CN105802929B - Protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene and application - Google Patents
Protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene and application Download PDFInfo
- Publication number
- CN105802929B CN105802929B CN201610286953.8A CN201610286953A CN105802929B CN 105802929 B CN105802929 B CN 105802929B CN 201610286953 A CN201610286953 A CN 201610286953A CN 105802929 B CN105802929 B CN 105802929B
- Authority
- CN
- China
- Prior art keywords
- barley
- hvmpk4a
- resistance
- powdery mildew
- mildew
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
- C12Y207/01037—Protein kinase (2.7.1.37)
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The present invention relates to molecular biology and field of molecular breeding, and in particular to protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene HvMPK4a and application.The protein kinase HvMPK4a relevant to barley mildew-resistance is the protein that the amino acid sequence shown in SEQ ID No.1 forms.The present invention has found that HvMPK4a expression quantity during powdery mildew infects barley significantly rises by the expression pattern analysis to HvMPK4a, illustrates that HvMPK4a participates in the process that barley defence powdery mildew infects and plays its biological function.The present invention is instantaneously overexpressed HvMPK4a and is inoculated with non-affine powdery mildew by barley epidermal cell, and discovery barley is obviously reduced the resistance of powdery mildew；Silencing HvMPK4a and it is inoculated with affine powdery mildew in barley by virus-mediated gene silencing, discovery barley enhances the resistance of powdery mildew, illustrates HvMPK4a negative regulation barley to the resistance of powdery mildew.
Description
Technical field
The present invention relates to molecular biology and field of molecular breeding, specifically, being related to relevant to barley mildew-resistance
Protein kinase HvMPK4a and its encoding gene and application.
Background technique
Barley is one of the staple food crop planted extensively in the whole world, and world's sown area is only second to wheat, rice
And corn, rank the 4th.Barley can be cooked food, feed and beer brewing raw material, have important economic value.Barley powdery mildew
(barley powdery mildew) is one of main fungal disease of barley, by dlumeria graminis barley specialized form
(Blumeria graminis f.sp.hordei) causes.The disease fungus category Ascomycetes Erysiphales is mainly big in host
Obligate living body is parasitic in wheat epidermal leaf cells, can encroach on each organ of overground part of barley strain, but based on blade and leaf sheath,
When severe disease barley stalk and fringe portion also by infringement (1994,Crit.Rev.Plant Sci.).Barley powdery mildew
It mostly occurs in moist and semi-humid region, is distributed in each barley producing region in the world.European Countries, Eastern North America and southern areas,
The barley cultivations regions such as the ground such as Japan, and Chinese Guizhou, Sichuan and southeastern coast, which have, generally to be occurred, and can generally be caused
The production loss of 20%-25%, and heavy losses are up to 30% in the time of plant disease epidemic.In recent years, due to barley variety
The cultural factors such as unification, high dense planting and excessive applied nitrogen, so that barley powdery mildew morbidity is on the rise.
The preventing and controlling of whole world barley powdery mildew mainly pass through application chemical pesticide and complete at present.Triazole type (triazole)
Fungicide is organic heterocyclic compound, is in the late four decades for the wide spectrum of powdery mildew of cereals exploitation, interior suction, efficient chemistry
Fungicide, it is applied widely, application method is flexible, it is preferable to the control efficiency of barley powdery mildew.The effect of triazole bactericidal agent
Mechanism is to inhibit the biosynthesis of disease fungus ergosterol, destroys somatic cells membrane structure and function, and then is inhibited
Or the development of thallus appresorium and haustorium and the formation of mycelia and spore are interfered, reduce disease fungus pathogenicity.Wheat crops
Has more than 40 years history so far using triazole bactericidal agent prevention and treatment powdery mildew, Powdery Mildew has generated triazole class compounds
Resistance at home and abroad has research and report.Triazole bactericidal agent not only has bactericidal effect, there are also plant growth regulation, because
This often has phytotoxicity in use, influences the yield and quality of crop.Meanwhile it largely can be to ring using chemical bactericide
Border pollutes, and forms potential threaten to people and animals' safe diet and health.
Disease-resistant variety is cultivated and is planted in screening, is to prevent and treat another important channel of barley powdery mildew, and discovery and identification are big
Wheat mildew-resistance gene is then the important ring in breeding for disease resistance work.Barley includes: one to the resistance of powdery mildew, relies on microspecies
Resistance specified (the Shen et al, 2007, Science) that specialization resistance disease-resistant gene (such as MLA gene) generates；Two, it relies on
Resistance of wide spectrum that non-race specific resistance disease-resistant gene (such as mlo gene) generates (Acevedo-Garcia et al, 2014, New
Phytol.)；Three, rely on the partial resistance that non-race specific resistance disease-resistant gene generates.Pass through traditional breeding method mode and molecule mark
Note assisting sifting combines, and can accelerate to import barley powdery mildew disease-resistant gene into cultivar.
Barley powdery mildew bacteria has many biological strains；The powder mildew resistance of the barley disease-resistant variety of main cultivation often with locality
Powdery mildew dominant race it is different, therefore effective race specific resistance cannot be generated.And barley powdery mildew bacteria makes a variation
Speed is fast, so that effective race specific resistance disease-resistant gene of many a period of time loses resistance in a short time, becomes breeding and pushes away
Breeder's unsolved problem always during vast wheat disease-resistant variety.Although barley pair can be made with mlo gene
Powdery mildew generates efficient resistance of wide spectrum, but can also accelerate the Apoptosis of crop simultaneously, reduce crop to other diseases
Defence capability finally influences crop yield, therefore also has significant limitation using mlo gene in resistance breeding
(Acevedo-Garcia et al,2014,New Phytol.).In recent years, gene silencing (RNAinterference, RNAi)
Technology have been obtained for being widely applied in crops prevention and treatment pest and disease damage field (Koch and Kogel, 2014, Plant
Biotechnol.J.), but the target gene of the tiny RNA of overexpression institute negative regulation is greatly mostly from harmful organism (such as disease
Poison, bacterium, fungi, nematode and insect etc.).
Mitogen-activated protein kinase cascade reaction (MAPK cascade) is signal highly conserved in eucaryote
Pipeline.It is living at: mitogen-activated protein kinase kinase kinases (MAPKKK), mitogen by three kinds of albumen kinases groups
Change protein kinase kinase (MAPKK) and mitogen-activated protein kinase MAPK (Nakagami et al., 2005).In plant
In, MAPK cascade reaction and biotic, abiotic stress, cell differentiation and development are all closely related.A large number of studies show that
MAPK cascade reaction can by pathogen induction and the defense reaction that activates and participate in plant to pathogen.Work as pathogen
When invasion, the PAMPs from pathogen is identified by surface of Plant callus cell receptor PRRs, activation MAPK cascade reaction, under phosphorylation
Swim substrate molecule, and starting PTI (Chisholm et al., 2006；Tena et al., 2011), and the MAPK approach in barley
It is not investigated also, the applied research that prevention and treatment barley fungal disease purpose is reached with MAPK signal pathway still rarely has report
Road.
Summary of the invention
In order to solve the problems in the existing technology, the object of the present invention is to provide a kind of related to barley mildew-resistance
Protein kinase HvMPK4a and its encoding gene and application.
In order to achieve the object of the present invention, technical scheme is as follows:
In a first aspect, the present invention provides protein kinase HvMPK4a relevant to barley mildew-resistance, for following (a) or
(b):
(a) protein that the amino acid sequence shown in SEQ ID No.1 forms；
(b) by SEQ ID No.1 by replacing and/or being deleted and/or added what one or several amino acid residues obtained
To the disease-resistant related or protein as derived from a) with transcriptional activation activity.
Further, the present invention provides the encoding gene HvMPK4a of the protein kinase HvMPK4a.
Further, the encoding gene is following DNA molecular 1) or 2) or 3):
1) DNA molecular shown in SEQ ID No.2；
2) hybridizing under strict conditions with the DNA sequence dna 1) limited and encoding has the active egg of protein kinase HvMPK4a
White DNA molecular；
3) at least there is with the DNA sequence dna 1) limited 90% or more homology and coding has protein kinase HvMPK4a living
The DNA molecular of the albumen of property.
The present invention is had detected in the barley leaves sample of inoculation powdery mildew using the method for Real-time qPCR
The gene expression abundance of HvMPK4a finds that the expression quantity of HvMPK4a is aobvious in the affine and non-affine interaction of barley-powdery mildew
It writes and increases.
Further, the present invention provides the primer pairs for expanding the encoding gene or its segment.
Preferably, the present invention provides one group through screening obtained specificity height, the good primer pair of sensitivity, comprising:
Forward primer: 5'-GAAGAAGCCATGGACACCTCC-3'；
Reverse primer: 5'-GTAGGGCGGATCAGGGTTAAAT-3'.
Further, the present invention also provides the recombinant vector containing afore-mentioned code gene, expression cassette, transgenic cell lines
Or recombinant bacterium.
The recombinant vector is specially that the encoding gene is inserted into expression vector, obtains the recombination for expressing the albumen
Carrier.
It should be noted that the transgenic cell line is understood not to propagation material, it is not belonging to plant variety
Scope.
Second aspect, the present invention provides the protein kinase HvMPK4a, the encoding gene HvMPK4a or described are heavy
Group carrier, expression cassette, transgenic cell line or recombinant bacterium are in screening disease resistance of plant, breeding disease-resistant plants or building is disease-resistant turns base
Because of the application in plant.
Specifically, the plant is barley, it is disease-resistant to show as mildew-resistance.The pathogen of the barley powdery mildew is big
Wheat powdery mildew bacterium (Blumeria graminis f.sp.hordei)；The barley powdery mildew bacteria is specially that big wheat powdery mildew is raw
Manage microspecies K1 or A6.
The present invention expresses HvMPK4a-YFP in barley epidermal cell by the method that particle gun mediates, and finds it thin
There is positioning in cytoplasm and nucleus.
The present invention is instantaneously overexpressed HvMPK4a using the method for particle gun in barley epidermal cell, finds non-affine
Barley reduces the resistance of powdery mildew in interaction, and the haustorium index for showing as powdery mildew significantly increases, and illustrates that HvMPK4a is negative and tunes up
Race specific resistance of the wheat to powdery mildew.
The gene silent technology that the present invention is mediated using hordeivirus silencing HvMPK4a in barley, discovery
Barley enhances the resistance of powdery mildew in affine interaction, and the microcolony number for showing as powdery mildew substantially reduces, and illustrates HvMPK4a
It is negative to tune up wheat to the background resistance of powdery mildew.
Further the present invention provides a kind of instantaneous intragentic method of silenced plant body, and detects after providing silencing
Barley judges barley sample to powdery mildew the method for the resistance of powdery mildew by the microcolony index on statistics silencing blade
Resistance.
For example, using hordeivirus mediate gene silencing methods silencing HvMPK4a and have detected silencing leaf
HvMPK4a expression quantity in piece.
The present invention provides the qPCR primer pairs of specific detection HvMPK4a expression quantity, comprising:
It is positive: 5'-CACGAAGATACATGAAGCAA-3'；
It is reversed: 5'-CAGAGCCTCATCAACAGTA-3'.
The beneficial effects of the present invention are:
The present invention has found that HvMPK4a is expressed during powdery mildew infects barley by the expression pattern analysis to HvMPK4a
Amount significantly rises, and illustrates that HvMPK4a participates in the process that barley defence powdery mildew infects and plays its biological function.The present invention is logical
It crosses transient expression HvMPK4a in barley epidermal cell and finds that HvMPK4a has positioning in cytoplasm and nucleus.Pass through barley
Epidermal cell is instantaneously overexpressed HvMPK4a and is inoculated with non-affine powdery mildew, and discovery barley is obviously reduced the resistance of powdery mildew；It is logical
It crosses virus-mediated gene silencing and silencing HvMPK4a and is inoculated with affine powdery mildew in barley, discovery barley resists powdery mildew
Property enhancing, illustrate HvMPK4a negative regulation barley to the resistance of powdery mildew.HvMPK4a provided by the invention can be widely applied to
Barley genetic breeding, germ plasm resource improvement and the field of transgenic plants for cultivating mildew-resistance, make improvement and improvement barley etc.
The germ plasm resource of object plays a significant role.
Detailed description of the invention
Fig. 1 is that powdery mildew infects the influence diagram to barley HvMPK4a expression.
Fig. 2 is distribution map of the HvMPK4a albumen in barley epidermal cell；Fluorescence indicates HvMPK4a protein molecular.
Fig. 3 is that influence of the HvMPK4a to barley powdery mildew resistance is overexpressed in barley epidermal cell.
Fig. 4 is variation of the barley to powdery mildew resistance after silencing HvMPK4a.
Specific embodiment
The preferred embodiment of the present invention is described in detail below in conjunction with embodiment.It will be appreciated that following real
Providing merely to play the purpose of explanation for example is applied, is not used to limit the scope of the present invention.The skill of this field
Art personnel without departing from the spirit and purpose of the present invention, can carry out various modifications and replace to the present invention.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.
Experimental method used in following embodiments is conventional method unless otherwise specified.
Some materials in following embodiments are as follows:
Barley Golden Promise is documented in Nuclear activity of MLA immune receptors
links isolate-specific and basal disease-resistance responses.Science 315,
1098-1103, the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research；
Barley P01 is documented in Nuclear activity of MLA immune receptors links isolate-
Specific and basal disease-resistance responses.Science 315,1098-1103, Gong Zhongke
It is obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research；
Big wheat powdery mildew biological strain K1 is documented in Recognition Specificity and RAR1/SGT1
Dependence in Barley Mla Disease Resistance Genes to the Powdery Mildew
Fungus.Plant Cell, 2003,15:732-744, the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research
?；
Big wheat powdery mildew biological strain A6 (Blumeria graminis f.sp.Hordei) is documented in Recognition
Specificity and RAR1/SGT1 Dependence in Barley Mla Disease Resistance Genes
To the Powdery Mildew Fungus.Plant Cell, 2003,15:732-744, the public can lose from the Chinese Academy of Sciences
Biography is obtained with Developmental Biology research；
Plasmid pUbi-GUS is documented in A Transient Assay System for the Functional
Assessment of Defense-Related Genes in Wheat.MPMI, 1999,12:647-654, the public can be therefrom
The heredity of the academy of sciences, state is obtained with Developmental Biology research；
PUBI-Adaptor-NOS is documented in Recognition Specificity and RAR1/SGT1
Dependence in Barley Mla Disease Resistance Genes to the Powdery Mildew
Fungus.Plant Cell, 2003,15:732-744, the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research
?；
PUBI-Gateway-YFP carrier is documented in The CC-NB-LRR-type Rdg2a resistance gene
confers immunity to the seed-borne balrey leaf stripe pathogen in the absence
Of hypersensitive cell death.PLoS One, 2010,5:e12599, the public can from Chinese Academy of Sciences's heredity with
Developmental Biology research is obtained.
PCa- γ bLIC carrier is documented in Barley MLA Immune Receptors Directly Interfere
with Antagonistically Acting Transcription Factors to Initiate Disease
Resistance Signaling.Plant Cell, 2013,25,1158-1173, the public can be from Chinese Academy of Sciences's heredity and hair
Biological study is educated to be obtained.
Expression pattern analysis of 1 HvMPK4a of embodiment during big wheat powdery mildew infects barley
1, the preparation of vegetable material.
Barley variety P01 seed after planting, to long to 1 week or so, cuts boot leaf, blade face upward, is placed in containing culture
It is small that it is inoculated with barley powdery mildew bacteria physiology respectively on the culture dish of base (1% agar, 100mg/L benzimidazole), after restoring 24 hours
Kind K1 or A6, and different time points take blade material after inoculation respectively.
2, the extraction of plant total serum IgE.
300mg barley leaves are ground rapidly in liquid nitrogen to powdered, 1mL TRizol is added, fully shake after mixing in
4 DEG C of 12000rpm are centrifuged 10 minutes；Supernatant is transferred in new centrifuge tube, and the chloroform of 1/5 TRizol volume is added, and mixes rear chamber
Temperature stands 3 minutes and waits its layering, is centrifuged 15 minutes in 4 DEG C of 12000g later.Supernatant is transferred in new centrifuge tube, is first added
The 3M sodium acetate (pH 5.2) of clear volume 10%, adds 1 times of supernatant volume of isopropanol, after mixing in -20 DEG C after mixing
Stand 60 minutes.4 DEG C of 10000g are centrifuged 15 minutes, abandon supernatant, twice with 75% ethanol washing precipitating, are stored at room temperature 10 points every time
Clock, 4 DEG C of 7500rpm are centrifuged 5 minutes later, and precipitating is hung 10 minutes at room temperature.It is dissolved and is precipitated with 60 μ L DEPC water, obtained
Plant total serum IgE.
3, reverse transcription obtains cDNA.
Reverse transcription system are as follows: RNA 2 μ g, Oligo-dT 1 μ L add DEPC H2O to 10 μ L, 70 DEG C are denaturalized 5 minutes, on ice
It is 5 minutes cooling；5 × M-MLV Buffer, 5 1.25 μ L, RNase Inhibitor of μ L, dNTP 0.625 μ L, M- are added later
1 μ L of MLV, adds DEPC-H2O to 20 μ L, 48 DEG C warm bath 1 hour, 70 DEG C 15 minutes, 4 DEG C 10 minutes.
4, Real-time qPCR reacts.Reverse transcription product dilutes 10 times, and 2 μ L is taken to carry out Real-time qPCR.Real-
Time qPCR system and program are grasped referring to promega company kit GoTaq-qPCR Master Mix (catalog number (Cat.No.) A6001)
It explains.It is control with nonvaccinated barley P01.According to following system configurations fluorescence quantitative PCR reaction solution: 2 × qPCR Mix
5 μ L, 100 × CXR 0.1 μ L, 10 μM of forward primers 0.2 μ L, 10 μM of 0.2 μ L of reverse primer add ddH2O to 10 μ L.Then, will
Above-mentioned reaction solution is dispensed into the dedicated tubule of qPCR with 8 μ l/ pipes, and every pipe is separately added into 2 μ L template cDNA to be measured and mixes, and centrifugation makes
Reaction solution is gathered in tube bottom, epiphragma.Then, it is reacted on ABI fluorescence quantitative PCR instrument according to following procedure: 95 DEG C
10min, 95 DEG C of 15sec, 60 DEG C of 1min, 40 circulations.Solubility curve: 95 DEG C of 10sec, 65 DEG C of 1min, 0.2 DEG C of ladder liter is set
Temperature reads fluorescent value, is warming up to 95 DEG C of end.
QPCR primer needed for detecting HvMPK4a expression quantity is as follows:
It is positive: 5'-CACGAAGATACATGAAGCAA；
It is reversed: 5'-CAGAGCCTCATCAACAGTA；
Contain the barley product of MLA1 gene with toxicity powdery mildew microspecies A6 and nontoxic powdery mildew microspecies K1 inoculation genetic background
Kind P01 acquires leaf sample after inoculation 0,2,4,6,8,12,16 and 24 hour, and detects the phase of HvMPK4a in leaf tissue
To expression quantity, and then studies powdery mildew and infect the influence to barley HvMPK4a expression.It can with Real-time qPCR method
To detect the relative expression quantity of HvMPK4a in these leaf samples.Experimental result is shown in Fig. 1, are connect with toxicity powdery mildew microspecies A6
Kind barley variety P01 can reflect out barley to the background resistance of powdery mildew, and be inoculated with barley product with nontoxic powdery mildew microspecies K1
Kind P01 can reflect out barley to the race specific resistance of powdery mildew.The result shows that either in inoculation toxicity powdery mildew microspecies
In background resistance afterwards, or in the race specific resistance being inoculated with after nontoxic powdery mildew microspecies, HvMPK4a in Barley Cells
Gene expression abundance has all been changed over time and has been significantly risen, and illustrates that HvMPK4a participates in resistance processes and performance of the barley to Powdery Mildew
Corresponding biological function.
The clone of 2 barley HvMPK4a gene of embodiment and its positioning analysis in Barley Cells
1, the clone of HvMPK4a gene.
7 days seedling leaves of barley variety GP are taken, carry out reverse transcription acquisition cDNA after extracting RNA.Reverse transcription system and mistake
Journey is as follows: 21 μ L of μ g, Oligo-dT of RNA adds DEPC-H2O to 12 μ L, centrifuge tube mix and are denaturalized 10 in 70 DEG C after above-mentioned solution
Minute, then at cooled on ice 2 minutes, 2 μ L, dNTP mix of M-MLV Buffer, 1 μ L is continuously added in centrifuge tube later,
0.5 1 μ L of μ L, M-MLV of RNase inhibitor, adds DEPC-H2O to 20 μ L, in 42 DEG C warm bath 1 hour, 70 DEG C keep the temperature 15 points
The cDNA of reverse transcription is obtained after clock.
Primer needed for cloning the PCR amplification of HvMPK4a gene is as follows:
It is positive: 5'-ATGGACACCTCCGGCGGCGGCGGC-3'；
It is reversed: 5'-GTAGGGCGGATCAGGGTTAAAT-3'.
PCR reaction system are as follows: KOD buffer 5 μ L, MgSO4252 μ L of μ L, cDNA of μ L, dNTP, forward and reverse primer
Each 1 μ L, KOD plus enzyme, 1 μ L, adds H2O to 50 μ L.PCR response procedures are as follows: 94 DEG C 3 minutes+(94 DEG C 30 seconds+58 DEG C 30 seconds+68
DEG C 90 seconds)+68 DEG C of × 30 circulations 10 minutes.
Reaction obtains the PCR product of 1131bp, which is sequenced, and result is nucleotide shown in SEQ ID NO.2
Sequence, unnamed gene shown in the sequence are HvMPK4a；The albumen of gene coding is named as HvMPK4a, the amino of the albumen
Acid sequence is SEQ ID NO.1.
2, positioning analysis.
1) vector construction.
HvMPK4a is building up in intermediate vector pENTRY, and is further reacted by LR by the gene integration to expression
In carrier pUBI-Gateway-YFP.
Primer needed for constructing pUbi-HvMPK4a-YFP is as follows:
It is positive: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACACCTCCGGCGGCGGCG GC-3'；
It is reversed: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGTAGGGCGGATCAGGGTTAA AT-3'.
2) the unicellular gene of barley that particle gun mediates instantaneously is overexpressed.
9mg bronze is taken, 70% ethyl alcohol of 1mL is added after drying 4 hours at 65 DEG C, concussion cleaning 5 minutes stands 15 minutes
Sedimentation, centrifugation abandoned supernatant after 2 seconds.It shakes 2 minutes, is centrifuged 2 seconds after placing 1 minute, in abandoning after 1mL sterile deionized water is added
Clearly.50% glycerol of 1mL is added after being repeated 2 times, concussion mixes.After five minutes by the concussion of ready bronze, 1 μ g expression plasmid is taken
PUbi-HvMPK4a-YFP adds deionized water to 5 μ L；Be added plasmid DNA cocktail in 50 μ L bronzes, while earthquake by
It is added dropwise to 50 μ L 2.5M CaCl2, 20 μ L0.1M spermidines are then quickly added into, concussion 3 minutes is continued.It stands 1 minute and settles,
Centrifugation abandoned supernatant after 2 seconds, and respectively with 100% ethanol washing of 140 μ L, 70% ethyl alcohol and 140 μ L, 12 μ L 100% are added later
It shakes and mixes after ethyl alcohol.
It is bombarded using the particle gun of model PDS-1000/He delivery system (Bio-Rad).By carrier
Film is put into carrier film support plate, and bronze is uniformly applied to airing behind carrier film center；Explosion diaphragm is placed into rupture disk
Piece chuck, is fixed on accelerator；By carrier film support plate plus net is stopped, it is placed into bombardment room first layer, and leaf will be loaded with
The plate of piece vacuumizes after being placed on third layer, and bombardment is emitted after vacuum values reach 27 inches of mercury.Blade is being trained after bombardment
It supports and is set on ware, be put into growth cabinet stationary culture.Blade glycerol adding moisturizing is taken two days later, is placed on glass slide, Yu Jiguang
Fluorescence is observed under Laser Scanning Confocal Microscope.
This experiment is overexpressed HvMPK4a and YFP using the instant expression method that particle gun mediates in barley epidermal cell
Fusion protein, study positioning of the HvMPK4a in cell.As shown in Fig. 2, expressing HvMPK4a- in barley epidermal cell
After YFP, the distribution of (yellow) fluorescin can be detected in cytoplasm and nucleus, illustrate HvMPK4a cytoplasm with
It is distributed in nucleus.
Research of the HvMPK4a to barley powdery mildew resistance is overexpressed in 3 barley epidermal cell of embodiment
1, vector construction.
Above-mentioned HvMPK4a full length gene is built into pUBI-Adaptor-NOS carrier by the method that digestion connects,
Generate pUbi-HvMPK4a.
2, the instantaneous overexpression pUbi-HvMPK4a that particle gun mediates.
Bronze preparation is as indicated above.Plasmid DNA is mixed with gus reporter gene expression plasmid pUbi-GUS equimolar,
Add deionized water to 5 μ L；It is added plasmid DNA cocktail in 50 μ L bronzes, 50 μ L2.5M are added dropwise in earthquake while
CaCl2, 20 μ L0.1M spermidines are then quickly added into, concussion 3 minutes is continued.It standing 1 minute and settles, centrifugation abandoned supernatant after 2 seconds,
Respectively with 100% ethanol washing of 140 μ L, 70% ethyl alcohol and 140 μ L, mixing is shaken after 12 μ L, 100% ethyl alcohol is added later.
3, it is inoculated with powdery mildew and counts haustorium index.
Taken when connecing bacterium the barley strain with mature powdery mildew spores above the blade for receiving biolistic bombardment gently
Shake, makes spore even drop down；Culture dish is sealed after standing 3 minutes, is put into growth cabinet stationary culture.It will cultivate 48 hours
Barley isolated blade be immersed in GUS dyeing liquor and dye, vacuumize 3 times, every time 5 minutes, during which gently overturn；37 DEG C incubated
Blade is immersed in room temperature in destainer later and decolourized two days by night.Blade is cleaned 1 hour in clear water, it is molten in Coomassie brilliant blue
It dyes 10 seconds, washes with water 2 times in liquid；Face of blade is placed on glass slide upward, 50% glycerol of drop, coverslip in pressure,
Microscopically observation.(containing haustorium and secondary mycelia) susceptible in the cell of statistical presentation GUS respectively and disease-resistant (only adhere to
Born of the same parents) cell number, susceptible cell number and statistics cell number summation ratio be haustorium index.
This experiment is instantaneously overexpressed HvMPK4a in barley epidermis is unicellular using particle gun mediation, to be instantaneously overexpressed
Empty carrier is negative control, in conjunction with powdery mildew inoculation and haustorium index statistics later, has studied and crosses table in barley epidermal cell
Influence up to HvMPK4a to barley powdery mildew bacteria resistance.As shown in figure 3, powdery mildew haustorium index represents the conversion of barley epidermis
The susceptibility of cell, numerical value is bigger to illustrate that barley epidermal cell is more susceptible.It is unloaded with nontoxic biological strain K1 inoculation transient expression
After barley variety P01 blade in body or HvMPK4a gene, genetic background containing disease-resistant gene MLA1 gene, it can be seen that mistake
It is more susceptible that expression HvMPK4a can lead to Barley Cells.In the unicellular middle particle bombardment overexpression HvMPK4a of barley epidermis
Afterwards, Barley Cells decline the race specific resistance of powdery mildew, show as referring in inoculation toxicity powdery mildew microspecies opisthaptor
Number relatively control is risen, and illustrates that HvMPK4a gene is the inhibitors of barley mildew-resistance.
Influence research of the 4 silencing HvMPK4a of embodiment to barley mildew-resistance function
1, vector construction.
The sequence fragment of HvMPK4a gene specific is building up to the silent carrier for carrying hordeivirus γ chain
In pCa- γ bLIC.It is as follows to expand primer used in the specific fragment:
It is positive: 5'-AAGGAAGTTTAACTCATGACAGAGTATGTGGTC-3'；
It is reversed: 5'-AACCACCACCACCGTGTAATGCGTCTGCTTGGGTC-3'.
2, the conversion of Agrobacterium.
Agrobacterium strains EHA105 is crossed on LB solid medium culture, picking single colonie after two days trains liquid in LB
It is incubated overnight for 28 DEG C of 180rpm in base.Overnight culture expands culture to OD600After 0.5, bacterium solution is placed in 30 minutes on ice,
4 DEG C of 3000rpm collect thallus after being centrifuged 15 minutes, are resuspended thallus with the pre-cooling NaCl solution of 10mL0.15M, 4 DEG C of 5000rpm from
The heart collects thallus again after ten minutes.The 20mM CaCl being pre-chilled with 1mL2Thallus is resuspended in solution, and 50% glycerol of 0.5mL is added,
It mixes well and obtains Agrobacterium competent cell.Expression vector dna is added in Agrobacterium competent cell, gently piping and druming is mixed
It is even, be placed on ice after 30 minutes with liquid nitrogen flash freezer 1 minute, then with 37 DEG C water-bath heat shock 3 minutes.1mL LB culture solution 28 is added
DEG C 180rpm is cultivated 30 minutes, is coated on the LB solid medium added with corresponding antibiotic, and 28 DEG C are selected after inversion culture 2 days
Clone saves Agrobacterium-mediated Transformation body.
3, hordeivirus is expressed in tobacco.
The γ of the agrobacterium strains and viral α chain and β chain and carrying silencing segment of corresponding expression vectors will be converted
The Agrobacterium of chain is crossed on LB solid medium, picking Agrobacterium single colonie after two days, 28 DEG C of 230rpm in LB culture solution
Overnight incubation.Overnight culture is transferred in 8mL LB culture solution (MES containing 10mM and 0.02mM acetosyringone) by 1:50,
Squamous subculture is to OD6003000rpm is centrifuged 15 minutes collection thallus after being 1.5, and thallus is resuspended to OD600Be 0.7,24 DEG C be protected from light it is quiet
Tobacco (Nicotiana benthamiana) blade of 4 weeks sizes is injected after setting 3 hours.
4, barley is infected with hordeivirus.
It two weeks after injection, gives full expression to and propagates in this life cigarette to virus, clip has the blade of virus phenotype, is added
The sodium phosphate buffer of 20mM pH 7.2 is ground to homogenate, uses filtered through gauze.Diatomite is added in filtrate, frictional inoculation is raw
Long 14 days barley leaves.The virus phenotype of barley leaves is observed after 10-14 days.
5, it is inoculated with powdery mildew and counts microcolony index.
There to be the barley leaves of virus phenotype to cut to be laid on 1%agar plate, be inoculated with a small amount of powdery mildew, is put into artificial
It is cultivated in climate box.
The fixed rear decoloring of blade that three days will be cultivated.Finally dyed with coomassie brilliant blue R250.It observes, unites under the microscope
Meter is capable of the spore number of aerial mycelium, and the spore number of only appresorium, the spore number and spore of aerial mycelium
The ratio of sub- sum is microcolony index.
The gene silencing methods that this experiment is mediated using hordeivirus silencing HvMPK4a in barley GP, with
Silencing empty carrier is negative control, in conjunction with powdery mildew inoculation and microcolony index statistics later, has studied the silencing in barley
Influence of the HvMPK4a to barley powdery mildew bacteria resistance.
See that Fig. 4, microcolony represent the susceptibility of barley, numerical value is bigger to illustrate that barley is more susceptible.With affine biological strain A6
After being inoculated with the blade of instantaneous silencing HvMPK4a, it can be seen that barley increases the resistance of powdery mildew.As shown in Fig. 4 left figure, big
In wheat after silencing HvMPK4a, barley enhances the resistance of powdery mildew, shows as the germ after being inoculated with affine powdery mildew microspecies
It falls index to be remarkably decreased compared with control, illustrates that HvMPK4a gene is the inhibitors of barley mildew-resistance.And Fig. 4 right figure then shows
The expression quantity of HvMPK4a gene only has original 1/10 in silencing rear blade.
Although above the present invention is described in detail with a general description of the specific embodiments,
On the basis of the present invention, it can be made some modifications or improvements, this will be apparent to those skilled in the art.Cause
This, these modifications or improvements, fall within the scope of the claimed invention without departing from theon the basis of the spirit of the present invention.
Claims (1)
1. protein kinase HvMPK4a relevant to barley mildew-resistance or the weight containing protein kinase HvMPK4a encoding gene
Group carrier, expression cassette, transgenic cell line or recombinant bacterium are in screening disease resistance of plant, breeding disease-resistant plants or building is disease-resistant turns base
Because of the application in plant,
The amino acid sequence of the protein kinase HvMPK4a is as shown in SEQ ID No.1；The plant is barley, disease-resistant performance
For mildew-resistance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610286953.8A CN105802929B (en) | 2016-05-03 | 2016-05-03 | Protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610286953.8A CN105802929B (en) | 2016-05-03 | 2016-05-03 | Protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105802929A CN105802929A (en) | 2016-07-27 |
| CN105802929B true CN105802929B (en) | 2019-08-20 |
Family
ID=56455125
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610286953.8A Expired - Fee Related CN105802929B (en) | 2016-05-03 | 2016-05-03 | Protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105802929B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114317566B (en) * | 2022-01-13 | 2023-04-11 | 福建农林大学 | Application of powdery mildew resistance related gene MPK15 |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102649812A (en) * | 2011-02-24 | 2012-08-29 | 中国科学院遗传与发育生物学研究所 | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof |
| CN102649811A (en) * | 2011-02-24 | 2012-08-29 | 中国科学院遗传与发育生物学研究所 | Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2 |
| CN103588868A (en) * | 2012-08-17 | 2014-02-19 | 中国科学院遗传与发育生物学研究所 | Wheat protein TaMYB1, and coding gene and application thereof |
| CN103833836A (en) * | 2012-11-22 | 2014-06-04 | 中国科学院遗传与发育生物学研究所 | Barley protein HvMYB6 and coding gene and application thereof |
| CN104561032A (en) * | 2013-10-28 | 2015-04-29 | 常熟市董浜镇里睦蔬菜专业合作社 | Quick identification of powdery mildew resistant gene for barley |
-
2016
- 2016-05-03 CN CN201610286953.8A patent/CN105802929B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102649812A (en) * | 2011-02-24 | 2012-08-29 | 中国科学院遗传与发育生物学研究所 | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof |
| CN102649811A (en) * | 2011-02-24 | 2012-08-29 | 中国科学院遗传与发育生物学研究所 | Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2 |
| CN103588868A (en) * | 2012-08-17 | 2014-02-19 | 中国科学院遗传与发育生物学研究所 | Wheat protein TaMYB1, and coding gene and application thereof |
| CN103833836A (en) * | 2012-11-22 | 2014-06-04 | 中国科学院遗传与发育生物学研究所 | Barley protein HvMYB6 and coding gene and application thereof |
| CN104561032A (en) * | 2013-10-28 | 2015-04-29 | 常熟市董浜镇里睦蔬菜专业合作社 | Quick identification of powdery mildew resistant gene for barley |
Non-Patent Citations (1)
| Title |
|---|
| GenBank: BAJ97968.1;GenBank;《GenBank》;20110520;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105802929A (en) | 2016-07-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103562395B (en) | Insect pest is had the plant of resistance | |
| ES2539110T3 (en) | MIR604 Corn Event | |
| EA039511B1 (en) | Method for conducting site-specific modification on entire plant via gene transient expression | |
| HU219057B (en) | Proteins with insecticidal properties against homopteran insects and their use in plant protection | |
| CN110157719A (en) | Sclerotinite SsMAS3 gene and its application in plant resistance to sclerotinia sclerotiorum breeding | |
| CN103589749A (en) | Methods for enhancing stress tolerance in plants | |
| JP6375380B2 (en) | Phytophthora resistant plant belonging to the solanaceous family | |
| CN110117320A (en) | Cotton GhCAL-D07 gene is promoting the application in flowering of plant | |
| CN107177610B (en) | Arabidopsis thaliana MPK gene for regulating seed size and method for increasing seed size | |
| CN105755020B (en) | Radix Notoginseng mitogen-activated protein kinase kinase gene PnMAPKK1 and its application | |
| CN106834314A (en) | Millet adversity gene SiRLK35 and encoding proteins and application | |
| CN109234285A (en) | Application of the Zm-Remorin gene in corn stalk rot disease prevention and treatment | |
| CN105177001B (en) | The miR167d related to barley mildew-resistance and its application | |
| CN104388448B (en) | A kind of corn phospholipase A_2 gene ZmsPLA2-1 and its application | |
| CN105802929B (en) | Protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene and application | |
| CN113621643A (en) | Application of GhTULP34 in regulation and control of plant resistance to abiotic adversity stress and regulation and control method | |
| CN110373417A (en) | Cotton GhMADS41-A04 gene is promoting the application in flowering of plant | |
| CN105177002A (en) | miR159a related to barley powdery mildew resistance and application thereof | |
| CN110117321A (en) | Cotton GhDctpp1-D11 gene is promoting the application in flowering of plant | |
| CN107446934B (en) | A kind of gene, albumen and its application participating in the reaction of tobacco salt stress | |
| CN115491380B (en) | Plant lipoxygenase gene LOX and application thereof in broad-spectrum disease resistance of plants | |
| CN105585621B (en) | Soybean protein GmAIRP1 and its encoding gene and application | |
| CN105585620B (en) | Soybean protein GmAIRP1 and its encoding gene are cultivating the application in resistance plant | |
| CN112029775B (en) | Cabbage mustard BoWRKY33 gene and application thereof | |
| CN103497958A (en) | Rice OsXrn4 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20190820 |