNAi, virus induced gene silencing (virus induced gene silencing, VIGS) molecular mechanism of the Effect of Anti Powdery Mildew such as technology provides genetic resources, is conducive to the mechanism of action setting forth wheat anti-powdery mildew fast.

Accompanying drawing explanation

The qualification of Fig. 1 wheat MLO gene;

What this figure showed is 13 MLO type gene identification results, and each gene is containing ' MLO ' conserved domain.

The Phylogenetic Relationships analysis of Fig. 2 plant MLO gene family and the qualification of wheat MLO type powdery mildew gene thereof;

Arabidopis thaliana is the model plant of plant science research, in phylogenetic tree construction, the powdery mildew gene (PsMLO) of 15 MLO type genes (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12) of Arabidopis thaliana, Gene against Powdery Mildew in Tomato (SIMLO), barley powdery mildew gene (HvMLO and HvMLO02) and pea is selected to and the analysis of wheat MLO type gene clusters.Identify 7 wheat MLO type powdery mildew genes altogether.In figure, the gene of italic mark is exactly gene of wheat powdery mildew.

The compare of analysis of Fig. 3 wheat MLO type powdery mildew gene;

7 gene of wheat powdery mildews and barley (HvMLO), tomato (SIMLO), pea (PsMLO), Arabidopis thaliana powdery mildew gene (AtMLO02, AtMLO06 and AtMLO12) to compare, qualification powdery mildew infects the conservative type in amino-acid residue and the region played an important role.In figure, TM1-TM7 represents 7 revolving die regions of wheat MLO type powdery mildew gene; Black round dot represents that powdery mildew infects important amino-acid residue; CaMBD represents calmodulin CaM binding region; I and II represents and infects important amino acid region to powdery mildew.

Embodiment

The qualification of disease-resistant gene has important effect in the research of crop disease-resistant theory of heredity and disease-resistant variety seed selection.Present method Rapid identification can go out gene of wheat powdery mildew.Specific implementation process is as follows:

1) collection of wheat MLO type gene

In order to obtain wheat MLO type gene members, we are first with the MLO type gene of Arabidopis thaliana, and the mildew-resistance MLO gene order of tomato, pea, capsicum, rose, capsicum, Root or stem of Littleleaf Indianmulberry retrieves wheat MLO type gene from ncbi database, secondly the MLO gene order delivered in Different Crop as target sequence (from DFCI database: TC171015, TC267529, DFCI:TC327983, TC289653, TC312087, TC132500, TC133436, TC317623, TC317025, TC315947, TC325903, TC315944, TC315912, TC322759, TC322059, TC330654, TC282713, TC293173, TC281861, TC283253, TC283383, TC285032, TC290021, TC302716, TC283487, TC282866, TC283441, TC281428, TC285118, TC285090, from GenBank database: AY967408, AF384145, AF384144, AY029312-AY029315, AY029317-AY029319, Z95352, AF369563-AF369565, AF369567, AF369569-AF369576, Z83834, Z95496, AY581255), BLAST comparison is carried out to wheat database (http://www.ncbi.nlm.nih.gov/), select the highest sequence of similarity to download, obtain the MLO type gene (AB581575 of 13 altogether, AB581579, AB581576, AB581580, AB581577, AB581578, AF361932, AF361933, AY584534, AF384144, AF384145, GQ397361:GQ397362).

2) qualification of wheat MLO type gene conserved domain

In order to verify these MLO gene accuracys further, we carry out the qualification of conserved domain " MLO " to these 13 MLO genes.With the aminoacid sequence of the MLO type gene of each for benchmark, PFAM (http://pfam.sanger.ac.uk/) website is carried out the qualification of ' MLO ' conserved domain, result shows, each MLO type gene has one or more ' MLO ' structural domain (Fig. 1).

3) the Phylogenetic Relationships analysis of wheat MLO type gene

In previous research, find that dicotyledons powdery mildew gene aggregates into district's group; Therefore, in phylogenetic tree construction, we have selected 15 MLO type genes (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12) of model plant Arabidopis thaliana, the powdery mildew gene of Gene against Powdery Mildew in Tomato, barley powdery mildew gene and pea analyze with wheat MLO type gene clusters together with cluster analysis.Wheat MLO type gene and other crop powdery mildew gene protein sequences are carried out multisequencing connection to join (adopting Clustal X1.83 software to carry out), and utilize Genedoc software (http://www.nrbsc.org/gfx/genedoc/index.html) to show multisequencing to join the result of joining.Clustal multisequencing is joined the result of joining output in MEGA4.0 software, and utilize this software to construct adjacent tree (neighbor-joining, NJ) respectively, utilize Bootstrapping method to assess these evolutionary trees.Found that in dicotyledons mildew-resistance gene district group, there are 7 wheat MLO types powdery mildew gene (see Fig. 2).

4) comparison of wheat MLO type disease-resistant gene

In the research of barley MLO type powdery mildew gene, in succession found some important areas and single amino acids in research, they infect large wheat powdery mildew irreplaceable effect.In order to identify in 7 gene of wheat powdery mildews, these important areas and amino acid whether high conservative, we have carried out amino acid alignment analysis to from Arabidopis thaliana 3 mildew-resistance genes (AtMLO02, AtMLO6 and AtMLO12), tomato powdery mildew gene (SlMLO), powdery mildew of pea gene (PsMLO).Find wheat 7 powdery mildew genes and known MLO type powdery mildew gene 7 cross-film districts, 30 important amino-acid residue, 1 calmodulin CaM binding region (CaMBD) and two regions played an important role with powdery mildew identification (I and II) high conservative (Fig. 3).Show that these seven genes are exactly wheat MLO type mildew-resistance gene.

Claims

1. powdery mildew resistance gene in wheat, it is characterized in that being selected from following 7 genes (fragment) or its one of:

AF361932

Aminoacid sequence:

MADDDEYPPARTLPETPSWAVALVFAVMIIVSVLLEHALHKLGHWFHKRHKNALAEALEKIKAELMLVGFISLLLAVTQDPISGICISEKAASIMRPCKLPPGSVKSKYKDYYCAKQGKVSLMSTGSLHQLHIFIFVLAVFHVTYSVIIMALSRLKMRTWKKWETETASLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGVRWVVAFFRQFFRSVTKVDYFTLRAGFINAHLSHNSKFDFHKYIKRSMEDDFKVVVGISLPLWCVAILTLFLDIDGIGTLTWISFIPLVILLCVGTKLEMIIMEMALEIQDRASVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATPGLKKCFHMHIGLSIMKVVLGLALQFLCSYITFPLYALVTQMGSNMKRSIFDEQTAKALTNWRNTAKEKKKVRDTDMLMAQMIGDATPSRGASPMPSRGSSPVHLLHKGMGRSDDPQSTPTSPRAMEEARDMYPVVVAHPVHRLNPADRRRSVSSSALDVDIPSADFSFSQG

Nucleotide sequence:

ATGGCGGACGACGACGAGTACCCCCCAGCGAGGACGCTGCCGGAGACGCCGTCCTGGGCGGTGGCCCTCGTCTTCGCCGTCATGATCATCGTGTCCGTCCTCCTGGAGCACGCGCTCCATAAGCTCGGCCATTGGTTCCACAAGCGGCACAAGAACGCGCTGGCGGAGGCGCTGGAGAAGATCAAGGCGGAGCTCATGCTGGTGGGCTTCATCTCGCTGCTGCTCGCCGTGACGCAGGACCCCATCTCCGGGATATGCATCTCCGAGAAGGCCGCCAGCATCATGCGGCCCTGCAAGCTGCCCCCTGGCTCCGTCAAGAGCAAGTACAAAGACTACTACTGCGCCAAACAGGGCAAGGTGTCGCTCATGTCCACGGGCAGCTTGCACCAGCTGCACATATTCATCTTCGTGCTCGCCGTCTTCCATGTCACCTACAGCGTCATCATCATGGCTCTAAGCCGTCTCAAAATGAGAACCTGGAAGAAATGGGAGACAGAGACCGCCTCCCTGGAATACCAGTTCGCAAATGATCCTGCGCGGTTCCGCTTCACGCACCAGACGTCGTTCGTGAAGCGGCACCTGGGCCTCTCCAGCACCCCCGGCGTCAGATGGGTGGTGGCCTTCTTCAGGCAGTTCTTCAGGTCGGTCACCAAGGTGGACTACTTCACCTTGAGGGCAGGCTTCATCAACGCGCATTTGTCGCATAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCCATGGAGGACGACTTCAAAGTCGTCGTTGGCATCAGCCTCCCGCTGTGGTGTGTGGCGATCCTCACCCTCTTCCTTGACATTGACGGGATCGGCACGCTCACCTGGATTTCTTTCATCCCTCTCGTCATCCTCTTGTGTGTTGGAACCAAGCTGGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGGCGAGCGTCATCAAGGGGGCGCCCGTGGTTGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGCTATTCCAGAACGCGTTTCAGATGGCACATTTCGTGTGGACAGTGGCCACGCCCGGCTTGAAGAAATGCTTCCATATGCACATCGGGCTGAGCATCATGAAGGTCGTGCTGGGGCTGGCTCTTCAGTTCCTCTGCAGCTATATCACCTTCCCGCTCTACGCGCTCGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCAGACGGCCAAGGCGCTAACAAACTGGCGGAACACGGCCAAGGAGAAGAAGAAGGTCCGAGACACGGACATGCTGATGGCGCAGATGATCGGCGACGCGACGCCCAGCCGAGGGGCGTCGCCCATGCCTAGCCGGGGCTCGTCGCCAGTGCACCTGCTTCACAAGGGCATGGGACGGTCCGACGATCCCCAGAGCACGCCAACCTCGCCAAGGGCCATGGAGGAGGCTAGGGACATGTACCCGGTTGTGGTGGCGCATCCAGTGCACAGACTAAATCCTGCTGACAGGAGAAGGTCGGTCTCGTCGTCGGCACTCGATGTCGACATTCCCAGCGCAGATTTTTCCTTCAGCCAGGGA

GQ397361

Aminoacid sequence:

MADDDEYPPARTLPETPSWAVALVFAVMIIVSVLLEHALHKLGHWFHKRHKNALAEALEKIKAELMLVGFISLLLAVTQDPISGICISEKAASIMRPCKLPPGSVKSKYKDYYCAKQGKVSLMSTGSLHQLHIFIFVLAVFHVTYSVIIMALSRLKMRTWKKWETETASLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGVRWVVAFFRQFFRSVTKVDYLTLRAGFINAHLSHNSKFDFHKYIKRSMEDDFKVVVGISLPLWCVAILTLFLDIDGIGTLTWISFIPLVILLCVGTKLEMIIMEMALEIQDRASVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATPGLKKCFHMHIGLSIMKVVLGLALQFLCSYITFPLYALVTQMGSNMKRSIFDEQTAKALTNWRNTAKEKKKVRDTDMLMAQMIGDATPSRGASPMPSRGSSPVHLLHKGMGRSDDPQSTPTSPRAMEEARDMYPVVVAHPVHRLNPADRRRSVSSSALDVDIPSADFSFSQG

Nucleotide sequence:

ATGGCGGACGACGACGAGTACCCCCCAGCGAGGACGCTGCCGGAGACGCCGTCCTGGGCGGTGGCCCTCGTCTTCGCCGTCATGATCATCGTGTCCGTCCTCCTGGAGCACGCGCTCCATAAGCTCGGCCATTGGTTCCACAAGCGGCACAAGAACGCGCTGGCGGAGGCGCTGGAGAAGATCAAGGCGGAGCTCATGCTGGTGGGCTTCATCTCGCTGCTGCTCGCCGTGACGCAGGACCCCATCTCCGGGATATGCATCTCCGAGAAGGCCGCCAGCATCATGCGGCCCTGCAAGCTGCCCCCTGGCTCCGTCAAGAGCAAGTACAAAGACTACTACTGCGCCAAACAGGGCAAGGTGTCGCTCATGTCCACGGGCAGCTTGCACCAGCTGCACATATTCATCTTCGTGCTCGCCGTCTTCCATGTCACCTACAGCGTCATCATCATGGCTCTAAGCCGTCTCAAAATGAGAACCTGGAAGAAATGGGAGACAGAGACCGCCTCCCTGGAATACCAGTTCGCAAATGATCCTGCGCGGTTCCGCTTCACGCACCAGACGTCGTTCGTGAAGCGGCACCTGGGCCTCTCCAGCACCCCCGGCGTCAGATGGGTGGTGGCCTTCTTCAGGCAGTTCTTCAGGTCGGTCACCAAGGTGGACTACCTCACCTTGAGGGCAGGCTTCATCAACGCGCATTTGTCGCATAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCCATGGAGGACGACTTCAAAGTCGTCGTTGGCATCAGCCTCCCGCTGTGGTGTGTGGCGATCCTCACCCTCTTCCTTGACATTGACGGGATCGGCACGCTCACCTGGATTTCTTTCATCCCTCTCGTCATCCTCTTGTGTGTTGGAACCAAGCTGGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGGCGAGCGTCATCAAGGGGGCGCCCGTGGTTGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGCTATTCCAGAACGCGTTTCAGATGGCACATTTCGTGTGGACAGTGGCCACGCCCGGCTTGAAGAAATGCTTCCATATGCACATCGGGCTGAGCATCATGAAGGTCGTGCTGGGGCTGGCTCTTCAGTTCCTCTGCAGCTATATCACCTTCCCGCTCTACGCGCTCGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCAGACGGCCAAGGCGCTGACAAACTGGCGGAACACGGCCAAGGAGAAGAAGAAGGTCCGAGACACGGACATGCTGATGGCGCAGATGATCGGCGACGCGACGCCCAGCCGAGGGGCGTCGCCCATGCCTAGCCGGGGCTCGTCGCCAGTGCACCTGCTTCACAAGGGCATGGGACGGTCCGACGATCCCCAGAGCACGCCAACCTCGCCAAGGGCCATGGAGGAGGCTAGGGACATGTACCCGGTTGTGGTGGCGCATCCAGTGCACAGACTAAATCCTGCTGACAGGAGAAGGTCGGTCTCGTCGTCGGCACTCGATGTCGACATTCCCAGCGCAGATTTTTCCTTCAGCCAAGGA

GQ397362

Aminoacid sequence:

MADDDEYPPARTLPETPSWAVALVFAVMIIVSVLLEHALHKLGHWFHKRHKNALAEALEKIKAELMLVGFISLLLAVTQDPISGICISEKAASIMRPCKLPPGSVKSKYKDYYCAKQGKVSLMSTGSLHQLHIFIFVLAVFHVTYSVIIMALSRLKMRTWKKWETETASLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGVRWVVAFFRQFFRSVTKVDYLTLRAGFINAHLSHNSKFDFHKYIKRSMEDDFKVVVGISLPLWCVAILTLFLDIDGIGTLTWISFIPLVILLCVGTKLEMIIMEMALEIQDRASVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATPGLKKCFHMHIGLSIMKVVLGLALQFLCSYITFPLYALVTQMGSNMKRSIFDEQTAKALTNWRNTAKEKKKVRDTDMLMAQMISDATPSRGASPMPSRGSSPVHLLHKGMGRSDDPQSTPTSPRAMEEARDMYPVVVAHPVHRLNPADRRRSVSSSALDVDIPSADFSFSQG

Nucleotide sequence:

ATGGCGGACGACGACGAGTACCCCCCAGCGAGGACGCTGCCGGAGACGCCGTCCTGGGCGGTGGCCCTCGTCTTCGCCGTCATGATCATCGTGTCCGTCCTCCTGGAGCACGCGCTCCATAAGCTCGGCCATTGGTTCCACAAGCGGCACAAGAACGCGCTGGCGGAGGCGCTGGAGAAGATCAAGGCGGAGCTCATGCTGGTGGGCTTCATCTCGCTGCTGCTCGCCGTGACGCAGGACCCCATCTCCGGGATATGCATCTCCGAGAAGGCCGCCAGCATCATGCGGCCCTGCAAGCTGCCCCCTGGCTCCGTCAAGAGCAAGTACAAAGACTACTACTGCGCCAAACAGGGCAAGGTGTCGCTCATGTCCACGGGCAGCTTGCACCAGCTGCACATATTCATCTTCGTGCTCGCCGTCTTCCATGTCACCTACAGCGTCATCATCATGGCTCTAAGCCGTCTCAAAATGAGAACCTGGAAGAAATGGGAGACAGAGACCGCCTCCCTGGAATACCAGTTCGCAAATGATCCTGCGCGGTTCCGCTTCACGCACCAGACGTCGTTCGTGAAGCGGCACCTGGGCCTCTCCAGCACCCCCGGCGTCAGATGGGTGGTGGCCTTCTTCAGGCAGTTCTTCAGGTCGGTCACCAAGGTGGACTACCTCACCTTGAGGGCAGGCTTCATCAACGCGCATTTGTCGCATAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCCATGGAGGACGACTTCAAAGTCGTCGTTGGCATCAGCCTCCCGCTGTGGTGTGTGGCGATCCTCACCCTCTTCCTTGACATTGACGGGATCGGCACGCTCACCTGGATTTCTTTCATCCCTCTCGTCATCCTCTTGTGTGTTGGAACCAAGCTGGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGGCGAGCGTCATCAAGGGGGCGCCCGTGGTTGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGCTATTCCAGAACGCGTTTCAGATGGCACATTTCGTGTGGACAGTGGCCACGCCCGGCTTGAAGAAATGCTTCCATATGCACATCGGGCTGAGCATCATGAAGGTCGTGCTGGGGCTGGCTCTTCAGTTCCTCTGCAGCTATATCACCTTCCCGCTCTACGCGCTCGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCAGACGGCCAAGGCGCTGACAAACTGGCGGAACACGGCCAAGGAGAAGAAGAAGGTCCGAGACACGGACATGCTGATGGCGCAGATGATCAGCGACGCGACGCCCAGCCGAGGGGCGTCGCCCATGCCTAGCCGGGGCTCGTCGCCAGTGCACCTGCTTCACAAGGGCATGGGACGGTCCGACGATCCCCAGAGCACGCCAACCTCGCCAAGGGCCATGGAGGAGGCTAGGGACATGTACCCGGTTGTGGTGGCGCATCCAGTGCACAGACTAAATCCTGCTGACAGGAGAAGGTCGGTCTCGTCGTCGGCACTCGATGTCGACATTCCCAGCGCAGATTTTTCCTTCAGCCAAGGA

AF384145

Aminoacid sequence:

MADDDEYPPARTLPETPSWAVALVFAVMIIVSVLLEHALHKLGHWFHKRHKNALAEALEKIKAELMLVGFISLLLAVTQDPISGICIPEKAASIMRPCKLPPGSVKSKYKDYYCAKQGKVSLMSTGSLHQLHIFIFVLAVFHVTYSVIIMALSRLKMRTWKKWETETASLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGVRWVVASFRQFFRSVTKVDYLTLRAGFINAHLSHNSKFDFHKYIKRSMEDDFKVVVGISLPLWCVAILTLFLDIDGIGTLTWISFIPLVILLCVGTKLEMIIMEMALEIQDRASVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATRGLKKCFHMHIGLSIMKVVLGLALQFLCSYITFPLYALVTQMGSNMKRSIFDEQTAKALTNWRNTAKEKKKVRDTDMLMAQMIGDATPSRGASPMPSRGSSPVHLLHKGMGRSDDPQSTPTSPRAMEEARDMYPVVVAHPVHRLNPADRRRSVSSSALDVDIPSADFSFSQG

Nucleotide sequence:

ATGGCGGACGACGACGAGTACCCCCCAGCGAGGACGCTGCCGGAGACGCCGTCCTGGGCGGTGGCCCTCGTCTTCGCCGTCATGATCATCGTGTCCGTCCTCCTGGAGCACGCGCTCCATAAGCTCGGCCATTGGTTCCACAAGCGGCACAAGAACGCGCTGGCGGAGGCGCTGGAGAAGATCAAGGCGGAGCTCATGCTGGTGGGCTTCATCTCGCTGCTGCTCGCCGTGACGCAGGACCCCATCTCCGGGATATGCATCCCCGAGAAGGCCGCCAGCATCATGCGGCCCTGCAAGCTGCCCCCTGGCTCCGTCAAGAGCAAGTACAAAGACTACTACTGCGCCAAACAGGGCAAGGTGTCGCTCATGTCCACGGGCAGCTTGCACCAGCTGCACATATTCATCTTCGTGCTCGCCGTCTTCCATGTCACCTACAGCGTCATCATCATGGCTCTAAGCCGTCTCAAAATGAGAACCTGGAAGAAATGGGAGACAGAGACCGCCTCCCTGGAATACCAGTTCGCAAATGATCCTGCGCGGTTCCGCTTCACGCACCAGACGTCGTTCGTGAAGCGGCACCTGGGCCTCTCCAGCACCCCCGGCGTCAGATGGGTGGTGGCCTCCTTCAGGCAGTTCTTCAGGTCGGTCACCAAGGTGGACTACCTCACCTTGAGGGCAGGCTTCATCAACGCGCATTTGTCGCATAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCCATGGAGGACGACTTCAAAGTCGTCGTTGGCATCAGCCTCCCGCTGTGGTGTGTGGCGATCCTCACCCTCTTCCTTGACATTGACGGGATCGGCACGCTCACCTGGATTTCTTTCATCCCTCTCGTCATCCTCTTGTGTGTTGGAACCAAGCTGGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGGCGAGCGTCATCAAGGGGGCGCCCGTGGTTGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGCTATTCCAGAACGCGTTTCAGATGGCACATTTCGTGTGGACAGTGGCCACGCGCGGCTTGAAGAAATGCTTCCATATGCACATCGGGCTGAGCATCATGAAGGTCGTGCTGGGGCTGGCTCTTCAGTTCCTCTGCAGCTATATCACCTTCCCGCTCTACGCGCTCGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCAGACGGCCAAGGCGCTGACAAACTGGCGGAACACGGCCAAGGAGAAGAAGAAGGTCCGAGACACGGACATGCTGATGGCGCAGATGATCGGCGACGCGACGCCCAGCCGAGGGGCGTCGCCCATGCCTAGCCGGGGCTCGTCGCCAGTGCACCTGCTTCACAAGGGCATGGGACGGTCCGACGATCCCCAGAGCACGCCAACCTCGCCAAGGGCCATGGAGGAGGCTAGGGACATGTACCCGGTTGTGGTGGCGCATCCAGTCCACAGACTAAATCCTGCTGACAGGAGAAGGTCGGTCTCGTCGTCGGCACTCGATGTCGACATTCCCAGCGCAGATTTTTCCTTCAGCCAAGGA

AF361933

Aminoacid sequence:

VEPGSVKSKYKDYYCAKEGKVALMSTGSLHQLHIFIFVLAVFHVTYSVIIMALSRLKMRTWKKWETETASLEYQFANDPARLRFTHQTSFVKRHLGLSSTPGVRWVVAFFRQFFRSVTKVDYLTLRAGFINAHLSQNSKFDFHKYIKRSMEDDFKVVVGISLPLWAVAILTLFLDIDGIGTLTWVSFIPLIILLCVGTKLEMIIMEMALEIQDRSSVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATPGLKDCFHMNIGLSIMKVVLGLALQFLCSYITFPLYALVTQMGSNMKRSIFDEQTAKALTNWRNTAKEKKKVRDTDMLMAQMIGDATPSRGTSPMPSRGSSPVHLLQKGMGRSDDPQSAPTSPRTMEEARDMYPVVVAHPVHRLNPADRRRSVSSSALDADIPSADFSFSQG

Nucleotide sequence:

ATGTCCACGGGCAGCCTGCACCAGCTCCACATATTCATCTTCGTGCTAGCCGTCTTCCATGTCACCTACAGCGTCATCATCATGGCTCTAAGCCGTCTCAAGATGAGAACATGGAAGAAATGGGAGACAGAGACCGCCTCCTTGGAATACCAGTTCGCAAATGATCCTGCGCGGCTCCGCTTCACGCACCAGACGTCGTTCGTGAAGCGGCACCTGGGCCTGTCCAGCACCCCCGGCGTCAGATGGGTGGTGGCCTTCTTCAGGCAGTTCTTCAGGTCGGTCACCAAGGTGGACTACCTCACCTTGAGGGCAGGCTTCATCAACGCGCACTTGTCGCAGAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCCATGGAGGACGACTTCAAAGTCGTCGTTGGCATCAGCCTCCCGCTGTGGGCTGTGGCGATCCTCACCCTCTTCCTTGATATCGACGGGATCGGCACACTCACCTGGGTTTCTTTCATCCCTCTCATCATCCTCTTGTGTGTTGGAACCAAGCTAGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGTCGAGCGTCATCAAGGGGGCACCCGTGGTCGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGCTGTTCCAGAACGCGTTTCAGATGGCACATTTCGTGTGGACAGTGGCCACGCCCGGCTTGAAGGACTGCTTCCATATGAACATCGGGCTGAGCATCATGAAGGTCGTGCTGGGGCTGGCTCTCCAGTTCCTGTGCAGCTACATCACCTTCCCCCTCTACGCGCTAGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCAGACAGCCAAGGCGCTGACCAACTGGCGGAACACGGCCAAGGAGAAGAAGAAGGTCCGAGACACGGACATGCTGATGGCGCAGATGATCGGCGACGCAACACCCAGCCGAGGCACGTCCCCGATGCCTAGCCGGGGCTCATCGCCGGTGCACCTGCTTCAGAAGGGCATGGGACGGTCTGACGATCCCCAGAGCGCACCGACCTCGCCAAGGACCATGGAGGAGGCTAGGGACATGTACCCGGTTGTGGTGGCGCATCCTGTACACAGACTAAATCCTGCTGACAGGCGGAGGTCGGTCTCTTCATCAGCCCTCGATGCCGACATCCCCAGCGCAGATTTTTCCTTCAGCCAGGGA

AF384144

Aminoacid sequence:

MAKDDGYPPARTLPETPSWAVALVFAVMIIVSVLLEHALHKLGHWFHKRHKNALAEALEKMKAELMLVGFISLLLAVTQDPISGICISQKAASIMRPCKVEPGSVKSKYKDYYCAKEGKVALMSTGSLHQLHIFIFVLAVFHVTYSVIIMALSRLKMRTWKKWETETASLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGVRWVVAFFRQFFRSVTKVDYLILRAGFINAHLSQNSKFDFHKYIKRSMEDDFKVVVGISLPLWAVAILTLFLDIDGIGTLTWVSFIPLIILLCVGTKLEMIIMEMALEIQDRSSVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTMATPGLKDCFHMNIGLSIMKVVLGLALQFLCSYITFPLYALVTQMGSNMKRSIFDEQTAKALTNWRNTAKEKKKVRDTDMLMAQMIGDATPSRGTSPMPSRGSSPVHLLQKGMGRSDDPQSAPTSPRTMEEARDMYPVVVAHPVHRLNPADRRRSVSSSALDADIPSADFSFSQG

Nucleotide sequence:

ATGGCAAAGGACGACGGGTACCCCCCGGCGCGGACGCTGCCGGAGACGCCGTCCTGGGCGGTGGCGCTGGTCTTCGCCGTCATGATCATCGTCTCCGTCCTCCTGGAGCACGCGCTCCACAAGCTCGGCCATTGGTTCCACAAGCGGCACAAGAACGCGCTGGCGGAGGCGCTGGAGAAGATGAAGGCGGAGCTGATGCTGGTGGGATTCATCTCGCTGCTGCTCGCCGTCACGCAGGACCCAATCTCCGGGATATGCATCTCCCAGAAGGCCGCCAGCATCATGCGCCCCTGCAAGGTGGAACCCGGTTCCGTCAAGAGCAAGTACAAGGACTACTACTGCGCCAAAGAGGGCAAGGTGGCGCTCATGTCCACGGGCAGCCTGCACCAGCTCCACATATTCATCTTCGTGCTAGCCGTCTTCCATGTCACCTACAGCGTCATCATCATGGCTCTAAGCCGTCTCAAGATGAGAACATGGAAGAAATGGGAGACAGAGACCGCCTCCTTGGAATACCAGTTCGCAAATGATCCTGCGCGGTTCCGCTTCACGCACCAGACGTCGTTCGTGAAGCGGCACCTGGGCCTGTCCAGCACCCCCGGCGTCAGATGGGTGGTGGCCTTCTTCAGGCAGTTCTTCAGGTCGGTCACCAAGGTGGACTACCTCATCTTGAGGGCAGGCTTCATCAACGCGCACTTGTCGCAGAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCCATGGAGGACGACTTCAAAGTCGTCGTTGGCATCAGCCTCCCGCTGTGGGCTGTGGCGATCCTCACCCTCTTCCTTGATATCGACGGGATCGGCACACTCACCTGGGTTTCTTTCATCCCTCTCATCATCCTCTTGTGTGTTGGAACCAAGCTAGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGTCGAGCGTCATCAAGGGGGCACCCGTGGTCGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGCTGTTCCAGAACGCGTTTCAGATGGCACATTTCGTGTGGACAGTGGCCACGCCCGGCTTGAAGGACTGCTTCCATATGAACATCGGGCTGAGCATCATGAAGGTCGTGCTGGGGCTGGCTCTCCAGTTCCTGTGCAGCTACATCACCTTCCCCCTCTACGCGCTAGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTTGACGAGCAGACAGCCAAGGCGCTGACCAACTGGCGGAACACGGCCAAGGAGAAGAAGAAGGTCCGAGACACGGACATGCTGATGGCGCAGATGATCGGCGACGCAACACCCAGCCGAGGCACGTCCCCGATGCCTAGCCGGGGCTCATCGCCGGTGCACCTGCTTCAGAAGGGCATGGGACGGTCTGACGATCCCCAGAGCGCACCGACCTCGCCAAGGACCATGGAGGAGGCTAGGGACATGTACCCGGTTGTGGTGGCGCATCCTGTACACAGACTAAATCCTGCTGACAGGCGGAGGTCGGTCTCTTCATCAGCCCTCGATGCCGACATCCCCAGCGCAGATTTTTCCTTCAGCCAGGGA

AY584534

Aminoacid sequence:

MADDDEYPPARTLPETPSWAVALVFAVMIIVSVLLEHALHKLGHWFHKRHKNALAEALEKIKAELMLVGFISLLLAVTQDPISGICISEKAASIMRPCKLPPGSVKSKYKDYYCAKQGKVSLMSTGSLHQLHIFIFVLAVFHVTYSVIIMALSRLKMRTWKKWETETASLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGVRWVVAFFRQFFRSVTKVDYLTLRAGFINAHLSHNSKFDFHKYIKRSMEDDFKVVVGISLPLWCVAILTLFLDIDGIGTLTWISFIPLVILLCVGTKLEMIIMEMALEIQDRASVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATPGLKKCFHMHIGLSIMKVVLGLALQFLCSYITFPLYALVTQMGSNMKRSIF

Nucleotide sequence:

ATGGCGGACGACGACGAGTACCCCCCAGCGAGGACGCTGCCGGAGACGCCGTCCTGGGCGGTGGCCCTCGTCTTCGCCGTCATGATCATCGTGTCCGTCCTCCTGGAGCACGCGCTCCATAAGCTCGGCCATTGGTTCCACAAGCGGCACAAGAACGCGCTGGCGGAGGCGCTGGAGAAGATCAAGGCGGAGCTCATGCTGGTGGGCTTCATCTCGCTGCTGCTCGCCGTGACGCAGGACCCCATCTCCGGGATATGCATCTCCGAGAAGGCCGCCAGCATCATGCGGCCCTGCAAGCTGCCCCCTGGCTCCGTCAAGAGCAAGTACAAAGACTACTACTGCGCCAAACAGGGCAAGGTGTCGCTCATGTCCACGGGCAGCTTGCACCAGCTGCACATATTCATCTTCGTGCTCGCCGTCTTCCATGTCACCTACAGCGTCATCATCATGGCTCTAAGCCGTCTCAAAATGAGAACCTGGAAGAAATGGGAGACAGAGACCGCCTCCCTGGAATACCAGTTCGCAAATGATCCTGCGCGGTTCCGCTTCACGCACCAGACGTCGTTCGTGAAGCGGCACCTGGGCCTCTCCAGCACCCCCGGCGTCAGATGGGTGGTGGCCTTCTTCAGGCAGTTCTTCAGGTCGGTCACCAAGGTGGACTACCTCACCTTGAGGGCAGGCTTCATCAACGCGCATTTGTCGCATAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCCATGGAGGACGACTTCAAAGTCGTCGTTGGCATCAGCCTCCCGCTGTGGTGTGTGGCGATCCTCACCCTCTTCCTTGACATTGACGGGATCGGCACGCTCACCTGGATTTCTTTCATCCCTCTCGTCATCCTCTTGTGTGTTGGAACCAAGCTGGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGGCGAGCGTCATCAAGGGGGCGCCCGTGGTTGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGCTATTCCAGAACGCGTTTCAGATGGCACATTTCGTGTGGACAGTGGCCACGCCCGGCTTGAAGAAATGCTTCCATATGCACATCGGGCTGAGCATCATGAAGGTCGTGCTGGGGCTGGCTCTTCAGTTCCTCTGCAGCTATATCACCTTCCCGCTCTACGCGCTCGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTC。

2. the application of Rapid identification gene of wheat powdery mildew described in claim 1, comprising:

1) initiative or the new variety initiative of the breeding material of mildew-resistance MLO gene is carried: utilize the MLO GENE SOURCES given by right 1 to be parent material, in hybridization, backcross progeny, the breeding material that transformation has MLO resistant gene can be obtained.

2) mildew-resistance fundamental research: molecular marker analysis is carried out to the MLO type mildew-resistance gene of right 1; Molecular Mapping or the assignment of genes gene mapping are carried out to this gene; This gene is cloned and Interaction among genes analysis.

3) mildew-resistance transgenic research: utilize the MLO type powdery mildew gene given by claim 1 to carry out transgenic research.