CN102649812B - Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof - Google Patents
Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof Download PDFInfo
- Publication number
- CN102649812B CN102649812B CN201110045303.1A CN201110045303A CN102649812B CN 102649812 B CN102649812 B CN 102649812B CN 201110045303 A CN201110045303 A CN 201110045303A CN 102649812 B CN102649812 B CN 102649812B
- Authority
- CN
- China
- Prior art keywords
- wheat
- powdery mildew
- barley
- tawrky1
- encoding gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 52
- 241000221785 Erysiphales Species 0.000 title claims abstract description 42
- 102000004169 proteins and genes Human genes 0.000 title claims abstract description 15
- 241000209140 Triticum Species 0.000 claims abstract description 68
- 235000021307 Triticum Nutrition 0.000 claims abstract description 68
- 235000007340 Hordeum vulgare Nutrition 0.000 claims abstract description 44
- 125000003275 alpha amino acid group Chemical group 0.000 claims abstract description 6
- 241000209219 Hordeum Species 0.000 claims description 43
- 241000894006 Bacteria Species 0.000 claims description 12
- 235000018102 proteins Nutrition 0.000 claims description 9
- 241000196324 Embryophyta Species 0.000 claims description 4
- 239000013598 vector Substances 0.000 claims description 3
- 241000700605 Viruses Species 0.000 claims description 2
- 230000001105 regulatory effect Effects 0.000 claims description 2
- 238000002474 experimental method Methods 0.000 abstract description 10
- 230000003828 downregulation Effects 0.000 abstract description 5
- 125000000539 amino acid group Chemical group 0.000 abstract description 2
- 238000009395 breeding Methods 0.000 abstract description 2
- 230000001488 breeding effect Effects 0.000 abstract description 2
- 240000005979 Hordeum vulgare Species 0.000 abstract 1
- 210000004027 cell Anatomy 0.000 description 20
- 238000000034 method Methods 0.000 description 13
- 201000010099 disease Diseases 0.000 description 9
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 description 9
- 230000000694 effects Effects 0.000 description 6
- 208000035240 Disease Resistance Diseases 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 5
- 239000002245 particle Substances 0.000 description 5
- 239000002299 complementary DNA Substances 0.000 description 4
- 108020004414 DNA Proteins 0.000 description 3
- 101710113900 Protein SGT1 homolog Proteins 0.000 description 3
- 102100027722 Small glutamine-rich tetratricopeptide repeat-containing protein alpha Human genes 0.000 description 3
- 230000001580 bacterial effect Effects 0.000 description 3
- 239000003153 chemical reaction reagent Substances 0.000 description 3
- 108010082025 cyan fluorescent protein Proteins 0.000 description 3
- 238000004519 manufacturing process Methods 0.000 description 3
- 230000005945 translocation Effects 0.000 description 3
- 102000004190 Enzymes Human genes 0.000 description 2
- 108090000790 Enzymes Proteins 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 2
- 108700026244 Open Reading Frames Proteins 0.000 description 2
- 238000012408 PCR amplification Methods 0.000 description 2
- 101150054327 RAR1 gene Proteins 0.000 description 2
- 102000018120 Recombinases Human genes 0.000 description 2
- 108010091086 Recombinases Proteins 0.000 description 2
- 101100011885 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) ERG12 gene Proteins 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000003556 assay Methods 0.000 description 2
- 244000052616 bacterial pathogen Species 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000004043 dyeing Methods 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 238000005286 illumination Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 239000000203 mixture Substances 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 239000013612 plasmid Substances 0.000 description 2
- 239000000843 powder Substances 0.000 description 2
- 238000001228 spectrum Methods 0.000 description 2
- 230000009261 transgenic effect Effects 0.000 description 2
- 230000001052 transient effect Effects 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- HYZJCKYKOHLVJF-UHFFFAOYSA-N 1H-benzimidazole Chemical compound C1=CC=C2NC=NC2=C1 HYZJCKYKOHLVJF-UHFFFAOYSA-N 0.000 description 1
- 229920001817 Agar Polymers 0.000 description 1
- 241001480061 Blumeria graminis Species 0.000 description 1
- 229910000906 Bronze Inorganic materials 0.000 description 1
- 241000233866 Fungi Species 0.000 description 1
- 244000070299 Hydrangea aspera Species 0.000 description 1
- 102100034343 Integrase Human genes 0.000 description 1
- 208000031888 Mycoses Diseases 0.000 description 1
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 1
- 108091023040 Transcription factor Proteins 0.000 description 1
- 102000040945 Transcription factor Human genes 0.000 description 1
- 244000098338 Triticum aestivum Species 0.000 description 1
- 241000510764 Villosa Species 0.000 description 1
- 230000004308 accommodation Effects 0.000 description 1
- 239000008272 agar Substances 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 238000010170 biological method Methods 0.000 description 1
- 239000010974 bronze Substances 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 235000013339 cereals Nutrition 0.000 description 1
- 238000012512 characterization method Methods 0.000 description 1
- KUNSUQLRTQLHQQ-UHFFFAOYSA-N copper tin Chemical compound [Cu].[Sn] KUNSUQLRTQLHQQ-UHFFFAOYSA-N 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 230000008034 disappearance Effects 0.000 description 1
- 230000006806 disease prevention Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000011081 inoculation Methods 0.000 description 1
- 230000002045 lasting effect Effects 0.000 description 1
- 238000013507 mapping Methods 0.000 description 1
- 230000003020 moisturizing effect Effects 0.000 description 1
- 230000035772 mutation Effects 0.000 description 1
- 239000000618 nitrogen fertilizer Substances 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 230000024241 parasitism Effects 0.000 description 1
- 230000029553 photosynthesis Effects 0.000 description 1
- 238000010672 photosynthesis Methods 0.000 description 1
- 239000013641 positive control Substances 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 230000022532 regulation of transcription, DNA-dependent Effects 0.000 description 1
- 230000029058 respiratory gaseous exchange Effects 0.000 description 1
- 238000003757 reverse transcription PCR Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 230000004960 subcellular localization Effects 0.000 description 1
- 230000002194 synthesizing effect Effects 0.000 description 1
- 239000013077 target material Substances 0.000 description 1
- 238000012546 transfer Methods 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention discloses powdery mildew resistance-related protein TaWRKY1 and a coding gene thereof. The protein is protein which is shown by (a) or (b): (a) protein consisting of an amino acid sequence shown by SEQ ID NO: 1; and (b) protein derived from (a) by substituting and/or deleting and/or adding one or more amino acid residues based on the amino acid sequence shown by the SEQ ID NO: 1 and related to powdery mildew resistance. Experiments prove that the gene is used for negative regulation of the powdery mildew resistance performance of wheat or barley. The gene has broad application prospect in the aspect of wheat breeding and great significance in the aspect of guaranteeing high and stable yield of wheat.
Description
Technical field
The present invention relates to a kind of albumen TaWRKY1 and the encoding gene thereof relevant to mildew-resistance.
Background technology
Wheat powdery mildew (Powdery mildew) is a kind of fungal disease being caused by obligatory parasitism fungi standing grain dlumeria graminis Bgt (Blumeria graminis f sp.tritici), belong to universal disease, had a strong impact on the output of world wheat.In recent years, due to increasing of density of crop, the increase of amount of application of nitrogen fertilizer, and crop-planting is single, the harm that wheat powdery mildew is caused is day by day serious.After wheat is injured, can cause blade early withered, photosynthesis reduces, and respiration is strengthened, and tiller number reduces, and the percentage of earbearing tiller reduces, and dry granular heavily declines, generally can the underproduction 5%～10%, and the underproduction of grave illness field reaches more than 20%.Because wheat powdery mildew has that colony is large, wide accommodation, physiological strain be numerous, and speed of mutation is fast, makes many effective disease-resistant genes lose resistances.At present breeder is usingd selection and popularization disease-resistant variety as the main means of prevention of disease always, quite become effective for many years, but resistant lose is unsolved problem always, and the variation of anti-source is to realize the effective way that disease resistance is lasting.By biological method, clone new disease-resistant gene, utilizing transgenic method to improve wheat is one of available strategy of preventing and treating from now on Powdery Mildew to the resistance of Powdery Mildew for this reason.
Summary of the invention
An object of the present invention is to provide a kind of albumen relevant to powder mildew resistance and encoding gene thereof.
Albumen provided by the present invention, name be called TaWRKY1, derive from common wheat capital 411, be following a) or b) protein:
A) protein being formed by the aminoacid sequence shown in SEQ ID NO:1;
B) by aminoacid sequence shown in SEQ ID NO:1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and relevant to powder mildew resistance by a) derivative protein.
Described encoding gene is following 1) or 2) or 3) shown in:
1) its nucleotide sequence is DNA molecular shown in SEQ ID NO:2;
2) under stringent condition with 1) the DNA sequence dna hybridization that limits and the DNA molecular of encoding said proteins;
3) with 1) DNA sequence dna that limits has more than 90% homology and the DNA molecular of encoding said proteins.
The primer pair of above-mentioned arbitrary described full length gene or its any fragment of increasing also belongs to protection scope of the present invention.
A primer sequence in described primer pair is as shown in SEQ ID NO:3, and another primer sequence in described primer pair is as shown in SEQ ID NO:4.
The recombinant vectors that contains above-mentioned arbitrary described gene, recombinant bacterium, transgenic cell line, recombinant virus or expression cassette also belong to protection scope of the present invention.
Above-mentioned arbitrary described albumen or above-mentioned arbitrary described protein coding gene also belong to protection scope of the present invention at regulating plant to the application in the resistance of Powdery Mildew.
In above-mentioned application, described Powdery Mildew is barley powdery mildew or wheat powdery mildew; Described plant is barley or wheat.
In above-mentioned arbitrary described application, described barley powdery mildew causes by barley powdery mildew bacteria, and described wheat powdery mildew is caused by wheat powdery mildew.
In above-mentioned arbitrary described application, described barley powdery mildew bacteria is large wheat powdery mildew physiological strain K1 (AvrMla1, virMla6, virMla12, virMlg) or barley powdery mildew bacteria physiological strain A6 (virMla1, AvrMla6, AvrMla12, AvrMlg); Described wheat powdery mildew is No. 15 physiological strain E09 of wheat powdery mildew;
In above-mentioned arbitrary described application, described barley is barley variety P01 (containing Mla1); Described wheat is wheat breed Yangmai No.158 (not containing Pm21).
The mildew-resistance performance that experiment showed, gene pairs wheat of the present invention or barley is carried out negative regulation.Gene of the present invention will have broad application prospects aspect wheat breeding, aspect assurance improving yield of wheat stable yields, have great importance.
Accompanying drawing explanation
Fig. 1 is wheat TaWRKY1 protein subcellular location.
Fig. 2 is disease-resistant susceptible cell diagram.
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
The acquisition of embodiment 1, TaWRKY1
1, the electronics of candidate EST and full length gene cDNA extends
Take barley HvWRKY1 as Seed Sequences, search wheat est database (
http:// compbio.dfci.harvard.edu/tgi/cgi-bin/tgi) in est sequence, preserve the est sequence of height homology, the sequence searching out splice and is assembled into contig (contig), outside the open reading frame (Openreading frame, ORF) of prediction, design Auele Specific Primer; Primer sequence is as follows:
TaWRKY1：F1 5’＞ATGGATCCATGGGTCAGCAG＞3’(SEQ ID NO：3)
R1 5’＞TTAATTGATGTCCCTGGTC＞3’(SEQ ID NO：4)
2, the clone of the cDNA of wheat TaWRKY1 gene
Select wheat breed in the same size Henan wheat 66 (high mildew-resistance), each 40 seeds of capital 411 (high sense Powdery Mildew), be seeded in seedling alms bowl, when growing to first leaf and launching completely (about one week left and right time), utilize No. 15 physiological strains of the popular wheat powdery mildew in Beijing area (E09 bacterial strain) to carry out high-density to wheat lines and connect bacterium processing, after connecing bacterium 0,1,2,3,12,24 hour, collect wheat leaf blade, for the extraction of total RNA.Utilize Trizol method to extract the total RNA of wheat, take total RNA as template, adopt synthetic cDNA first chain of M-MLV ReverseTranscriptase of Invitrogen company, the first chain synthesizing of take is template, with above-mentioned primer pair F1/R1, carry out RT-PCR amplification, amplified production checks order.
Sequencing result to the amplified production in capital 411 shows: obtaining cDNA is the gene shown in SEQ ID NO:2, by this unnamed gene, is TaWRKY1, and the aminoacid sequence of the albumen of its coding is as shown in SEQ ID NO:1.
The molecular characterization of embodiment 2, wheat TaWRKY1 and study on mechanism
One of feature of transcription factor is to be positioned in nucleus, and in nucleus, carries out its transcriptional control function.For this reason, utilize the method for particle gun mediation in wheat leaf blade cell, the Subcellular Localization of wheat TaWRKY1 albumen to be studied.Result shows, HvWRKY2 is identical with barley, and wheat TaWRKY1 is also positioned (Fig. 1) in nucleus.In Fig. 1, CFP (cyan fluorescent protein), CFP-HvWRKY2 (CFP is at the N end of HvWRKY2), TaWRKY1-YFP (yellow fluorescence protein is at the C of TaWRKY1 end), Overlay are overlapping.
Embodiment 3, the TaWRKY1 functional study in barley and wheat anti-powdery mildew
1, the function of TaWRKY1 in barley mildew-resistance
(1) impact of TaWRKY1 on barley race specific resistance
Carrier pGY-1 disclosed in document " Patrick Schweizer et al; A Transient Assay System for theFunctional Assessment of Defense-Related Genes in Wheat.MPMI; 1999; 12:647-654 ", and the heredity of the public Ke Cong Chinese Academy of Sciences obtains with developmental biology institute.
Carrier p35S-GUS disclosed in document " Patrick Schweizer et al; A Transient Assay System for theFunctional Assessment of Defense-Related Genes in Wheat.MPMI; 1999; 12:647-654 ", and the heredity of the public Ke Cong Chinese Academy of Sciences obtains with developmental biology institute.
Barley variety P01 (containing Mla1) disclosed in document " Shen Q H et al.; Recognition Specificity andRAR1/SGT1 Dependence in Barley Mla Disease Resistance Genes to the Powdery MildewFungus.2003; 15:732-744 ", and the heredity of the public Ke Cong Chinese Academy of Sciences obtains with developmental biology institute.
Barley powdery mildew bacteria physiological strain K1 (AvrMla1, virMla6, virMla12, virMlg) in document " Shen QH et al.; Recognition Specificity and RAR1/SGT1 Dependence in Barley Mla DiseaseResistance Genes to the Powdery Mildew Fungus.2003; 15:732-744 ", disclosed, the heredity of the public Ke Cong Chinese Academy of Sciences obtains with developmental biology institute.
P DONR201 is purchased from Invitrogen company; PUbi-GW is purchased from Invitrogen company.BP reaction reagent and LR reaction reagent are all purchased from Invitrogen company.
The structure of carrier pUbi-TaWRKY1 and authentication method:
The primer of design amplification TaWRKY1 total length, the front end of upstream primer adds attB1, downstream primer adds attB2 (F:5-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGATCCATGGGTCAGC-3
R:5-GGGGACCACTTTGTACAAGAAAGCTGGGTCATTGATGTCCCTGGTCGG-3), the gene shown in the SEQ ID NO:2 of synthetic of take is template, carries out pcr amplification; Amplified production reclaims, and reclaims after product and pDONR201 and carries out BP reaction generation ENTRY carrier.
PCR product (40ng/ul) 3.5ul
BP recombinase mixture 0.5ul
p DONR201(100ng/ul) 1ul
25℃，3hr。
Enzyme is cut evaluation positive colony, and a positive gram property is ENTRY carrier.
ENTRY carrier carries out LR reaction with p Ubi-GW again.System is as follows:
ENTRY carrier (100ng/ul) 1ul
LR recombinase mixture 0.5ul
p Ubi-GW(100ng/ul) 1ul
TE(PH＝8.0) 2ul
25℃，3hr。
Enzyme is cut evaluation positive colony, and a positive gram property is pUbi-TaWRKY1.Positive colony is carried out to sequence verification, sequence verification result: record and in pUbi-TaWRKY1, contain gene order shown in SEQ ID NO:2.For subsequent experimental.
The structure of carrier pUbi-HvWRKY2 and authentication method: with following primer pair F/R, the sequence that No. Genebank of synthetic of take is AJ853838 is template, carries out pcr amplification, obtains HvWRKY2 gene.Obtain according to the method described above recombinant vectors pUbi-HvWRKY2.
F：5＞GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGAGGAGCAGTGGATG＞3
R：5＞GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAAGCAACAGGGATCC＞3。
Method for transformation: the method for particle gun mediation: barley seed is after bud plantation is blown in moisturizing, wait to grow to about one week, cut first leaf, blade face upward, be positioned on the culture dish that contains substratum (all the other are water for 1% agar, 80mg/L benzimidazole), recover 3 hours, carry out particle gun bombardment; Object plasmid pUbi-TaWRKY1 and plasmid p35S-GUS are fully mixed by 1: 1 volume, being wrapped in diameter is on 1um bronze particulate, adopt PDS-1000/He (U.S. Bio-Rad) bombardment target material, particle gun bombardment parameters is: stop that the distance between net and bombardment material is 5.5cm, can split film pressure is 1100Pa, and every rifle bronze-DNA consumption is 42/0.21ug.
Meet large wheat powdery mildew physiological strain K1 (AvrMla1, virMla6, virMla12, virMlg) method: after particle gun bombardment, barley leaves is put into incubator renewal cultivation 4 hours (20 ℃ of culture condition, 16h illumination/18 ℃ 8h dark), after 4 hours, connect bacterium, spore is shaken off on barley leaves, guarantee 1 spore/mm
2, cultivate 40 hours (20 ℃ of culture condition, 16h, illumination/18 ℃ 8h, dark), carry out GUS dyeing, 37 ℃ are spent the night, and after dyeing, decolour, and utilize two days later microscope to carry out cell observation.
In the cell of statistical presentation GUS, the ratio of susceptible cell is calculated haustorium index, judges the function of gene TaWRKY1 according to haustorium index.The relation of haustorium index and disease resistance: haustorium index is less than 20% for high resistance, being greater than 60% is between high sense, 30%-60%, to be anti-in (comprising 30% and 60%) or middle sense.
The judging criterion of disease-resistant cell: cell inner expression GUS, and in cell, do not contain haustorium, and cell surface is attached with conidial cell, be disease-resistant cell (Fig. 2 A).
The judging criterion of susceptible cell: cell inner expression GUS, and the cell that cell contains haustorium is susceptible cell (Fig. 2 B).
The calculation formula of haustorium index: the number of haustorium index=susceptible cell/(number of the number of disease-resistant cell+susceptible cell) * 100%.
Using proceed to pGY-1 and p35S-GUS barley leaves as empty map, using proceed to pUbi-HvWRKY2 and carrier p35S-GUS barley leaves as positive control.
3 repetitions, results averaged are established in experiment.
Result shows, the haustorium index that proceeds to the barley leaves of carrier pUbi-TaWRKY1 and carrier p35S-GUS is 55.44%; The haustorium index that proceeds to the barley leaves of pGY-1 and carrier p35S-GUS is 17.58%; The haustorium index that proceeds to the barley leaves of pUbi-HvWRKY2 and carrier p35S-GUS is 58.65%.
Result shows, in barley leaves, crosses after expression TaWRKY1, and haustorium index obviously rises, and illustrates that the effect of TaWRKY1 and HvWRKY2 is identical, has negative regulation effect in the race specific resistance of barley.
(2) impact of TaWRKY1 on barley background resistance
Barley powdery mildew bacteria physiological strain A6 (virMla1, AvrMla6, AvrMla12, AvrMlg) in document " ShenQ H et al.; Recognition Specificity and RAR1/SGT1 Dependence in Barley Mla Disease ResistanceGenes to the Powdery Mildew Fungus.2003; 15:732-744 ", disclosed, the heredity of the public Ke Cong Chinese Academy of Sciences obtains with developmental biology institute.
Basic identical described in method and experiment (1), different is that the pathogenic bacterium that inoculate are barley powdery mildew bacteria physiological strain A6 (virMla1, AvrMla6, AvrMla12, AvrMlg).
3 repetitions, results averaged are established in experiment.
Result shows, the haustorium index that proceeds to the barley leaves of carrier pUbi-TaWRKY1 and carrier p35S-GUS is 81.94%; The haustorium index that proceeds to the barley leaves of pGY-1 and carrier p35S-GUS is 54.60%; The haustorium index that proceeds to the barley leaves of pUbi-HvWRKY2 and carrier p35S-GUS is 81.45%.
Result shows, in barley leaves, crosses after expression TaWRKY1, and haustorium index obviously rises, and illustrates that the effect of TaWRKY1 and HvWRKY2 is identical, in the background resistance of barley, has negative regulation effect.
The function of 2.TaWRKY1 in wheat anti-powdery mildew
(1) impact of TaWRKY1 on wheat race specific resistance
Wheat breed Yangmai No.158 (not containing Pm21) disclosed in document " LIU P et al.; Transfer of disease resistance ofTriticum aestitpvum-Haynaldia villosa 6VS/6AI J translocation lines in diferent wheatbackground.Journal of Naming Agricultural University.2004; 27 (2): 1～5 ", and the heredity of the public Ke Cong Chinese Academy of Sciences obtains with developmental biology institute.
No. 15 physiological strains of wheat powdery mildew (bacterial strain E09) disclosed in document " Hu T Z et al.; Identification andMolecular Mapping Gene in Wheat Cultivar yu mai 66 of the Powdery Mildew Resistance.ACTAAGRONOMICA SINICA 2008; 34 (4): 545-55 ", and the heredity of the public Ke Cong Chinese Academy of Sciences obtains with developmental biology institute.
In method and experiment 1, (1) is described basic identical, and the pathogenic bacterium of inoculation that different is are No. 15 physiological strains of wheat powdery mildew (bacterial strain E09), conversion be the blade of wheat breed Yangmai No.158 (containing Pm21).
3 repetitions, results averaged are established in experiment.
Result shows, the haustorium index that proceeds to the wheat leaf blade of carrier pUbi-TaWRKY1 and carrier p35S-GUS is 81.93%; The haustorium index that proceeds to the wheat leaf blade of pGY-1 and p35S-GUS is 54.60%; The haustorium index that proceeds to the wheat leaf blade of pUbi-HvWRKY2 and p35S-GUS is 81.45%.
Result shows, in wheat leaf blade, crosses after expression TaWRKY1, and haustorium index obviously rises, and illustrates that TaWRKY1 plays negative regulation effect in the race specific resistance of wheat.
(2) impact of TaWRKY1 on wheat background resistance
Wheat breed wheat cluster dirty wheat translocation line 6VS/6AL (containing Pm21) disclosed in document " Cao AZ et al.; Cloningand Analysis of an Hv-OxOLP Gene Induced by Ergsiphe graminis in H.villosa.Journal ofTriticeae Crops.2006; 26 (5): 27～32 ", and the heredity of the public Ke Cong Chinese Academy of Sciences obtains with developmental biology institute.
Basic identical described in method and experiment (1), different is that wheat breed used is wheat breed wheat cluster dirty wheat translocation line 6VS/6AL (containing Pm21).
3 repetitions are established in experiment, and result is taken the mean.
Result shows, the haustorium index that proceeds to the wheat leaf blade of carrier pUbi-TaWRKY1 and carrier p35S-GUS is 13.16%; The haustorium index that proceeds to the wheat leaf blade of pGY-1 and carrier p35S-GUS is 13.60%; The haustorium index that proceeds to the wheat leaf blade of pUbi-HvWRKY2 and carrier p35S-GUS is 12.62%.
Result shows, in wheat leaf blade, crosses after expression TaWRKY1, and haustorium index is almost constant, illustrates that the resistance of wide spectrum of Pm21 mediation does not rely on TaWRKY1.Function not effect in resistance of wide spectrum of TaWRKY1 is described, may in race specific resistance, works.
Claims (9)
1. an albumen, the protein being formed by the aminoacid sequence shown in SEQ ID NO:1.
2. the encoding gene of albumen described in claim 1.
3. encoding gene according to claim 2, is characterized in that: described encoding gene is DNA molecular shown in SEQ ID NO:2.
4. the recombinant vectors that contains encoding gene described in claim 2 or 3.
5. the recombinant bacterium that contains encoding gene described in claim 2 or 3.
6. the recombinant virus that contains encoding gene described in claim 2 or 3.
7. the expression cassette that contains encoding gene described in claim 2 or 3.
Encoding gene described in claim 2 or 3 at regulating plant to the application in the resistance of Powdery Mildew; Described Powdery Mildew is barley powdery mildew or wheat powdery mildew; Described plant is barley or wheat; Described barley is barley variety P01; Described wheat is wheat breed Yangmai No.158.
9. application according to claim 8, is characterized in that: described barley powdery mildew causes by barley powdery mildew bacteria, and described wheat powdery mildew is caused by wheat powdery mildew.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110045303.1A CN102649812B (en) | 2011-02-24 | 2011-02-24 | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201110045303.1A CN102649812B (en) | 2011-02-24 | 2011-02-24 | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102649812A CN102649812A (en) | 2012-08-29 |
| CN102649812B true CN102649812B (en) | 2014-04-02 |
Family
ID=46691942
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201110045303.1A Expired - Fee Related CN102649812B (en) | 2011-02-24 | 2011-02-24 | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102649812B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102942621B (en) * | 2012-10-30 | 2014-03-05 | 中国农业大学 | Plant powdery mildew resistance related protein TaCAF1 and its coding gene and application |
| CN104788550B (en) * | 2014-01-17 | 2017-11-28 | 中国科学院遗传与发育生物学研究所 | ScRGA 6RL3 and its encoding gene and application |
| CN105441460B (en) * | 2016-01-06 | 2018-08-10 | 昆明理工大学 | A kind of Ming River lily WRKY transcription factor genes LrWRKY1 and application |
| CN105802929B (en) * | 2016-05-03 | 2019-08-20 | 中国科学院遗传与发育生物学研究所 | Protein kinase HvMPK4a relevant to barley mildew-resistance and its encoding gene and application |
| CN108424438B (en) * | 2018-05-17 | 2021-06-25 | 青岛大学 | Wheat powdery mildew resistance-related protein TaWRKY49, and coding gene and application thereof |
-
2011
- 2011-02-24 CN CN201110045303.1A patent/CN102649812B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| Differential Expression of Potato WRKY1 Gene Upon Erwinia carotovora Infection;Yasser Mabrouk et al.;《Australian Journal of Basic and Applied Sciences》;20081231;第2卷(第1期);30-36 * |
| Nuclear Activity of MLA Immune Receptors Links Isolate-Specific and Basal Disease-Resistance Responses;Qian-Hua Shen et al.;《Science》;20070223;第315卷(第5815期);1098-1103 * |
| Qian-Hua Shen et al..Nuclear Activity of MLA Immune Receptors Links Isolate-Specific and Basal Disease-Resistance Responses.《Science》.2007,第315卷(第5815期),1098-1103. |
| Yasser Mabrouk et al..Differential Expression of Potato WRKY1 Gene Upon Erwinia carotovora Infection.《Australian Journal of Basic and Applied Sciences》.2008,第2卷(第1期),30-36. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102649812A (en) | 2012-08-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102649811B (en) | Protein TaWRKY2 related to powdery mildew resistance and coding gene of protein TaWRKY2 | |
| WO2020207125A1 (en) | Nucleic acid sequence for detecting maize plant dbn9501 and detection method therefor | |
| CN102649812B (en) | Powdery mildew resistance-related protein TaWRKY1 and coding gene thereof | |
| CN112626040B (en) | ZmRBOHB gene and application of encoding protein thereof in resistance to maize ear rot | |
| CN110117320B (en) | Application of cotton GhCAL-D07 gene in promoting flowering of plants | |
| CN107475210B (en) | Rice bacterial leaf blight resistance related gene OsABA2 and application thereof | |
| CN103215237A (en) | Set of paddy rice anti-brown-planthopper genes, coded protein thereof, and application thereof | |
| CN103266109A (en) | Molecular marker of rice resistance gene Xa23 and application of molecular marker | |
| CN109971880A (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9508 | |
| CN109609527A (en) | CDPK18L gene is improving the application in tomato bacterial leaf spot resistance and high temperature resistance as negative regulatory factor | |
| CN103588868A (en) | Wheat protein TaMYB1, and coding gene and application thereof | |
| CN109134633B (en) | Rice blast resistant protein and gene, isolated nucleic acid and application thereof | |
| CN100540665C (en) | Regulate the gene of plant branching, contain the carrier of this gene,, and utilize this microorganism to regulate the method for plant branching by this carrier microorganism transformed | |
| CN116284286A (en) | Wheat stripe rust fungus sugar transport protein, gene and application thereof | |
| CN100549029C (en) | One plant disease resistance-related SGT1 and encoding gene and application | |
| CN105177002A (en) | miR159a related to barley powdery mildew resistance and application thereof | |
| CN110283238A (en) | Paddy disease-resistant albumen RWR1 and its application | |
| CN110004155A (en) | Control disease-resistant gene, protein and its application of plant phobotaxis aphid resistance shape | |
| CN105177001A (en) | MiR167d related to barley powdery mildew resistance and application thereof | |
| CN114989283A (en) | Application of TCP19 protein in regulation and control of rice sheath blight resistance | |
| CN112410314B (en) | Acetyl transferase OsG2 gene and application of protein coded by gene | |
| CN101967486B (en) | Insect-resistant gene OsRGI and encoded product and application thereof | |
| CN108559753A (en) | The breeding method of application and Rust resistance bacterium wheat of the wheat stripe rust PSTG_17694 genes in stripe rust prevention | |
| CN111378670A (en) | Separated adelphocoris suturalis Taiman gene and encoded protein thereof | |
| CN117187276B (en) | Wheat embryogenesis receptor kinase TaSERK1 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140402 Termination date: 20180224 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |