CN102719446A

CN102719446A - Method for rapidly identifying orange MLO powdery mildew resistance gene

Info

Publication number: CN102719446A
Application number: CN2012100949987A
Authority: CN
Inventors: 钱孝英; 袁伟
Original assignee: CHANGSHU ZHITANG TOWN XINSHENG TECHNICAL CONSULTATION SERVICE CO LTD
Current assignee: CHANGSHU ZHITANG TOWN XINSHENG TECHNICAL CONSULTATION SERVICE CO LTD
Priority date: 2012-03-31
Filing date: 2012-03-31
Publication date: 2012-10-10

Abstract

The present invention is a method for rapidly identifying an orange MLO powdery mildew resistance gene, relating to plant comparative genomics, genetics, bioinformatics and other disciplines of knowledge, and belonging to the field of plant biotechnology science. The method in the invention mainly comprises the following steps of: 1) download of an orange full genome sequence and collection of an MLO gene; 2) identification of the MLO gene; 3) identification of a candidate MLO powdery mildew gene through phylogenetic relationship of the MLO gene; and 4) comparison of the MLO powdery mildew gene. The method in the invention can effectively shorten a mining cycle of the orange powdery mildew gene, facilitating rapid identification of the powdery mildew gene; the method can develop corresponding cosegregation functional markers (SNP, SCAR and the like) through the identified candidate powdery mildew gene and can also be used in fast molecular marker-assisted selection of the powdery mildew resistance gene with high accuracy; the method can also create multiple breeding materials with resistance property through combination of other resistance gene molecular markers, shortening a breeding period and improving breeding efficiency; the method can further lays a foundation for describing an orange powdery mildew resistance molecular mechanism.

Description

Sweet orange MLO type mildew-resistance gene Rapid identification

Technical field

The present invention is by means of sweet orange order-checking whole genome sequence; Utilize method Rapid identification sweet orange powdery mildew genes such as plant comparative genomics, genetics, information biology and candidate gene strategy, be mainly concerned with the download of sweet orange whole genome sequence, the evaluation of candidate gene; The comparison of gene; Means such as cluster, and then identify powdery mildew gene, belong to the Plant Biotechnology scientific domain.

Background technology

Sweet orange is Rutaceae (Rutaceae) oranges and tangerines subfamily Citrus (Citurs) fruit trees; The yellow fruit of another name, orange, gold goal, gold orange etc.; Originate in the torrid zone and subtropical zone; Mainly be distributed in the area of year-round average temperature more than 15 ℃, China is one of country of origin of sweet orange, the main producing region mainly in Sichuan, province such as Guangdong, Taiwan, Guangxi, Fujian, Hunan, Jiangxi, Hubei.In world's oranges and tangerines were produced, the ratio that sweet orange accounts for was maximum, and YO accounts for 2/3 of tangerine class ultimate production.

The sweet orange Powdery Mildew is one type of common in sweet orange production fungal disease, this type of disease main harm sweet orange children's browse and young fruit, and their early stage can present white mildew on the positive and negative two sides of tender leaf, and outward appearance is loose, and mildew is often outwards expanded by the center.Leaf tissue is water stain shape at first below the mould layer, and chlorosis gradually forms macula lutea later on.Scab extends to full leaf when serious, often causes that a large amount of fallen leaves, shedding, branch dry up, and this type disease has had a strong impact on the yield and quality of sweet orange.Therefore, controlling the generation of this type of disease and spread, is the prerequisite guarantee that makes sweet orange industry healthy and rapid development.The simple diffusion of passing through the chemical control Powdery Mildew in the production can not fundamentally solve spreading of this type of disease.Breeding resistant variety is the method that the most directly solves this type of disease of generally acknowledging all the time, but because the orange-tree body is big, Tong Qichang, and the height heterozygosis is difficult to set up the ideal segregating population in the heredity, this has brought very big difficulty for traditional breeding mode.Fast development along with molecular biotechnology; Utilizing molecule marker and transgenic technology that disease-resistant gene is transferred to the breeding process that will speed up sweet orange in the fine orange-tree, is to utilize biotechnology to cultivate the prerequisite and the basis of mildew-resistance sweet orange so excavate and analyze mildew-resistance gene.

MLO type disease-resistant gene is one type of special disease-resistant gene of plant.The investigator find the earliest MLO ( MIldew resistance lOcus o ) the gene pairs powder mildew resistance is to start from 1937-1938, gathered the barley of a lot of kinds by the fritz in Ethiopia, two strains systems wherein to the white powder germ ( Blumeria graminisF. sp. Hordei) physiological strains that all oneself know all have efficient resistance.Further research shows, the recessive mutation mlo of MLO gene can make barley that the physiological strain of nearly all oneself knowledge barley powdery mildew bacteria is produced resistance lasting, wide spectrum in the barley.Recently, the investigator finds that the mildew-resistance gene of a lot of plants all is a MLO type Gene Handling, like tomato, and pea, Arabidopis thaliana, rose, capsicum, Root or stem of Littleleaf Indianmulberry or the like.Therefore breeding has important effect to the plant mildew-resistance to excavate MLO type disease-resistant gene in the plant.

At present, the disease-resistant gene method commonly used of excavating commonly used has map based cloning, methods such as transposon tagging.But because the fundamental research of sweet orange is not deep enough, not only the time is long but also very difficult these genes of cloning exactly therefore to utilize these methods.Therefore, how the MLO type disease-resistant gene in the Rapid identification sweet orange will become the important prerequisite of sweet orange mildew-resistance breeding.

Plant comparative genomics (Comparative Genomics) is based on Genome Atlas and the order-checking basis, and known gene and genome structure are compared, and understands the subject of function, expression mechanism and the spore of gene.Utilize between model plant genome and other Plant Genome on the coded sequence and structural homology, clone's other plant gene discloses gene function and molecular mechanism, illustrates spore relation and genomic immanent structure.Method that this patent adopted and thinking: the research of model plant arabidopsis gene group has disclosed the function of MLO type gene; Utilize the homology clone sweet orange MLO type disease-resistant gene on its order of gene; According to the characteristics of meliority on the model plant Arabidopis thaliana experimental system and known MLO type disease-resistant gene, quick " seizure " sweet orange mildew-resistance gene.In recent years, the completion of sweet orange gene order-checking provides condition for our fast mining sweet orange powdery mildew gene.It is prerequisite that this patent has been introduced with the sweet orange whole genome sequence, in conjunction with knowledge such as comparative genomics, genetics, genomics, information biology and candidate gene strategy, fast mining powdery mildew gene.

Summary of the invention

Technical problem

The purpose of this invention is to provide a kind of through combining knowledge such as plant comparative genomics, plant genetics, genomics and information biology, fast mining sweet orange mildew-resistance gene.Its result can be used for the exploitation of sweet orange powdery mildew gene compact linkage molecule mark on the one hand, carries out the molecular marker assisted selection breeding, also for other crop powdery mildew gene identification reference frame is provided on the other hand.

Technical scheme

Cardinal principle: first plant mildew-resistance gene (MLO) is cloned from barley, discovers that this gene is one type of special disease-resistant gene, is different from most of NBS (nucleotide-binding site) type disease-resistant gene of previous clone; Subsequently, the investigator has cloned powdery mildew gene in succession from plants such as tomato, Arabidopis thaliana, pea, capsicum, Root or stem of Littleleaf Indianmulberry, and what discover these genes encodings all is MLO type disease-resistant gene.Subsequently, numerous investigators confirm that through test of many times MLO type disease-resistant gene has become one type of mildew-resistance gene of plant specific.Find that further plant MLO type gene is a gene family; And the MLO gene family that derives from different plant species is carried out the Phylogenetic Relationships analysis finds, in the different plant species mildew-resistance gene always cluster become one type together, this type MLO gene all has the characteristic feature of mildew-resistance gene sequence.The completion of sweet orange gene order-checking provides a convenient for excavating powdery mildew gene.Therefore, can identify the sweet orange powdery mildew gene by means of the Phylogenetic Relationships of MLO gene family in the full genome of the sweet orange that has checked order and the MLO powdery mildew gene of having cloned and for the amino acid conservative property of keeping powdery mildew gene MLO critical function.

Key step is following:

1) collection of the download of sweet orange whole genome sequence and MLO type gene thereof

At first download the sweet orange whole genome sequence from sweet orange sequenced genes group DB (http://www.phytozome.net/search.php); Use " DNATOOLS " software that the full genome amino acid sequence data of sweet orange that obtains is set up DB; Use pfam DB (protein family DB then; Http:// pfam.janelia.org/search/sequence) hidden Markov model in (HMM) carries out Blastp (E-value=0.001) sequence alignment to the aminoacid sequence of MLO structural domain with the full genome amino acid sequence database of having set up of sweet orange, and preliminary screening goes out candidate gene sequence.Secondly, utilize the MLO type gene order of having announced, the sweet orange genome database is carried out the BLAST comparison, obtain candidate gene sequence.

2) evaluation of sweet orange MLO type gene family

With the candidate gene of the homologous nucleotide sequence that obtains in the The above results, analyze through Pfam (E-value=1.0), remove the gene order (Fig. 1) of not having ' MLO ' structural domain.The ClustalW instrument that again candidate's disease-resistant gene sequence is provided through MEGA3.1 software (multisequencing comparison program) carries out the multisequencing comparison, removes Tumor-necrosis factor glycoproteins.

3) Phylogenetic Relationships through plant MLO type gene is identified candidate's sweet orange MLO type powdery mildew gene

Because previous research is verified; Dicotyledons MLO type powdery mildew gene is positioned at the same district of plant MLO Phylogenetic Tree group; Therefore in Phylogenetic Relationships research; We are MLO type mildew-resistance gene and the cluster analysis together of sweet orange MLO type gene of the MLO type gene family of Arabidopis thaliana and some other crops, to obtain candidate's sweet orange mildew-resistance gene (Fig. 2).

4) comparison of sweet orange powdery mildew gene and known plant MLO powdery mildew gene

Utilize BioXM 2.6 softwares the aminoacid sequence of the MLO powdery mildew gene of sweet orange candidate's MLO type powdery mildew gene and Arabidopis thaliana, tomato, pea, barley to be converted to the file of Fasta form; These files are imported BioEdit 7.0 softwares; Use in this software Clustal software to carry out the multisequencing comparison, disclose the conservative property in candidate's powdery mildew gene important amino acid residue and zone.Thereby further identify sweet orange candidate's powdery mildew gene (Fig. 3).

Positively effect of the present invention:

1) shortens the sweet orange powdery mildew gene and excavated the cycle, helped the Rapid identification of powdery mildew gene.Employing ordinary method (map based cloning, transposon tagging etc.) excavation mildew-resistance gene not only takes time and effort, efficient is low, and is difficult to successfully.The present invention is based on plant comparative genomics, genetics, bioinformatics method fast mining sweet orange powdery mildew gene, not only can shorten the time, can also improve powdery mildew gene and identify efficient.

2) sweet orange ( Citrus sinensis) be one of important fruit tree in the whole world.Because the sweet orange hereditary basis is narrow, the germ plasm resource variety is low, therefore identifies relatively difficulty of sweet orange powdery mildew gene through conventional molecule marker (RAPD, ISSR, SSR, AFLP etc.).The candidate's powdery mildew gene exploitation that is tested and appraised is divided into from functional mark (SNP, SCAR etc.) accordingly, can be used for the molecular marker assisted selection of disease-resistant gene fast, and accuracy is high.

3) initiative of multiresistance breeding material.Based on the functional molecular marker of the powdery mildew gene of new evaluation exploitation, combine the molecule marker of localized other disease-resistant genes, carry out the initiative of multiresistance breeding material, can shortening the breeding cycle, the raising breeding efficiency.

4) lay a good foundation for setting forth sweet orange mildew-resistance molecular mechanism.The evaluation of sweet orange mildew-resistance gene; Gene silencing (virus induced gene silencing through transgenic technology, RNAi, virus induction; VIGS) molecular mechanism of research mildew-resistance such as technology provides genetic resources, helps setting forth fast the mechanism of action of sweet orange mildew-resistance.

Description of drawings

The evaluation of Fig. 1 sweet orange MLO gene;

That this figure shows is 15 MLO type gene identification results, and each gene all contains ' MLO ' conserved domain.

The evaluation of the Phylogenetic Relationships analysis of Fig. 2 plant MLO gene family and sweet orange MLO type powdery mildew gene thereof;

Arabidopis thaliana is the model plant of plant science research; Grow in the tree at constructing system; The powdery mildew gene (PsMLO) of 15 MLO type genes of Arabidopis thaliana (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12), tomato mildew-resistance gene (SlMLO), barley powdery mildew gene (HvMLO and HvMLO02) and pea is selected and is used for and the cluster analysis of sweet orange MLO type gene.Identify 2 sweet orange candidates' MLO type powdery mildew gene altogether.The gene of italic mark is exactly candidate's sweet orange powdery mildew gene among the figure.

The compare of analysis of Fig. 3 sweet orange MLO type powdery mildew gene;

2 sweet orange powdery mildew genes and barley (HvMLO), tomato (SlMLO), pea (PsMLO), Arabidopis thaliana powdery mildew gene (AtMLO02; AtMLO06 and AtMLO12) compare, identify that powdery mildew infects the amino-acid residue and regional conservative type that plays an important role.TM1-TM7 representes 7 revolving die zones of sweet orange MLO type powdery mildew gene among the figure; The black round dot representes that powdery mildew infects important amino-acid residue; CaMBD representes the calmodulin land; I and II represent powdery mildew is infected important amino acid region.

Embodiment

The evaluation of disease-resistant gene has important effect in research of crop disease-resistant theory of heredity and disease-resistant variety seed selection.Present method can Rapid identification go out the sweet orange powdery mildew gene.The practical implementation process is following:

1) collection and the evaluation of sweet orange MLO type gene

In order to obtain the whole MLO type gene family member of sweet orange; We are at first with the MLO type gene of Arabidopis thaliana; The mildew-resistance MLO gene order of tomato, pea, capsicum, rose, capsicum, Root or stem of Littleleaf Indianmulberry makes up the HMM model, from the sweet orange genome sequence, receives rope MLO type gene; Secondly with the MLO gene order delivered in the Different Crop as target sequence (from DFCI DB: TC171015, TC267529, DFCI:TC327983, TC289653, TC312087, TC132500; TC133436, TC317623, TC317025, TC315947, TC325903, TC315944; TC315912, TC322759, TC322059, TC330654, TC282713, TC293173; TC281861, TC283253, TC283383, TC285032, TC290021, TC302716; TC283487, TC282866, TC283441, TC281428, TC285118, TC285090; From GenBank DB: AY967408, AF384145, AF384144; AY029312-AY029315, AY029317-AY029319, Z95352; AF369563-AF369565, AF369567, AF369569-AF369576; Z83834, Z95496, AY581255); Sweet orange DB (http://www.phytozome.net/search.php) is carried out the BLAST comparison, select the highest sequence of similarity to download, obtained 15 candidates' MLO type gene (orange1.1g041242m.g altogether; Orange1.1g042041m.g; Orange1.1g010670m.g; Orange1.1g008373m.g; Orange1.1g012859m.g; Orange1.1g023637m.g; Orange1.1g009223m.g; Orange1.1g008408m.g; Orange1.1g010805m.g; Orange1.1g048528m.g; Orange1.1g011363m.g; Orange1.1g047450m.g; Orange1.1g044857m.g; Orange1.1g010450m.g; Orange1.1g008391m.g; ).

2) evaluation of sweet orange MLO type gene family

In order further to verify these MLO gene accuracys, we have carried out the evaluation of conserved domain " MLO " to these 15 candidates' MLO gene.Aminoacid sequence with each candidate's MLO type gene is a benchmark, on PFAM (http://pfam.sanger.ac.uk/) website, carries out the evaluation of ' MLO ' conserved domain, and concrete outcome is seen Fig. 1.

3) the Phylogenetic Relationships analysis of sweet orange MLO type gene

In the research formerly, find that the dicotyledons powdery mildew gene aggregates into district's group; Therefore; Grow in the tree at constructing system; We have selected the powdery mildew gene and the sweet orange MLO type gene cluster analysis cluster analysis together of 15 MLO type genes (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12), tomato mildew-resistance gene, barley powdery mildew gene and the pea of model plant Arabidopis thaliana.Sweet orange MLO type gene and other crop powdery mildew gene protein sequences are carried out the multisequencing couplet join (adopting Clustal X 1.83 softwares to carry out), and utilize Genedoc software (http://www.nrbsc.org/gfx/genedoc/index.html) to show that multisequencing joins the result who joins.The Clustal multisequencing is joined the result who joins output in MEGA 4.0 softwares, and (neighbor-joining NJ), utilizes the Bootstrapping method that these evolutionary trees are assessed to utilize this software to make up the adjacency tree respectively.The result finds in dicotyledons mildew-resistance gene district group, to have 2 sweet orange candidates' MLO type powdery mildew gene (see figure 2).

4) comparison of sweet orange MLO type disease-resistant gene

In the research of barley MLO type powdery mildew gene, found some important areas and single amino acids in the research in succession, they infect big wheat powdery mildew has irreplaceable effect.In the sweet orange powdery mildew gene of identifying 2 candidates; Whether these important areas and amino acid high conservative, and we have carried out compare of analysis to 3 mildew-resistance genes (AtMLO02, AtMLO6 and AtMLO12), tomato powdery mildew gene (SlMLO), the powdery mildew of pea gene (PsMLO) from Arabidopis thaliana.2 candidates' of discovery sweet orange powdery mildew gene and 7 of known MLO type powdery mildew genes are striden the film district, 30 important amino acid, 1 calmodulin land (CaMBD) and two important zone (I and II) high conservatives (Fig. 3).

Claims

1. sweet orange mildew-resistance gene is characterized in that being selected from one of following 2 genes or its:

orange1.1g008391m.g

Amino acid:

MAEKKVYERTLEETPTWAVAAVFFVLIAVSVVIEHLIHIIGKWLNNRHKKALFEAVEKVKAELMLLGFISLLLTVLQEPISGICVSKSVANSWHPCTDKLEKDAYSSDNKESRRRLLSFLDSGTASTRRSLATKGYDKCADEGKVAFVSAYGIHQLHIFIFVLAVFHVLYCLFTLALGRTKMKKWKAWENETKTIEYQYYNDPERFRFARDTSFGRRHLNIWSKSSISLWIVCFFRQFLGSVNKIDYHTLRHGFIMAHLAPGSETKFDFQKYISRSLEEDFKDVVGITPILWFIATLFLLTNTHGWFAYLWLPFIPLFIILLVGAKLQVIITKLGLRIQERGDVVKGAPVVQPGDDLFWFGRPRFILFLIHLVLFQNAFQLAFFSWSTYEFALKSCFHKKTEDIAIRISMGVLIQILCSYVTLPLYALVTQMGSTMKPTIFNDRVAAALKNWHHIAKKHTKQGRLSGSNTPMSSRPQTPTHGMSPVHLLHNYPNSSYHSNFEHEHWDPENQIRSPRHHREIMNESPPHYAESSEQEVAALEEPRQIEMQLPPGPGFIHTHHEFSFGK

Nucleotide:

ATGGCGGAGAAAAAGGTTTATGAGCGTACGTTGGAGGAAACTCCAACATGGGCTGTTGCTGCGGTCTTTTTTGTGTTGATTGCCGTTTCAGTCGTCATTGAACATCTCATTCACATTATTGGAAAGTGGTTGAATAACAGACACAAGAAAGCTCTCTTCGAAGCAGTTGAAAAAGTTAAAGCAGAGCTTATGCTATTGGGGTTCATATCATTGCTGCTAACAGTGTTACAAGAACCAATTTCTGGTATTTGTGTATCAAAGAGTGTTGCAAATTCTTGGCATCCTTGCACTGACAAATTAGAAAAAGATGCATATAGCAGTGATAATAAAGAGAGTCGCCGGAGACTTCTTTCGTTTCTTGATTCCGGAACAGCCAGCACTCGCCGGAGTTTAGCAACTAAAGGTTATGACAAATGCGCGGATGAGGGCAAAGTTGCATTTGTGTCTGCATATGGGATTCATCAGCTCCATATATTCATATTTGTTTTAGCTGTTTTCCATGTCCTTTACTGCTTATTCACCTTGGCTTTGGGAAGAACAAAGATGAAGAAATGGAAGGCATGGGAGAATGAGACAAAGACAATTGAGTACCAATACTACAATGATCCAGAAAGGTTTCGGTTTGCAAGGGACACTTCATTTGGTCGTAGGCATTTGAATATTTGGAGTAAATCATCAATCAGCTTGTGGATTGTTTGCTTCTTCAGGCAATTCCTTGGATCTGTTAACAAAATTGATTACCACACACTGAGACATGGATTCATCATGGCTCATTTGGCTCCTGGAAGTGAAACAAAATTCGATTTTCAGAAATACATCAGCAGATCGCTTGAAGAAGATTTCAAAGATGTTGTGGGAATAACTCCAATTCTATGGTTCATTGCAACGTTGTTCTTGCTCACCAATACACATGGATGGTTTGCTTACTTGTGGTTACCATTTATCCCCTTATTTATAATTCTGTTGGTGGGTGCTAAACTACAAGTGATTATAACGAAACTGGGCCTGAGAATTCAAGAGAGAGGTGATGTGGTGAAGGGGGCACCAGTGGTTCAGCCTGGTGATGACCTTTTCTGGTTCGGACGCCCGCGGTTCATTCTCTTTCTCATTCACTTGGTTCTTTTCCAGAATGCATTTCAGCTGGCATTTTTCAGTTGGAGCACGTATGAATTTGCGCTTAAATCTTGCTTCCACAAGAAAACTGAGGATATAGCTATCAGAATCTCAATGGGGGTGCTCATTCAGATTCTATGCAGTTATGTGACACTACCTCTATATGCCTTAGTGACACAGATGGGATCTACAATGAAACCAACAATATTTAATGATAGAGTGGCAGCAGCACTGAAAAACTGGCACCATATTGCCAAAAAACACACAAAACAGGGCAGGCTTTCTGGGAGTAACACACCAATGTCAAGCAGGCCACAAACTCCTACACATGGAATGTCACCGGTCCATCTCTTGCATAATTACCCGAACAGCAGCTACCACTCGAACTTCGAGCACGAGCATTGGGATCCCGAGAATCAGATTCGTTCGCCGCGCCACCACCGCGAGATCATGAATGAGTCTCCTCCACATTATGCAGAATCTAGTGAACAAGAAGTGGCAGCACTTGAAGAGCCTAGGCAAATTGAAATGCAGCTGCCTCCAGGTCCCGGATTCATTCATACACATCACGAATTTTCATTTGGGAAATGA

orange1.1g023637m.g

Amino acid:

MAGASGGRSLEETPTWAVAVVCFVLVTISIIIEHIIHLIGKWLTKKHKRALYEALEKIKSELMLLGFISLLLTVAGSWISKICIPESVANTWHPCDKEREPELNNEKETTEQETTEHENRRRLLEAVAASGGSIRRALAAGSTTEKCSKGKVPFVSEDGLHQLHIFIFVLALFHVLYSILTMALSRAKMKKWKKWEKETRTIDYQFSHDPERFRFARETSFGRRHLSSWTKTPVLIWIVCFFRQFVRSVPKVDYLTLRHGFVTVIFLCFQSLAISIKYY

Nucleotide:

ATGGCCGGAGCTAGCGGAGGAAGATCTTTGGAGGAGACGCCGACATGGGCCGTTGCGGTCGTTTGTTTTGTTTTGGTTACGATTTCAATAATTATCGAGCACATAATCCATCTTATCGGAAAGTGGCTGACAAAGAAACACAAGAGAGCTTTATACGAGGCACTCGAGAAGATCAAATCAGAGTTGATGCTACTGGGGTTCATATCGTTGCTACTAACAGTAGCAGGTAGTTGGATATCAAAAATATGCATACCAGAAAGTGTGGCAAATACATGGCATCCATGCGATAAGGAAAGAGAACCAGAGCTAAACAATGAGAAGGAGACTACTGAACAAGAAACGACAGAACACGAAAACCGCCGGAGACTTCTGGAGGCGGTGGCCGCCTCGGGTGGAAGTATCCGAAGAGCTTTGGCGGCGGGATCAACAACCGAAAAATGTTCCAAGGGCAAAGTTCCATTTGTGTCTGAGGACGGTCTCCATCAACTCCATATTTTCATCTTTGTCTTAGCACTTTTCCATGTCCTTTACAGTATCCTTACAATGGCCTTGAGCAGAGCCAAGATGAAGAAATGGAAGAAATGGGAAAAGGAAACAAGAACAATTGATTATCAGTTCTCTCACGATCCTGAGAGGTTTAGATTTGCAAGAGAGACGTCGTTTGGCAGGAGGCATTTGAGTTCGTGGACCAAGACACCTGTCCTCATTTGGATAGTTTGTTTCTTCAGGCAATTTGTTCGGTCGGTTCCCAAGGTTGATTACTTAACTCTCAGGCATGGATTTGTCACGGTAATTTTCTTGTGTTTTCAAAGTTTGGCAATTTCAATCAAATATTATTAA。

2. the application of the said Rapid identification sweet orange of claim 1 powdery mildew gene comprises:

1) initiative of breeding material.

3.2) breeding practice of mildew-resistance.

4.3) mildew-resistance fundamental research.