CN104561032A

CN104561032A - Quick identification of powdery mildew resistant gene for barley

Info

Publication number: CN104561032A
Application number: CN201310524964.1A
Authority: CN
Inventors: 钱春桃; 其他发明人请求不公开姓名
Original assignee: Changshu City Dongbang Town Limu Vegetable Profession Cooperatives
Current assignee: Changshu City Dongbang Town Limu Vegetable Profession Cooperatives
Priority date: 2013-10-28
Filing date: 2013-10-28
Publication date: 2015-04-29

Abstract

The invention provides quick identification of a powdery mildew resistant gene for barley, relates to subject knowledge of plant comparative genomics, genetics, bioinformatics and the like and belongs to the field of plant biotechnology science. The quick identification mainly comprises the following steps: (1) downloading a barley whole-genome sequence and acquiring an MLO gene; (2) identifying the MLO gene; (3) establishing a phylogenetic relationship of the MLO gene; and (4) comparing an MLO powdery mildew gene. According to the quick identification, the mining period of the barley powdery mildew gene is effectively shortened to facilitate quick identification of the powdery mildew gene; the corresponding coseparation functional markers (SNP, SCAR and the like) are developed through the identified candidate powdery mildew gene and quickly used for molecular marker auxiliary selection of the powdery mildew resistant gene, and the accuracy is high; through combination with other anti-disease gene molecular markers, creation of a multi-resistant breeding material can be carried out, the breeding period is shortened, and the breeding efficiency is improved; and a foundation is laid for stating the barley powdery mildew resistance molecular mechanism.

Description

Barley mildew-resistance gene Rapid identification

Technical field

The present invention is by means of barley order-checking whole genome sequence, utilize the method Rapid identification barley powdery mildew genes such as plant comparative genomics, genetics, information biology and candidate gene strategy, be mainly concerned with the download of barley whole genome sequence, the qualification of candidate gene, the comparison of gene, the means such as cluster, and then identify powdery mildew gene, belong to Plant Biotechnology scientific domain.

Background technology

Barley belongs to Gramineae Hordeum cereal grass.Have nutty flavor, carbohydrate content is higher, and protein, calcium, phosphorus content are medium.In north African and parts of Asia, barley is one of Major Foods.In addition, barley straw is soft, multiplexly litters as livestock, also uses producing fodder in a large number.Barley powdery mildew mainly occurs in humidity and semi-humid region.Can encroach on each organ of its overground part, but based on blade and leaf sheath, when morbidity is heavy, grain husk shell and awns also can be injured.Their early stage, there is the white mildew of 1 ~ 2mm in blade face, after expand as the oval white mildew of subcircular value gradually, there is one deck white powder on mildew surface.The mould layer in later stage disease portion becomes canescence to light brown, and scattered on scab have pinhead-sized little black grain point.Barley powdery mildew can cause the production loss of more than 20%.Usually, the control of disease is mainly by spraying fungicide, but life-time service medicine can cause environmental pollution and Biological Strains of The Pest variation, and therefore promoting disease-resistant variety is method the most safely and effectively.

The mankind find MLO the earliest in barley, find that this gene does not have function in mildew-resistance kind under study for action, and when making it not play function its silence of plan, this kind can produce resistance to Powdery Mildew.Investigator finds that MLO gene pairs powder mildew resistance starts from 1937-1938 the earliest, acquired the barley of a lot of kind in Ethiopia by fritz, two strains wherein all have efficient resistance to all physiological strains that oneself knows of Powdery Mildew (Blumeria.graminisf.sp.hexlei, Bgh).Further research shows, in barley the recessive mutation mlo of MLO gene can make barley to nearly all oneself know that the physiological strain of barley powdery mildew bacteria produces resistance that is lasting, wide spectrum.

MLO gene is a genoid special in plant, and disease-resistant gene is the most important components in plant defense system." gene-for-gene " theory is thought: dominant disease-resistant gene (the Resistance gene that plant has, R) corresponding dominant nontoxic gene (the Avimlence gene had to pathogen, Avr) identified with specially changing directly or indirectly by respective coded product, and then the expression of induction host Analysis of Defence Genes Involved, growth of pathogenic bacteria and propagation are suppressed, and plant performance is disease-resistant; If host plant does not have corresponding r gene, or pathogenic bacteria does not have corresponding Avr gene, and host plant then can not cause defense response because effectively not identifying pathogen, and cause pathogen successfully to infect and amount reproduction, plant performance is susceptible.Recently, investigator finds that the mildew-resistance gene of a lot of plant is all MLO type Gene Handling, as tomato, and pea, Arabidopis thaliana, rose, capsicum, Root or stem of Littleleaf Indianmulberry etc.Therefore the MLO type disease-resistant gene excavated in plant has important effect to Biology of Plant-Powdery Mildew Interaction breeding.The research that oneself has shows, MLO gene in familial form, has multiple family member, wherein has 15 family members in Arabidopis thaliana in many crops.In corn, find to have 9 at least.In paddy rice, there are 12 family members, due to the factor such as delayed that the genome sequencing of other plant is done, barley, the crop such as wheat, lotus rhizome, capsicum, tomato relatively seldom have other member of MLO family to be found.Therefore, this genoid has very large potentiality and application prospect improving in plant resistance to environment stress.At present, the method for clone plant disease-resistant gene mainly contains transposon tagging, map based cloning method etc.Therefore, the MLO type disease-resistant gene how in Rapid identification barley will become the important prerequisite of barley mildew-resistance breeding.

Plant comparative genomics is by the comprehensive gene between phylogenetic representative species and the comparative analysis of gene family, the genetic map of constructing system, discloses the subject of gene, the origin of gene family and function and complicated and diverse mechanisms during evolution thereof.Plant comparative genomics (comparative genomics), is also called comparative genetics and comes from and utilize molecule marker (mainly RFLP mark) to map to genome.Utilize the homology in functional area order, in weave construction between different plant species genome, clone new gene, discloses gene function and molecular mechanism, illustrates spore relation and genomic immanent structure.The importance of plant comparative genomics is that it links together different subjects, different biological species, has erected the bridge between fundamental research and applied research.Across kind, across belonging to, genome comparison transboundary understands the relation of gene and genomic structure, gene structure and function and DNA to us and changes and how to cause species diversity etc. to be of great significance.

The method that this patent adopts and thinking: the research of model plant arabidopsis gene group has disclosed the function of MLO type gene, utilize the homology clone barley MLO type disease-resistant gene in its order of gene, according to the feature of the superiority in model plant Arabidopis thaliana experimental system and known MLO type disease-resistant gene, " seizure " barley mildew-resistance gene fast.This patent describes premised on barley whole genome sequence, in conjunction with knowledge such as comparative genomics, genetics, genomics, information biology and candidate gene strategy, excavates powdery mildew gene fast.

Summary of the invention

Technical problem

The object of this invention is to provide a kind of by conjunction with knowledge such as plant comparative genomics, plant genetics, genomics and information biology, excavate barley mildew-resistance gene fast.Its result can be used for the exploitation of barley powdery mildew gene compact linkage molecule mark on the one hand, carries out molecular marker assisted selection breeding, on the other hand also for other crop powdery mildew gene identification provide reference frame.

Technical scheme

Cardinal principle: powdery mildew gene (MLO) is the special disease-resistant gene of a class, is different from most of NBS (nucleotide-binding site) the type disease-resistant gene of previously clone; Investigator has cloned powdery mildew gene in succession from the plants such as tomato, Arabidopis thaliana, pea, capsicum, Root or stem of Littleleaf Indianmulberry, and what research found these genes encodings is all MLO type disease-resistant gene.Subsequently, by test of many times, numerous investigator confirms that MLO type disease-resistant gene has become the distinctive class mildew-resistance gene of plant.Further discovery, plant MLO type gene is a gene family; And Phylogenetic Relationships analysis discovery is carried out to the MLO gene family deriving from different plant species, in different plant species mildew-resistance gene always cluster together, become a class, this class MLO gene all has the characteristic feature of mildew-resistance gene sequence.Completing of barley gene group order-checking provides a convenient approach for excavating powdery mildew gene.Therefore, can by means of the Phylogenetic Relationships of MLO gene family in the barley full-length genome checked order and the MLO powdery mildew gene of having cloned and for maintaining the conservation of amino acids of powdery mildew gene MLO critical function to identify barley powdery mildew gene.

Key step is as follows:

1) download of barley whole genome sequence and the collection of MLO type gene thereof

First barley whole genome sequence is downloaded from barley sequenced genes group database (http://www.public.iastate.edu/ ~ imagefpc/IBSC%20Webpage/IBSC%20Template-seq%20resourc es.html); Use " DNATOOLS " software to the barley full-length genome amino acid sequence data building database obtained, then pfam database (protein family database is used, http://pfam.janelia.org/search/sequence) in hidden Markov model (HMM) Blastp (E-value=0.001) sequence alignment is carried out to the aminoacid sequence of MLO structural domain and the barley full-length genome amino acid sequence database to have set up, preliminary screening goes out candidate gene sequence.Secondly, utilize the MLO type gene order announced, BLAST comparison is carried out to barley gene group database, obtain candidate gene sequence.

2) qualification of barley MLO type gene family

By the candidate gene of homologous amino acid sequence obtained in the above results, analyzed by Pfam (E-value=1.0), remove the gene order (Fig. 1) without ' MLO ' structural domain.The ClustalW instrument (Multiple Sequence Alignment program) Candidate Disease Resistant Genes sequence provided by MEGA3.1 software again carries out Multiple Sequence Alignment, removes tumor-necrosis factor glycoproteins.

3) by the barley MLO type powdery mildew gene of the Phylogenetic Relationships qualification candidate of plant MLO type gene

Because previous research is verified, dicotyledons MLO type powdery mildew gene is positioned at plant MLO Phylogenetic Tree same district group, therefore in Phylogenetic Relationships research, we are MLO type mildew-resistance gene with barley MLO type gene together with the cluster analysis of the MLO type gene family of Arabidopis thaliana with some other crops, to obtain the barley mildew-resistance gene (Fig. 2) of candidate.

4) comparison of barley powdery mildew gene and known plant MLO powdery mildew gene

BioXM2.6 software is utilized to convert the aminoacid sequence of the MLO powdery mildew gene of the MLO type powdery mildew gene of barley candidate and Arabidopis thaliana, tomato, pea, barley the file of Fasta form to, these files are imported BioEdit7.0 software, use Clustal software in this software to carry out Multiple Sequence Alignment, disclose the conservative property in candidate's powdery mildew gene important amino acid residue and region.Thus identify the powdery mildew gene (Fig. 3) of barley candidate further.

Positively effect of the present invention:

1) shorten the barley powdery mildew gene excavating cycle, be conducive to the Rapid identification of powdery mildew gene.Mildew-resistance gene not only takes time and effort, efficiency is low to adopt ordinary method (map based cloning, transposon tagging etc.) to excavate, and is difficult to successfully.The present invention is based on plant comparative genomics, genetics, bioinformatics method and excavate barley powdery mildew gene fast, not only can shorten the time, powdery mildew gene determination rates can also be improved.

2) barley is one of important food crop in the whole world.Because barley hereditary basis is narrow, Germplasm Resources Diversity is low, therefore by conventional molecule marker (RAPD, ISSR, SSR, AFLP etc.) qualification barley powdery mildew genetic comparison difficulty.The candidate's powdery mildew gene exploitation be tested and appraised is divided into from functional indicia (SNP, SCAR etc.) accordingly, can fast for the molecular marker assisted selection of disease-resistant gene, and accuracy is high.

3) initiative of multiresistance breeding material.Based on the functional molecular marker of the powdery mildew gene exploitation of new qualification, ins conjunction with the molecule marker of other disease-resistant genes after positioning, carry out the initiative of multiresistance breeding material, can shortening the breeding cycle, raising breeding efficiency.

4) lay a good foundation for setting forth barley mildew-resistance molecular mechanism.The qualification of barley mildew-resistance gene, by transgenic technology, RNAi, virus induced gene silencing (virus induced gene silencing, VIGS) molecular mechanism of the Effect of Anti Powdery Mildew such as technology provides genetic resources, is conducive to the mechanism of action setting forth barley mildew-resistance fast.

Accompanying drawing explanation

The qualification of Fig. 1 barley MLO gene;

What this figure showed is 11 MLO type gene identification results, and each gene is containing ' MLO' a conserved domain.

The Phylogenetic Relationships analysis of Fig. 2 plant MLO gene family and the qualification of barley MLO type powdery mildew gene thereof;

Arabidopis thaliana is the model plant of plant science research, in phylogenetic tree construction, the powdery mildew gene (PsMLO) of 15 MLO type genes (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12) of Arabidopis thaliana, Gene against Powdery Mildew in Tomato (SIMLO) and pea is selected to and the analysis of barley MLO type gene clusters.Identify the MLO type powdery mildew gene of 1 barley candidate altogether.In figure, the gene of italic mark is exactly candidate's barley powdery mildew gene.

The compare of analysis of Fig. 3 barley MLO type powdery mildew gene;

1 barley powdery mildew gene and barley cloned powdery mildew gene (HvMLO), tomato (SIMLO), pea (PsMLO), Arabidopis thaliana powdery mildew gene (AtMLO02, AtMLO06 and AtMLO12) to compare, qualification powdery mildew infects the conservative type in amino-acid residue and the region played an important role.In figure, TMI-TM7 represents 7 revolving die regions of barley MLO type powdery mildew gene; Black round dot represents that powdery mildew infects important amino-acid residue; CaMBD represents calmodulin CaM binding region; I and II represents and infects important amino acid region to powdery mildew.

Embodiment

The qualification of disease-resistant gene has important effect in the research of crop disease-resistant theory of heredity and disease-resistant variety seed selection.Present method Rapid identification can go out barley powdery mildew gene.Specific implementation process is as follows:

1) collection of barley MLO type gene and qualification

In order to obtain the whole MLO type gene family member of barley, we are first with the MLO type gene of Arabidopis thaliana, the mildew-resistance MLO gene order of tomato, pea, capsicum, rose, capsicum, Root or stem of Littleleaf Indianmulberry builds HMM model, receives rope MLO type gene from barley gene group sequence, secondly the MLO gene order delivered in Different Crop as target sequence (from DFCI database: TC171015, TC267529, DFCI:TC327983, TC289653, TC312087, TC132500, TC133436, TC317623, TC317025, TC315947, TC325903, TC315944, TC315912, TC322759, TC322059, TC330654, TC282713, TC293173, TC281861, TC283253, TC283383, TC285032, TC290021, TC302716, TC283487, TC282866, TC283441, TC281428, TC285118, TC285090, from GenBank database: AY967408, AF384145, AF384144, AY029312-AY029315, AY029317-AY029319, Z95352, AF369563-AF369565, AF369567, AF369569-AF369576, Z83834, Z95496, AY581255), BLAST comparison is carried out to barley database (http://www.phytozome.net/search.php), select the highest sequence of similarity to download, obtain the MLO type gene (MLOC_57214.1 of 11 candidates altogether, MLOC_61466.1, MLOC_69399.1, MLOC_56507.3, MLOC_38046.3, MLOC_39391.1, MLOC_66301.1, MLOC_70290.3, MLOC_72783.2, MLOC_11560.1, AK364906, ).

2) qualification of barley MLO type gene family

In order to verify these MLO gene accuracys further, we have carried out the qualification of conserved domain " MLO " to the MLO gene of these 11 candidates.With the aminoacid sequence of the MLO type gene of each candidate for benchmark, PFAM (http://pfam.sanger.ac.uk/) website is carried out ' qualification of MLO' conserved domain, concrete outcome is shown in Fig. 1.

3) the Phylogenetic Relationships analysis of barley MLO type gene

In previous research, find that monocotyledons powdery mildew gene aggregates into district's group; Therefore, in phylogenetic tree construction, we have selected 15 MLO type genes (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12) of model plant Arabidopis thaliana, the powdery mildew gene of Gene against Powdery Mildew in Tomato, barley powdery mildew gene and pea analyze with barley MLO type gene clusters together with cluster analysis.Barley MLO type gene and other crop powdery mildew gene protein sequences are carried out multisequencing connection to join (adopting Clustal X1.83 software to carry out), and utilize Genedoc software (http://www.nrbsc.org/gfx/genedoc/index.html) to show multisequencing to join the result of joining.Clustal multisequencing is joined the result of joining output in MEGA4.0 software, and utilize this software to construct adjacent tree (neighbor-joining, NJ) respectively, utilize Bootstrapping method to assess these evolutionary trees.Found that in dicotyledons mildew-resistance gene district group, there is the MLO type powdery mildew gene (see Fig. 2) of 1 barley candidate.

4) comparison of barley MLO type disease-resistant gene

In the research of barley MLO type powdery mildew gene, in succession found some important areas and single amino acids in research, they infect large wheat powdery mildew irreplaceable effect.In order to identify in the barley powdery mildew gene of 1 candidate, these important areas and amino acid whether high conservative, we have carried out compare of analysis to from 3 mildew-resistance genes (AtMLO02, AtMLO6 and AtMLO12) of Arabidopis thaliana, tomato powdery mildew gene (S1MLO), powdery mildew of pea gene (PsMLO).Find the powdery mildew gene of barley 1 candidate and known MLO type powdery mildew gene 7 cross-film districts, 30 important amino acid, 1 calmodulin CaM binding region (CaMBD) and two important region (I and II) high conservatives (Fig. 3).

Claims

1. barley mildew-resistance gene, it is characterized in that being selected from following 1 gene or its one of:

1.MLOC_70290.3

Amino acid:

MSDKKGVPARELPETPSWAVAVVFAAMVLVSVLMEHGLHKLGHWFQHRHKKALWEALEKMKAELMLVGFISLLLIVTQDPIIAKICISEDAADVMWPCKRGTEGRKPSKYVDYCPEGKVALMSTGSLHQLHVFIFVLAVFHVTYSVITIALSRLKMRTWKKWETETTSLEYQFANDPARFRFTHQTSFVKRHLGLSSTPGIRWVVAFFRQFFRSVTKVDYLTLRAGFINAHLSQNSKFDFHKYIKRSMEDDFKVVVGISLPLWGVAILTLFLDINGVGTLIWISFIPLVILLCVGTKLEMIIMEMALEIQDRASVIKGAPVVEPSNKFFWFHRPDWVLFFIHLTLFQNAFQMAHFVWTVATPGLKKCYHTQIGLSIMKVVVGLALQFLCSYMTFPLYALVTQMGSNMKRSIFDEQTSKALTNWRNTAKEKKKVRDTDMLMAQMIGDATPSRGSSPMPSRGSSPVHLLHKGMGRSDDPQSAPTSPRTQQEARDMYPVVVAHPVHRLNPNDRRRSASSSALEADIPSADFSFSQG

Nucleotide:

ATGTCGGACAAAAAAGGGGTGCCGGCGCGGGAGCTGCCGGAGACGCCGTCGTGGGCGGTGGCGGTGGTCTTCGCCGCCATGGTGCTCGTGTCCGTCCTCATGGAGCACGGCCTCCACAAGCTCGGCCATTGGTTCCAGCACCGGCACAAGAAGGCCCTGTGGGAGGCGCTGGAGAAGATGAAGGCGGAGCTCATGCTGGTGGGCTTCATATCCCTGCTCCTCATCGTCACGCAGGACCCCATCATCGCCAAGATATGCATCTCCGAGGATGCCGCCGACGTCATGTGGCCCTGCAAGCGCGGCACCGAGGGCCGCAAGCCCAGCAAGTACGTTGACTACTGCCCGGAGGGCAAGGTGGCGCTCATGTCCACGGGCAGCTTGCACCAGCTGCACGTCTTCATCTTCGTGCTCGCGGTCTTCCATGTCACCTACAGCGTCATCACCATAGCTCTAAGCCGTCTCAAAATGAGAACATGGAAGAAATGGGAGACAGAGACCACCTCCTTGGAATACCAGTTCGCAAATGATCCTGCACGGTTCCGGTTCACGCACCAGACGTCGTTCGTGAAGCGCCACCTGGGCCTCTCCAGCACCCCTGGCATCAGATGGGTGGTGGCCTTCTTCAGGCAGTTCTTCAGGTCAGTCACCAAGGTGGACTACCTGACCTTGAGGGCAGGCTTCATCAACGCGCATTTGTCGCAAAACAGCAAGTTCGACTTCCACAAGTACATCAAGAGGTCGATGGAGGACGACTTCAAGGTCGTCGTCGGCATCAGCCTCCCGCTGTGGGGTGTGGCGATCCTCACCCTCTTCCTTGACATCAATGGGGTTGGCACGCTCATCTGGATTTCTTTCATCCCTCTCGTGATCCTCTTGTGTGTTGGAACCAAGCTGGAGATGATCATCATGGAGATGGCCCTGGAGATCCAGGACCGGGCGAGCGTCATCAAGGGGGCCCCCGTGGTCGAGCCCAGCAACAAGTTCTTCTGGTTCCACCGCCCCGACTGGGTCCTCTTCTTCATACACCTGACGTTGTTCCAGAACGCGTTTCAGATGGCGCATTTTGTGTGGACAGTGGCCACGCCCGGCTTGAAGAAATGCTACCACACGCAGATCGGGCTGAGCATCATGAAGGTGGTGGTGGGGCTAGCTCTCCAGTTCCTCTGCAGCTATATGACCTTCCCCCTCTACGCGCTCGTCACACAGATGGGATCAAACATGAAGAGGTCCATCTTCGACGAGCAGACGTCCAAGGCGCTCACCAACTGGCGGAACACGGCCAAGGAGAAGAAGAAAGTCCGAGACACGGACATGCTGATGGCTCAGATGATCGGCGACGCAACACCGAGCCGAGGCTCGTCGCCGATGCCGAGCCGGGGCTCATCACCCGTGCACCTGCTTCACAAGGGCATGGGGCGGTCGGACGACCCCCAGAGCGCGCCCACCTCGCCAAGGACCCAGCAGGAGGCTAGGGACATGTACCCGGTTGTGGTGGCGCACCCGGTGCACAGACTAAATCCTAACGACAGGAGGAGGTCCGCCTCGTCGTCGGCCCTCGAAGCCGACATCCCCAGTGCAGATTTTTCCTTCAGCCAGGGA。

2. the application of Rapid identification barley powdery mildew gene described in claim 1, comprising:

1) initiative or the new variety initiative of the breeding material of mildew-resistance MLO gene is carried: utilize the MLO GENE SOURCES given by right 1 to be parent material, in hybridization, backcross progeny, the breeding material that transformation has MLO resistant gene can be obtained.

2) mildew-resistance fundamental research: molecular marker analysis is carried out to the MLO type mildew-resistance gene of right 1; Molecular Mapping or the assignment of genes gene mapping are carried out to this gene; This gene is cloned and Interaction among genes analysis.

3) mildew-resistance transgenic research: utilize the MLO type powdery mildew gene given by claim 1 to carry out transgenic research.