CN102649812A - Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof - Google Patents
Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof Download PDFInfo
- Publication number
- CN102649812A CN102649812A CN2011100453031A CN201110045303A CN102649812A CN 102649812 A CN102649812 A CN 102649812A CN 2011100453031 A CN2011100453031 A CN 2011100453031A CN 201110045303 A CN201110045303 A CN 201110045303A CN 102649812 A CN102649812 A CN 102649812A
- Authority
- CN
- China
- Prior art keywords
- powdery mildew
- wheat
- barley
- seq
- tawrky1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses powdery mildew resistance-related protein TaWRKY1 and a coding gene thereof. The protein is protein which is shown by (a) or (b): (a) protein consisting of an amino acid sequence shown by SEQ ID NO: 1; and (b) protein derived from (a) by substituting and/or deleting and/or adding one or more amino acid residues based on the amino acid sequence shown by the SEQ ID NO: 1 and related to powdery mildew resistance. Experiments prove that the gene is used for negative regulation of the powdery mildew resistance performance of wheat or barley. The gene has broad application prospect in the aspect of wheat breeding and great significance in the aspect of guaranteeing high and stable yield of wheat.
Description
Technical field
The present invention relates to a kind of albumen TaWRKY1 and the encoding sox thereof relevant with mildew-resistance.
Background technology
Wheat powdery mildew (Powdery mildew) is a kind of fungal disease that is caused by obligatory parasitism fungi standing grain Bu Shi powdery mildew Bgt (Blumeria graminis f sp.tritici), belongs to universal disease, has had a strong impact on the output of world wheat.In recent years, because the increasing of density of crop, the increase of amount of application of nitrogen fertilizer, and crop-planting is single, the harm that wheat powdery mildew is caused is serious day by day.After wheat is injured, can cause blade early withered, photosynthesis reduces, and respiration is strengthened, and tiller number reduces, and the percentage of earbearing tiller reduces, and dry granular heavily descends, but the general underproduction 5%～10%, and the underproduction of grave illness field reaches more than 20%.Colony is big because wheat powdery mildew has, wide accommodation, physiological strain are numerous, and speed of mutation is fast, makes many effective disease-resistant genes forfeiture resistances.The breeding work person with seed selection and the main means of prevention of popularization disease-resistant variety as disease, quite become effective for many years, but resistant lose is unsolved problem always that the variation of anti-source is to realize the persistent effective way of disease resistance always at present.Through the new disease-resistant gene of biological method clone, utilizing transgenic method raising wheat is one of available strategy of preventing and treating from now on Powdery Mildew to the resistance of Powdery Mildew for this reason.
Summary of the invention
An object of the present invention is to provide a kind of albumen relevant and encoding sox thereof with powder mildew resistance.
Albumen provided by the present invention, the name be called TaWRKY1, derive from common wheat capital 411, be following a) or b) protein:
A) protein of forming by the aminoacid sequence shown in the SEQ ID NO:1;
B) with the aminoacid sequence shown in the SEQ ID NO:1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with powder mildew resistance by a) deutero-protein.
Said encoding sox is following 1) or 2) or 3) shown in:
1) its nucleotide sequence is a dna molecular shown in the SEQ ID NO:2;
2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;
3) with 1) dna sequence dna that limits has homology and the dna molecular of encoding said proteins more than 90%.
Increase above-mentioned arbitrary said full length gene or its any segmental primer to also belonging to protection scope of the present invention.
A primer sequence of said primer centering is shown in SEQ ID NO:3, and another primer sequence of said primer centering is shown in SEQ ID NO:4.
The recombinant vectors, reorganization bacterium, transgenic cell line, recombinant virus or the expression cassette that contain above-mentioned arbitrary said gene also belong to protection scope of the present invention.
Above-mentioned arbitrary said albumen or above-mentioned arbitrary said protein coding gene also belong to protection scope of the present invention the adjusting plant to the application in the resistance of Powdery Mildew.
In the above-mentioned application, said Powdery Mildew is barley powdery mildew or wheat powdery mildew; Said plant is barley or wheat.
In above-mentioned arbitrary said application, said barley powdery mildew is caused that by barley powdery mildew bacteria said wheat powdery mildew is caused by wheat powdery mildew.
In above-mentioned arbitrary said application, said barley powdery mildew bacteria be big wheat powdery mildew physiological strain K1 (AvrMla1, virMla6, virMla12, virMlg) or barley powdery mildew bacteria physiological strain A6 (virMla1, AvrMla6, AvrMla12, AvrMlg); Said wheat powdery mildew is No. 15 physiological strain E09 of wheat powdery mildew;
In above-mentioned arbitrary said application, said barley is barley variety P01 (containing Mla1); Said wheat is that wheat breed is raised wheat 158 (not containing Pm21).
The mildew-resistance performance that experiment showed, gene pairs wheat of the present invention or barley is carried out negative regulation.Gene of the present invention will have broad application prospects aspect wheat breeding, have great importance aspect the assurance improving yield of wheat stable yields.
Description of drawings
Fig. 1 is wheat TaWRKY1 protein subcellular location.
Fig. 2 is disease-resistant susceptible cell diagram.
Embodiment
Employed experimental technique is ordinary method like no specified otherwise among the following embodiment.
Used material, reagent etc. like no specified otherwise, all can obtain from commercial sources among the following embodiment.
The acquisition of embodiment 1, TaWRKY1
1, the electronics of candidate EST and full length gene cDNA extends
With barley HvWRKY1 is kind of a subsequence, search wheat est database (
Http:// compbio.dfci.harvard.edu/tgi/cgi-bin/tgi) in est sequence, preserve height homologous est sequence, the sequence that searches out spliced be assembled into contig (contig), the ORFs of prediction (Openreading frame, ORF) outside, design specific primers; Primer sequence is following:
TaWRKY1：F1?5’＞ATGGATCCATGGGTCAGCAG＞3’(SEQ?ID?NO：3)
R1?5’＞TTAATTGATGTCCCTGGTC＞3’(SEQ?ID?NO：4)
2, the clone of the cDNA of wheat TaWRKY1 gene
Select big or small consistent wheat breed Henan wheat 66 (high mildew-resistances), each 40 seed of capital 411 (high sense Powdery Mildew); Be seeded in the seedling alms bowl; When growing to first leaf and launching fully (about one all left and right sides time), utilize No. 15 physiological strains of Beijing area popular wheat powdery mildew (E09 bacterial strain) that wheat lines is carried out high-density and connect bacterium and handle, after connecing bacterium 0,1,2,3,12,24 hour; Collect wheat leaf blade, be used for the extraction of total RNA.Utilize the Trizol method to extract the total RNA of wheat; With total RNA is template, adopts synthetic cDNA first chain of M-MLV ReverseTranscriptase of Invitrogen company, is template with synthetic first chain; With above-mentioned primer F1/R1 is carried out the RT-PCR amplification, amplified production checks order.
Sequencing result to the amplified production in capital 411 shows: obtaining cDNA is the gene shown in the SEQ ID NO:2, is TaWRKY1 with this unnamed gene, and the aminoacid sequence of its encoded protein is shown in SEQ ID NO:1.
The molecular characterization of embodiment 2, wheat TaWRKY1 and study on mechanism
One of characteristic of transcription factor is to be positioned in the nucleus, and in nucleus, carries out its transcriptional control function.For this reason, utilize the method for particle gun mediation in the wheat leaf blade cell, the proteic Subcellular Localization of wheat TaWRKY1 to be studied.The result shows that HvWRKY2 is identical with barley, and wheat TaWRKY1 also is positioned (Fig. 1) in the nucleus.Among Fig. 1, CFP (cyan fluorescent protein), CFP-HvWRKY2 (CFP is at the N of HvWRKY2 end), TaWRKY1-YFP (yellow fluorescence protein is at the C of TaWRKY1 end), Overlay are overlapping.
Embodiment 3, the functional study of TaWRKY1 in barley and wheat anti-powdery mildew
1, the function of TaWRKY1 in the barley mildew-resistance
(1) TaWRKY1 specially changes the influence of resistance to the barley microspecies
Carrier pGY-1 disclosed in document " Patrick Schweizer et al; A Transient Assay System for theFunctional Assessment of Defense-Related Genes in Wheat.MPMI; 1999; 12:647-654 ", and the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.
Carrier p35S-GUS disclosed in document " Patrick Schweizer et al; A Transient Assay System for theFunctional Assessment of Defense-Related Genes in Wheat.MPMI; 1999; 12:647-654 ", and the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.
Barley variety P01 (containing Mla1) disclosed in document " Shen Q H et al.; Recognition Specificity andRAR1/SGT1 Dependence in Barley Mla Disease Resistance Genes to the Powdery MildewFungus.2003; 15:732-744 ", and the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.
Barley powdery mildew bacteria physiological strain K1 (AvrMla1; VirMla6; VirMla12 virMlg) disclosed in document " Shen QH et al., Recognition Specificity and RAR1/SGT1 Dependence in Barley Mla DiseaseResistance Genes to the Powdery Mildew Fungus.2003; 15:732-744 ", and the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.
P DONR201 is available from Invitrogen company; PUbi-GW is available from Invitrogen company.BP reaction reagent and LR reaction reagent are all available from Invitrogen company.
The structure of carrier pUbi-TaWRKY1 and authentication method:
The primer of design amplification TaWRKY1 total length, the front end of upstream primer adds attB1, downstream primer adds attB2 (F:5-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGATCCATGGGTCAGC-3
R:5-GGGGACCACTTTGTACAAGAAAGCTGGGTCATTGATGTCCCTGGTCGG-3), be template with gene shown in the SEQ ID NO:2 of synthetic, carry out pcr amplification; Amplified production reclaims, and reclaims after product and pDONR201 and carries out BP reaction generation ENTRY carrier.
PCR product (40ng/ul) 3.5ul
BP recombinase mixture 0.5ul
p?DONR201(100ng/ul) 1ul
25℃，3hr。
Enzyme is cut the evaluation positive colony, and positive gram property is the ENTRY carrier.
The ENTRY carrier carries out the LR reaction with p Ubi-GW again.System is following:
ENTRY carrier (100ng/ul) 1ul
LR recombinase mixture 0.5ul
p?Ubi-GW(100ng/ul) 1ul
TE(PH＝8.0) 2ul
25℃，3hr。
Enzyme is cut the evaluation positive colony, and positive gram property is pUbi-TaWRKY1.Positive colony is carried out sequence verification, sequence verification result: record and contain gene order shown in the SEQ ID NO:2 among the pUbi-TaWRKY1.Be used for subsequent experimental.
The structure of carrier pUbi-HvWRKY2 and authentication method: to F/R, is that the sequence of AJ853838 be template with Genebank number of synthetic with following primer, carries out pcr amplification, obtains the HvWRKY2 gene.Obtain recombinant vectors pUbi-HvWRKY2 according to the method described above.
F：5＞GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGAGGAGCAGTGGATG＞3
R：5＞GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAAGCAACAGGGATCC＞3。
Method for transformation: the method for particle gun mediation: barley seed is waited to grow to about a week blow the bud plantation through preserving moisture after, cuts first leaf; The blade face is positioned over and contains substratum (1% agar, 80mg/L benzimidazole up; All the other are water) petridish on, recovered 3 hours, carry out particle gun bombardment; Purpose plasmid pUbi-TaWRKY1 and plasmid p35S-GUS are pressed 1: 1 volume thorough mixing; Being wrapped in diameter is on the 1um bronze particulate; Adopt PDS-1000/He (U.S. Bio-Rad) bombardment target material; Particle gun bombardment parameter is: stop that the distance between net and the bombardment material is 5.5cm, can split film pressure is 1100Pa, and every rifle bronze-DNA consumption is 42/0.21ug.
Meet big wheat powdery mildew physiological strain K1 (AvrMla1; VirMla6, virMla12, method virMlg): after the particle gun bombardment finishes; Barley leaves is put into incubator recover to cultivate 4 hours (20 ℃ of culture condition, 16h illumination/18 ℃ 8h dark); Connect bacterium after 4 hours, spore is shaken off on barley leaves, guarantee 1 spore/mm
2, cultivate 40 hours (20 ℃ of culture condition, 16h, illumination/18 ℃ 8h, dark), carry out GUS dyeing, 37 ℃ are spent the night, and decolour after dyeing finishes, and utilize microscope to carry out cell observation two days later.
The ratio of susceptible cell is calculated the haustorium index in the cell of statistical presentation GUS, judges the function of gene TaWRKY1 according to the haustorium index.The relation of haustorium index and disease resistance: the haustorium index is high anti-less than 20%, is to be anti-in (comprising 30% and 60%) or middle sense between high sense, the 30%-60% greater than 60%.
The judgement criteria of disease-resistant cell: cell inner expression GUS, and do not contain haustorium in the cell, be disease-resistant cell (Fig. 2 A) and cell surface is attached with conidial cell.
The judgement criteria of susceptible cell: cell inner expression GUS, and the cell that cell contains haustorium is susceptible cell (Fig. 2 B).
Haustorium exponential calculation formula: the number of haustorium index=susceptible cell/(number of the number of disease-resistant cell+susceptible cell) * 100%.
With the barley leaves that changes pGY-1 and p35S-GUS over to as empty map, with the barley leaves that changes pUbi-HvWRKY2 and carrier p35S-GUS over to as positive control.
3 repetitions, results averaged are established in experiment.
The result shows that the haustorium index that changes the barley leaves of carrier pUbi-TaWRKY1 and carrier p35S-GUS over to is 55.44%; The haustorium index that changes the barley leaves of pGY-1 and carrier p35S-GUS over to is 17.58%; The haustorium index that changes the barley leaves of pUbi-HvWRKY2 and carrier p35S-GUS over to is 58.65%.
The result shows that behind the mistake expression TaWRKY1, the haustorium index obviously rises, and explains that the effect of TaWRKY1 and HvWRKY2 is identical in barley leaves, and specially changing in the microspecies of barley has the negative regulation effect in the resistance.
(2) TaWRKY1 is to the influence of barley background resistance
Barley powdery mildew bacteria physiological strain A6 (virMla1; AvrMla6; AvrMla12 AvrMlg) disclosed in document " ShenQ H et al., Recognition Specificity and RAR1/SGT1 Dependence in Barley Mla Disease ResistanceGenes to the Powdery Mildew Fungus.2003; 15:732-744 ", and the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.
Basic identical described in method and the experiment (1), the pathogenic bacterium of inoculation that different is be barley powdery mildew bacteria physiological strain A6 (virMla1, AvrMla6, AvrMla12, AvrMlg).
3 repetitions, results averaged are established in experiment.
The result shows that the haustorium index that changes the barley leaves of carrier pUbi-TaWRKY1 and carrier p35S-GUS over to is 81.94%; The haustorium index that changes the barley leaves of pGY-1 and carrier p35S-GUS over to is 54.60%; The haustorium index that changes the barley leaves of pUbi-HvWRKY2 and carrier p35S-GUS over to is 81.45%.
The result shows that behind the mistake expression TaWRKY1, the haustorium index obviously rises, and explains that the effect of TaWRKY1 and HvWRKY2 is identical, in the background resistance of barley, the negative regulation effect is arranged in barley leaves.
2.TaWRKY1 the function in wheat anti-powdery mildew
(1) TaWRKY1 specially changes the influence of resistance to the wheat microspecies
Wheat breed is raised wheat 158 (not containing Pm21) and in document " LIU P et al.; Transfer of disease resistance ofTriticum aestitpvum-Haynaldia villosa 6VS/6AI J translocation lines in diferent wheatbackground.Journal of Naming Agricultural University.2004; 27 (2): 1～5 ", was disclosed, and the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.
No. 15 physiological strains of wheat powdery mildew (bacterial strain E09) disclosed in document " Hu T Z et al.; Identification andMolecular Mapping Gene in Wheat Cultivar yu mai 66 of the Powdery Mildew Resistance.ACTAAGRONOMICA SINICA 2008; 34 (4): 545-55 ", and the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.
(1) is said basic identical in method and the experiment 1, and the pathogenic bacterium of inoculation that different is are No. 15 physiological strains of wheat powdery mildew (bacterial strain E09), conversion be that wheat breed is raised wheat 158 blade of (not containing Pm21).
3 repetitions, results averaged are established in experiment.
The result shows that the haustorium index that changes the wheat leaf blade of carrier pUbi-TaWRKY1 and carrier p35S-GUS over to is 81.93%; The haustorium index that changes the wheat leaf blade of pGY-1 and p35S-GUS over to is 54.60%; The haustorium index that changes the wheat leaf blade of pUbi-HvWRKY2 and p35S-GUS over to is 81.45%.
The result shows, in wheat leaf blade, cross expression TaWRKY1 after, the haustorium index obviously rises, and explains that TaWRKY1 specially changes in the microspecies of wheat to play the negative regulation effect in the resistance.
(2) TaWRKY1 is to the influence of wheat background resistance
Wheat breed wheat cluster dirty wheat translocation line 6VS/6AL (containing Pm21) disclosed in document " Cao AZ et al.; Cloningand Analysis of an Hv-OxOLP Gene Induced by Ergsiphe graminis in H.villosa.Journal ofTriticeae Crops.2006; 26 (5): 27～32 ", and the public can obtain with developmental biology institute from Chinese Academy of Sciences's heredity.
Basic identical described in method and the experiment (1), different is that used wheat breed is wheat breed wheat cluster dirty wheat translocation line 6VS/6AL (containing Pm21).
3 repetitions are established in experiment, and the result takes the mean.
The result shows that the haustorium index that changes the wheat leaf blade of carrier pUbi-TaWRKY1 and carrier p35S-GUS over to is 13.16%; The haustorium index that changes the wheat leaf blade of pGY-1 and carrier p35S-GUS over to is 13.60%; The haustorium index that changes the wheat leaf blade of pUbi-HvWRKY2 and carrier p35S-GUS over to is 12.62%.
The result shows that behind the mistake expression TaWRKY1, the haustorium index is almost constant in the wheat leaf blade, explains that the resistance of wide spectrum of Pm21 mediation does not rely on TaWRKY1.Function not effect in resistance of wide spectrum of TaWRKY1 is described, is possibly specially changed in the resistance in microspecies and work.
Claims (9)
1. albumen, be following a) or b) protein:
A) protein of forming by the aminoacid sequence shown in the SEQ ID NO:1;
B) with the aminoacid sequence shown in the SEQ ID NO:1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant with powder mildew resistance by a) deutero-protein.
2. the said proteic encoding sox of claim 1.
3. encoding sox according to claim 2 is characterized in that: said encoding sox is following 1) or 2) or 3) shown in:
1) its nucleotide sequence is a dna molecular shown in the SEQ ID NO:2;
2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of encoding said proteins;
3) with 1) dna sequence dna that limits has homology and the dna molecular of encoding said proteins more than 90%.
4. amplification claim 2 or 3 said full length genes or its any segmental primer are right.
5. primer according to claim 4 is right, it is characterized in that: a primer sequence of said primer centering is shown in SEQ ID NO:3, and another primer sequence of said primer centering is shown in SEQ ID NO:4.
6. the recombinant vectors, reorganization bacterium, transgenic cell line, recombinant virus or the expression cassette that contain claim 2 or 3 said encoding soxs.
7. encoding sox described in the said albumen of claim 1 or claim 2 or 3 is being regulated plant to the application in the resistance of Powdery Mildew.
8. application according to claim 7 is characterized in that: said Powdery Mildew is barley powdery mildew or wheat powdery mildew; Said plant is barley or wheat.
9. according to claim 7 or 8 described application, it is characterized in that: said barley powdery mildew is caused that by barley powdery mildew bacteria said wheat powdery mildew is caused by wheat powdery mildew.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110045303.1A CN102649812B (en) | 2011-02-24 | 2011-02-24 | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110045303.1A CN102649812B (en) | 2011-02-24 | 2011-02-24 | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102649812A true CN102649812A (en) | 2012-08-29 |
| CN102649812B CN102649812B (en) | 2014-04-02 |
Family
ID=46691942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110045303.1A Expired - Fee Related CN102649812B (en) | 2011-02-24 | 2011-02-24 | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102649812B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102942621A (en) * | 2012-10-30 | 2013-02-27 | 中国农业大学 | Plant powdery mildew resistance related protein TaCAF1 and its coding gene and application |
| CN104788550A (en) * | 2014-01-17 | 2015-07-22 | 中国科学院遗传与发育生物学研究所 | ScRGA-6RL3 protein and coding gene and application thereof |
| CN105441460A (en) * | 2016-01-06 | 2016-03-30 | 昆明理工大学 | Lilium regale Wilson WRKY transcription factor gene LrWRKY1 and application |
| CN105802929A (en) * | 2016-05-03 | 2016-07-27 | 中国科学院遗传与发育生物学研究所 | Protein kinase HvMPK4a related to barley powdery mildew resistance and encoding gene and application of protein kinase HvMPK4a |
| CN108424438A (en) * | 2018-05-17 | 2018-08-21 | 青岛大学 | A kind of wheat powdery mildew resistance-associated protein TaWRKY49 and its encoding gene and application |
-
2011
- 2011-02-24 CN CN201110045303.1A patent/CN102649812B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| QIAN-HUA SHEN ET AL.: "Nuclear Activity of MLA Immune Receptors Links Isolate-Specific and Basal Disease-Resistance Responses", 《SCIENCE》 * |
| YASSER MABROUK ET AL.: "Differential Expression of Potato WRKY1 Gene Upon Erwinia carotovora Infection", 《AUSTRALIAN JOURNAL OF BASIC AND APPLIED SCIENCES》 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102942621A (en) * | 2012-10-30 | 2013-02-27 | 中国农业大学 | Plant powdery mildew resistance related protein TaCAF1 and its coding gene and application |
| CN102942621B (en) * | 2012-10-30 | 2014-03-05 | 中国农业大学 | Plant powdery mildew resistance related protein TaCAF1 and its coding gene and application |
| CN104788550A (en) * | 2014-01-17 | 2015-07-22 | 中国科学院遗传与发育生物学研究所 | ScRGA-6RL3 protein and coding gene and application thereof |
| CN104788550B (en) * | 2014-01-17 | 2017-11-28 | 中国科学院遗传与发育生物学研究所 | ScRGA 6RL3 and its encoding gene and application |
| CN105441460A (en) * | 2016-01-06 | 2016-03-30 | 昆明理工大学 | Lilium regale Wilson WRKY transcription factor gene LrWRKY1 and application |
| CN105441460B (en) * | 2016-01-06 | 2018-08-10 | 昆明理工大学 | A kind of Ming River lily WRKY transcription factor genes LrWRKY1 and application |
| CN105802929A (en) * | 2016-05-03 | 2016-07-27 | 中国科学院遗传与发育生物学研究所 | Protein kinase HvMPK4a related to barley powdery mildew resistance and encoding gene and application of protein kinase HvMPK4a |
| CN105802929B (en) * | 2016-05-03 | 2019-08-20 | 中国科学院遗传与发育生物学研究所 | Protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene and application |
| CN108424438A (en) * | 2018-05-17 | 2018-08-21 | 青岛大学 | A kind of wheat powdery mildew resistance-associated protein TaWRKY49 and its encoding gene and application |
| CN108424438B (en) * | 2018-05-17 | 2021-06-25 | 青岛大学 | Wheat powdery mildew resistance-related protein TaWRKY49, and coding gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102649812B (en) | 2014-04-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102649811B (en) | Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2 | |
| CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
| WO2020207125A1 (en) | Nucleic acid sequence for detecting maize plant dbn9501 and detection method therefor | |
| CN104878091B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9978 | |
| CN107475210B (en) | Rice bacterial leaf blight resistance related gene OsABA2 and application thereof | |
| CN102649812B (en) | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof | |
| CN109971880B (en) | Nucleic acid sequence for detecting corn plant DBN9508 and detection method thereof | |
| EP3696188A1 (en) | Gene for resistance to plant disease | |
| CN103266109A (en) | Molecular marker of rice resistance gene Xa23 and application of molecular marker | |
| CN106811462B (en) | Indel marker linked with tomato gray leaf spot resistance gene Sm as well as amplification primer and application thereof | |
| CN109609527A (en) | CDPK18L gene is improving the application in tomato bacterial leaf spot resistance and high temperature resistance as negative regulatory factor | |
| US20220154206A1 (en) | Gene for resistance to plant disease | |
| CN108004346B (en) | Wheat gene Yr10 molecular marker and application thereof in screening wheat with wheat stripe rust resistance | |
| Saiprasad et al. | Development of Trichoderma harzianum endochitinase gene construct conferring antifungal activity in transgenic tobacco | |
| CN116284286A (en) | Wheat stripe rust fungus sugar transport protein, gene and application thereof | |
| CN110283238B (en) | Rice disease-resistant protein RWR1 and application thereof | |
| CN100549029C (en) | One plant disease resistance-related SGT1 and encoding gene and application | |
| CN105198977A (en) | Plant powdery mildew resistance-related protein Pm-2F as well as encoding gene and application thereof | |
| CN104846084B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9927 | |
| EP3567111A1 (en) | Gene for resistance to a pathogen of the genus heterodera | |
| CN114196660B (en) | Application of rape FC2 ferrous chelate enzyme gene in improving rape yield | |
| CN101003570A (en) | Plant against disease relevant protein RAR1, and coding gene, and application | |
| Storfie | Fungal Pathogen Emergence: An Ustilago maydis x Sporisorium reilianum Model | |
| US20220389443A1 (en) | Gene for resistance to a pathogen of the genus heterodera | |
| CN114989283A (en) | Application of TCP19 protein in regulation and control of rice sheath blight resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140402 Termination date: 20180224 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |