CN110283238A

CN110283238A - Paddy disease-resistant albumen RWR1 and its application

Info

Publication number: CN110283238A
Application number: CN201810224514.3A
Authority: CN
Inventors: 周俭民; 赵燕; 何朝族; 陈明生
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2018-03-19
Filing date: 2018-03-19
Publication date: 2019-09-27
Anticipated expiration: 2038-03-19
Also published as: CN110283238B

Abstract

The invention discloses paddy disease-resistant albumen RWR1 and its applications.The present invention provides following 1) -3) in application of any substance in regulation disease resistance of plant: 1) albumen RWR1；2) DNA molecular of albumen RWR1 is encoded；3) recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA molecular containing coding albumen RWR1.The experiment proves that the transgenic paddy rice of RWR1 gene overexpression when being encroached on by rice blast fungus, compares wild rice, the growth of rice blast fungus mycelia is significantly inhibited, and significantly improves it to the resistance of rice blast fungus.Therefore, RWR1 gene is related to resistance of the rice to rice blast fungus；The cultivation and identification of disease-resistant plant variety needed for RWR1 albumen and its encoding gene can be used for agricultural and ecological environment treatment, play a significant role in Resistant breeding field.

Description

Paddy disease-resistant albumen RWR1 and its application

Technical field

The invention belongs to plant genetic engineering field, it is related to a kind of paddy disease-resistant albumen RWR1 and its application.

Background technique

Rice is the most important cereal crops in China, and the rice disease as caused by pathogenic microorganism seriously affects rice yield And quality.As people deepen continuously to rice-pathogen Coupling effects research, paddy disease-resistant is cultivated using disease-resistant gene Kind has become most effective, most safe, the most economical mode of rice breeding brainstrust prevention and treatment rice disease.

Prediction paddy disease-resistant related gene: using bioinformatics method is compared, AA genotype wild rice Oryza_ is chosen Glaberrima, FF genotype wild rice Oryza_brachyanth and two Asian Cultivated Rices (japonica rice OryzasativaLcv.Nipponbare and long-grained nonglutinous rices 9311) this four genome sequencing rice make comparisons genome analysis research, using PanOCT software to the water of four strains Rice genome carries out Collinearity Diagnosis Analysis, determines synteny region, identifies disease-resistant related gene, obtains target gene synteny area Domain and duplicate factor cluster Cluster；It analyzes to obtain homologous protein in conjunction with OrthMCL homologous protein；To being predicted in synteny region Adjacent objects gene divide Cluster gene family (less than 10 genetic intervals of two neighboring target gene)；In conjunction with system Tree analyzes and determines which target gene is homologous tandem sequence repeats in same gene family, which is that heterologous tandem repeats；Finally lead to Cross the historical events that target gene homologous recombination occurs in RDP3 software analysis gene family.

Screening rice broad spectrum antidisease gene: based on comparing biological gene information result, according at present it has been reported that rice The characteristics of mode of evolution and disease-resistant gene of disease-resistant gene, having chosen, which may have multiple genes of disease-resistant function to carry out function, tests Card (the homologous gene gene 8 wherein comprising disease-resistant gene delivered, functional).

Using gene microarray analysis technology, Large-scale Screening cloning rice disease-resistant gene converts water by transgenic technology After rice, identification transgenic rice plant to the resistances of the germs such as rice blast, specify target gene in the effect of broad spectrum resistance, To cultivate there is the Rice Resistance characteristic of disease of lasting and broad spectrum activity to provide new gene and material resources.

Summary of the invention

It is an object of the present invention to provide following 1) -3) in any substance purposes.

The present invention provides following 1) -3) in application of any substance in regulation plant disease-resistant:

1) albumen RWR1；

2) DNA molecular of albumen RWR1 is encoded；

3) recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA molecular containing coding albumen RWR1；

The albumen RWR1 is following (1) or (2):

(1) protein that the amino acid sequence shown in sequence 2 in sequence table forms；

(2) by amino acid sequence shown in sequence 2 in sequence table by one or several amino acid residues substitution and/or Deletion and/or addition and the protein with the same function as derived from (1).

In above-mentioned application, the DNA molecular is following 1) -4) in any DNA molecular:

1) code area is DNA molecular shown in sequence 1 in sequence table；

2) code area is DNA molecular shown in sequence 3 in sequence table；

3) hybridize under strict conditions with the DNA sequence dna 1) limited and encode the DNA molecular with identical function protein；

4) at least have 70% with the DNA sequence dna 1) limited, at least have 75%, at least having with 80%, at least 85%, at least with 90%, at least with 95%, at least with 96%, at least with 97%, at least have 98% or at least have There is 99% homology and coding has the DNA molecular of identical function protein.

It is described disease-resistant for blast resisting in above-mentioned application.

In above-mentioned application, the plant is dicotyledon or monocotyledon；

Or the plant is monocotyledon, the monocotyledon is specially rice.

Above-mentioned 1) -3) any substance is also the scope of protection of the invention cultivating the application in disease-resistant plants in.

It is described disease-resistant for blast resisting in above-mentioned application；

Or, the plant is dicotyledon or monocotyledon；

Or the plant is monocotyledon, the monocotyledon is specially rice.

Second purpose of the invention is to provide a kind of method for cultivating disease-resistant transgenic plant.

A kind of method for cultivating disease-resistant transgenic plant provided by the invention, includes the following steps: to improve in purpose plant The expression quantity and/or activity for encoding the DNA molecular of albumen RWR1, obtain genetically modified plants, the disease resistance of the genetically modified plants Higher than the purpose plant；

The albumen RWR1 is following (1) or (2):

In the above method, the expression quantity and/or activity that the DNA molecular of albumen RWR1 is encoded in the raising purpose plant are The DNA molecular of the coding albumen RWR1 is imported into purpose plant.

It is described disease-resistant for blast resisting in the above method；

In the above method, the plant is dicotyledon or monocotyledon；

Or the plant is monocotyledon, the monocotyledon is specially rice.

The disease resistance of genetically modified plants described above is higher than the purpose plant and is embodied in following at least one:

1) necrotic plaque of the genetically modified plants is less than the purpose plant；

2) the susceptible series of the genetically modified plants is less than the purpose plant；

3) the DNA relative expression quantity of the MoPot2 of the genetically modified plants is lower than the purpose plant；

The genetically modified plants are the homozygous plants (+/+) of transgenic paddy rice.

The experiment proves that the transgenic paddy rice of RWR1 gene overexpression is compared when being encroached on by rice blast fungus The growth of wild rice, rice blast fungus mycelia is significantly inhibited, and significantly improves it to the resistance of rice blast fungus.Therefore, RWR1 gene is related to resistance of the rice to rice blast fungus；RWR1 albumen and its encoding gene can be used for agricultural and ecological environment treatment The cultivation and identification of required disease-resistant plant variety, play a significant role in Resistant breeding field.

Detailed description of the invention

Fig. 1 is T₂For disease-resistant phenotype after p1300:RWR1 transgenic paddy rice inoculation rice blast fungus RB22.

Fig. 2 is T₂For p1300:RWR1 transgenic paddy rice after being inoculated with rice blast fungus RB22 susceptible series statistical result.

Fig. 3 is T₂For the relative value of p1300:RWR1 transgenic paddy rice fungal DNA in rice leaf after being inoculated with rice blast fungus.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Quantitative experiment in following embodiments, is repeated three times, and results are averaged.

In following embodiments rice using conventional variety TP309 (hereinafter also referred to wild rice) (be recorded in Wang J, Qu B, Dou S, Li L, Yin D, Pang Z, Zhou Z, Tian M, Liu G, Xie Q, Tang D, Chen X, Zhu L., The E3ligase OsPUB15interacts with the receptor-like kinase PID2and regulates plant cell death and innate immunity.BMC Plant Biol.2015,13；15. the public can be from China Academy of sciences's heredity and Developmental Biology research are obtained).

The acquisition of embodiment 1, RWR1 gene

It extracts rice (Oryza sativa) Oyzabrachyantha and (is recorded in Chen J, Huang Q, Gao D, Wang J,Lang Y,Liu T,Li B,Bai Z,Luis Goicoechea J,Liang C,Chen C,Zhang W,Sun S,Liao Y,Zhang X,Yang L,Song C,Wang M,Shi J,Liu G,Liu J,Zhou H,Zhou W,Yu Q,An N,Chen Y,Cai Q,Wang B,Liu B,Min J,Huang Y,Wu H,Li Z,Zhang Y,Yin Y,Song W,Jiang J, Jackson SA,Wing RA,Wang J,Chen M.Whole-genome sequencing of Oryzabrachyantha reveals mechanisms underlying Oryza genome evolution.Nat Commun.2013；4:1595, The public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research) DNA of blade, design primer carries out PCR amplification.

RWR1-F:5'ACGGCCAGTGCCAAGCTT GAGAGAGAGGGAGAGATGAA 3'

RWR1-R:5'CGCGCCTCGAGATCCA CCAACGGCGAGTAATAGCAT 3'

Amplification obtains 5273bp PCR product.

Above-mentioned PCR product is sent into sequencing, nucleotides sequence is classified as sequence 3 in sequence table, the starting including about 1026bp Subsequence and 4247bp coding region sequence, unnamed gene shown in sequence 3 1-5273 is RWR1 in sequence table.In sequence table Sequence 1 is the CDS sequence of the gene, totally 3645 bases, encodes 1214 amino acid, is named as RWR1 albumen (sequence 2).

The functional verification of embodiment 2, RWR1 gene

1, the acquisition of expression vector

Hind III and XbaI double digestion original plasmid pCAMBIA1300-flag (is recorded in Wang Z, Li N, Jiang S,Gonzalez N,Huang X,Wang Y,InzéD,Li Y.SCFSAP controls organ size by targeting PPD proteins for degradation in Arabidopsis thaliana.Nat.Commun.2016；7:11192, the public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research ), the big segment of 9.6kb is recycled, pCAMBIA1300-221-flag carrier framework is obtained.

The 5273bp PCR product and carrier framework pCAMBIA1300-flag that embodiment 1 is obtained carry out In-fusion It reacts (TAKARA company), obtains binary expression vector pCAMBIA1300::RWR1.

By sequencing, recombinant expression carrier pCAMBIA1300::RWR1 is to replace DNA molecular shown in sequence 3 The carrier that 35S promoter between Hind III and the Xba I of pCAMBIA1300-flag plasmid obtains.DNA shown in sequence 3 1-1026 are RWR1 gene promoter sequence in molecule, and 1027-5273 are RWR1 coding sequence.

2, RWR1 gene expression recombinant bacterium obtains

By above-mentioned 1 recombinant expression carrier pCAMBIA1300::RWR1 convert Agrobacterium EHA105, picking monoclonal, in 28 DEG C of overnight shaking cultures in LB liquid medium containing kanamycin with rifampin antibiotic, obtain transformant.

Transformant is carried out bacterium solution PCR identification, and (RWR1-6500F and Flag-R, obtaining about 600bp is positive restructuring Bacterium), positive restructuring bacterium is named as EHA105/p1300::RWR1, and be stored in -70 DEG C it is spare.

RWR1-6500F:5 ' GAGACCTGTCACATGCTCATA 3 '

Flag-R:5 ' CTAGTTAATTAAGACGCGTCCT 3 '.

3, the acquisition of RWR1 gene expression rice

Using agrobacterium tumefaciens-mediated transformation rice transformation, the specific method is as follows:

The preparation of I, transformation receptor: the receptor that 14 days after pollinating rice TP309 ratarias are infected as Agrobacterium is chosen.

The culture of II, Agrobacterium tumefaciens attachment: from positive restructuring bacterium Agrobacterium EHA105/p1300::RWR1 liquid storage (20% Glycerol) a small amount of bacterium solution is taken, it is cultivated in crossing on YEB solid medium (50mg/l containing kanamycin, rifamycin 50mg/l), 28 DEG C are protected from light culture to the single colonie for growing diameter 1mm size.Single colonie is taken to be connected on same culture medium, culture to vigorous life For a long time.The a little thallus of picking is connected in 20mlYEB fluid nutrient medium (containing corresponding antibiotic), and 28 DEG C are protected from light 220rpm oscillation training It supports overnight.Next day is transferred in the YEB fluid nutrient medium that 20ml contains 100uM acetosyringone with 2% inoculum concentration, and culture is extremely Mid log phase, with 3 times or more liquid minimal mediums be diluted to naked eyes slightly see muddiness can (OD600 about 0.1), in case turn Change is used.

III, root Agrobacterium infects and co-cultures: taking bacterium solution in culture bottle, the callus through preculture is added, slightly 10 minutes are stood after shake.The culture medium added with 100uM acetosyringone is placed in drying callus on aseptic filter paper On, 25 DEG C dark culture 3 days.

The screening of IV, kanamycin-resistant callus tissue: the callus after co-cultivation is gone to containing 25mg/l hygromycin (hygromycin B) and on the screening and culturing medium of 500mg/l cephalosporin, after screening 1~2 time, it is seen that resistant calli is grown.

The regeneration of V, resistant plant: resistant calli is gone on the culture medium of the hygromycin containing 25mg/l, illumination condition Ditto.Resistance budlet wait differentiate it is long to 2-3cm when, gone to the regrowth subculture medium of the hygromycin containing 25mg/l On, after length to complete plant, it is gone into open culture in nutrient solution from solid medium.It, will after new root to be generated Seedling is transferred to greenhouse, obtains T₀In generation, turns RWR1 rice.

Using same method, empty carrier pCAMBIA1300-221-flag is transferred in rice TP309, T is obtained₀In generation, turns Empty carrier rice.

By above-mentioned T₀For plant seeding, T is obtained₁For plant.

4, turn the identification of RWR1 rice

About two weeks T will be grown₁In generation, turns about 3 centimetres of RWR1 rice clip of blade, uses liquid nitrogen flash freezer rapidly.Total DNA is extracted, It is control with wild rice TP309, carries out PCR amplification, be integrated into genome to detect target gene.

Primer for PCR detection RWR1 expression (amplification obtains the junction fragment positioned at the end RWR13 ' and label F lag) Are as follows:

RWR1-6500F:5 ' GAGACCTGTCACATGCTCATA 3 '

Flag-R:5 ' CTAGTTAATTAAGACGCGTCCT 3 '

Recycling pcr amplification product is simultaneously sequenced, and shows that RWR1 has been integrated into the genome of rice, these are integrated Plant to rice genome is denoted as positive T₁In generation, turns RWR1 rice.

T₁In generation, turns empty carrier rice and wild rice TP309 and integrates without RWR1.

5, the acquisition of homozygosis RWR1 gene expression rice

Positive T is accredited as by above-mentioned₁In generation, turns RWR1 rice single plant sowing and obtains T₂For seed, 30-40 seeds are used respectively Immersion sprouting is carried out in the aqueous solution of hygromycin containing 25mg/L, determines positive plant (transgenosis yin by the growth conditions of plant roots Property plant young root be grown in heavily suppressed under hygromycin effect, show as that main root is shorter, and lateral root does not occur substantially, elongation To about 1 centimetre of beginning browning；And transgenic positive material is since with hygromycin resistance, the growth of root is not inhibited substantially, it is main The generation of root and lateral root is all very normal), it is denoted as T₂For p1300:RWR1 transgenic paddy rice, transplanting experiment is carried out.

T₁In generation, turns the plantation of empty carrier rice sowing, obtains T₂In generation, turns empty carrier rice.

6, RWR1 gene expression rice is to rice blast fungus Analysis of Resistance

Before rice inoculation, T₂For p1300:RWR1 transgenic paddy rice, T₂In generation, turns empty carrier rice and wild rice TP309 is cultivated under normal conditions: illumination 14 hours, 10 hours, 28 DEG C of temperature dark.

When plant length to one heart stage of three leaves (about needing 20 days), carries out rice blast fungus RB22 and connect bacterium experiment, spore liquid concentration For 5X10⁵(RB22 is recorded in Kang H, Wang Y, Peng S, Zhang Y, Xiao Y, Wang D, Qu S, Li Z, Yan to/ml S,Wang Z,Liu W1,Ning Y,Korniliev P,Leung H,Mezey J,McCouch SR,Wang GL..Dissection of the genetic architecture of rice resistance to the blast Fungus Magnaportheoryzae.Mol Plant Pathol.2016,17 (6): 959-72., the public can be from Chinese sciences Institute's heredity and Developmental Biology research are obtained).After blade squirts completely, after dark processing 24 hours, after light-exposed culture 5 days Statistics incidence is simultaneously photographed to record.

The result shows that compared with wild rice TP309, homozygous T₂It is being sprayed for p1300:RWR1 transgenic paddy rice After RB22 spore liquid, the resistance of rice blast fungus RB22 is significantly improved, illustrates that RWR1 albumen is related to resistance of the rice to rice blast fungus.

Specific manifestation are as follows:

1) plant phenotype after statistical analysis inoculation RB22

As a result as shown in Figure 1, after spray bacterium 6 days, T₂For the homozygous plants (+/+) and heterozygosis of p1300:RWR1 transgenic paddy rice The blade of plant (+/-) is not substantially by the dip dyeing of rice blast fungus；And the wild rice as control (is separated in Fig. 1 Wild rice, be expressed as -/-) blade have a large amount of necrotic plaques.

T₂In generation, turns empty carrier rice phenotype and wild rice without significant difference.

2) investigation and analysis rice material blade morbidity series

According to rice in Sichuan province blast resistance field test technical specification (DB51/T714-2007), to rice material into The statistics of row morbidity series, as a result such as Fig. 2, after spray bacterium 6 days, T₂For the homozygous plants (+/+) of p1300:RWR1 transgenic paddy rice With the susceptible series of heterozygous plant (+/-) blade well below the wild rice that control wild rice and transgenosis are separated (-/-)。

3) rice blast fungus DNA and rice leaf DNA relative value in rice leaf are detected

After detection RB22 spray bacterium after 6 days, T is detected₂For rice blast fungus in p1300:RWR1 transgenic paddy rice and wild rice The DNA relative expression quantity of marker gene M oPot2.

The specific method is as follows:

A, rice leaf DNA is extracted

The extraction of total DNA is extracted with CATB method:

1) 3 centimetres of the above-mentioned Rice Leaf agreement that contracts a film or TV play to an actor or actress of each strain is taken, after claying into power in liquid nitrogen, 0.3mL CATB DNA is added to extract Liquid, concussion mix.

2) after lapping liquid is placed 30 minutes in 65 DEG C of incubators, be added 0.3mL chloroform, cover tightly centrifuge tube, acutely sway from Heart pipe 20 seconds, 12000g was centrifuged 5 minutes.

3) it takes upper water to make an appointment 0.3mL Yu Yixin centrifuge tube, adds 0.3mL isopropanol, be placed at room temperature for 10 minutes, 4 DEG C, 12000g is centrifuged 10 minutes.

4) liquid is discarded supernatant, 75% ethyl alcohol of 0.7mL is added, is vortexed and mixes, 12000g is centrifuged 1 minute at 4 DEG C.

5) carefully discard supernatant liquid, then room temperature or vacuum drying 10 minutes, be dissolved in 0.3mL distilled water, obtain DNA。

B, quantitative fluorescent PCR is analyzed

1) reaction system

SYBR Premix 10μL

2) response procedures

95 DEG C, 30s；30cycles of (95 DEG C, 10s；60 DEG C, 20s；72 DEG C, 20s)

3) data are analyzed

Ct value is that fluorescence signal reaches recurring number experienced when the thresholding of setting in PCR pipe.

Δ Ct=Ct (Gene)-Ct (UBQ) measures the expression of gene with the value of 2- Δ Ct.

The gene and the primer for the quantitative PCR analysis expression being related to are as follows:

Reference gene is ubqutin, for expanding the Q-PCR primer of reference gene are as follows:

UBQ-F:5′-TTCTGGTCCTTCCACTTTCAG-3′

UBQ-R:5′-ACGATTGATTTAACCAGTCCATGA-3′

Detect the Q-PCR primer of MoPot2 are as follows:

MoPot2-F:5′-ACGACCCGTCTTTACTTATTTGG-3′

MoPot2-R:5′-AAGTAGCGTTGGTTTTGTTGGAT-3′

As a result as shown in figure 3, T₂For p1300:RWR1 transgenic paddy rice compared with check plant wild rice TP309, The DNA relative expression quantity of MoPot2 significantly reduces；T₂In generation, turns empty carrier rice compared with wild rice, the DNA phase of MoPot2 Expression quantity is not significantly different.

Above-mentioned experiment is repeated 3 times, as a result unanimously.

The above results prove that RWR1 gene is related to resistance of the rice to rice blast fungus, illustrate RWR1 albumen and its encoding gene The cultivation and identification that can be used for disease-resistant plant variety in agricultural production, play a significant role in Resistant breeding field.

Finally, it is stated that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although passing through ginseng According to the preferred embodiment of the present invention, invention has been described, it should be appreciated by those of ordinary skill in the art that can To make various changes to it in the form and details, without departing from the present invention defined by the appended claims Spirit and scope.

Sequence table

<110>Inst. of Genetics and Development Biology, CAS

<120>paddy disease-resistant albumen RWR1 and its application

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 3645

<212> DNA

<213>rice (Oryza sativa)

<400> 1

atggctgagt ttttggttcg gccgctgctg tccacggtgc agaacgcttc cagctatctt 60

gcaggccagt acagggtgat ggaaggcatg gaggagcagc gcaaagctct ggagcgcatg 120

cttccactca tcctcaccgt catccacgac gcacagaaca gaaccaaaca atcccaagta 180

ggcgcttggc tgcaagagct caagaaggtg tcctacgagg cgaccgacgt gttcgacgag 240

ttcagatacg aggcgctccg gcgcgaagcc aggaggaaag ggcacggcgc tgtaagcctc 300

ttctcctctc gtaacccaat cgtgtttcgc tacaggatgg gcaagaagct gcggaagatc 360

gtgcagagaa tcaaggaact tgtcgaggag atgaattcct ttgggctcgt acaccggcag 420

gaaacaccga ggcagtcgag gcaaactgat tcagtgatgc ttgattttga gaaggatatt 480

gttagcagat ccagagatga ggagaagagg aaggttgtca agatattggt ggatgaagct 540

agcgacaggg agctcacagt ccttcctgtt gttggaatgg gtggtcttgg caagactaca 600

tttgcacagc tcatctacaa tgaccctgaa atcctgaagc attttcagct tcgcaggtgg 660

tgttgtgtgt ctgatgaatt tgatgtcgtt agcatcgcaa acaacatatg tgtgagcaca 720

gagagaaatc gtgaaagggc actgcaagat ctgcagaagg aagtaagtgg aaagaagttt 780

ctgatagtgt tggatgatgt gtggaatagg gattctgaca agtggggaaa gttaatgacc 840

tgccttaagc agggctccag gggcagtgtg gtactaacaa caactcggga tgtcaaagtc 900

gctacaatta tggctaccag tgaagttgaa gtgtataatc ttggtaagct aggagaagtg 960

tatttgaagg aaataatcca aagtaaagca attggtttgc caggaagtga tgagcatttg 1020

gaagttctta ataaaattgt tcagagatgt gatggctctc ctttagctgc aaaatccttt 1080

ggctctgtgt tgtctagcag gagtactgta caagaatgga aggatatatt agccaaaagt 1140

aacatttgca atgaggggga ggacacaatt tttcctatac ttcgtctcag ctatgacgac 1200

ttaccatttg acatgaagca atgctttgct ttctgtgcta tattcccaaa agattatgtg 1260

attgatgtgg agactttgat taagctatgg ttggcacatg acttcatacc attacaagag 1320

gatgacaatc tagaatcggc agccgaagat atcttcaagg agctagtttg gaggtcattt 1380

tttcaagatg taaagaaatc ttctatatgg accacatgca agatacatga tcttatgcac 1440

gacattgctc aatctgttat gggaaaagaa tgtgtcagca tagctggaag gtccaatttt 1500

ataagtctgt tatcagaaca tcctaggtat cactttcact catcatacaa agagactgtt 1560

ctcttagatg actttatgag aaaacaatct ccaactctcc ggagtttatt gtttgaacga 1620

tggtttaatt acttcagcac atcacattta tccaagtgca gttctctgcg agcactgaag 1680

ctcctacgat gcagcgaatt cttaccaatc gggcaccttc agcacctaag atatctcaat 1740

atctcatcaa acagttgtat caaaaagctt cctaaagata tatgcatact ctacaatcta 1800

cagactttgg tcctctctta ttgtaaaaat cttgtcgaac ttccaaagga tatgaagtat 1860

atgaaaaatc tgcgacacct ttatacggat ggatgtccaa aattgaagta catgcctccg 1920

gaccttggac agttaacttc cctgcagata ttaacatctt ttgtggtggg agctaggtct 1980

ggttgcagta accttagaga attgcgtacc ttaaaccttt gtggcaggct acagttatgt 2040

ggcctagaaa atgaaaagga agaaaatgcg aaagcagcca atcttcgaaa caaagagaaa 2100

cttacacatt tgtctcttga gtggaatagc aactgccatc ttgaaggaac aaattcccct 2160

tataaggttc ttgatgctct taaacctcat cacaggctgc agatgcttaa ggtaatttcc 2220

tatacaggca gttcttttcc agcatggata acagaccttg gtgtcctgca aaacttgata 2280

gagctccatt tagagggctg tacaatgtgt ggagaatttc ctcagttcat tcgtttcaag 2340

tttcttcagg ttctttatct gagtagactt gataacttgc aaaccctatg tcgcgaggaa 2400

ggaagacaag gaacagaaca agcatttcat cagcttgaga aggttgtcat caacatctgt 2460

ccaaagtttc aaacattgtg ctctggtgtg gcatccactg catttccaga actaaaggaa 2520

gtcaagttaa tggatttgga gagctttgag acatgggtgg caatggaagg gaggcaaggt 2580

tacatgccaa catttcctct gcttgaggag gttgaaatca acaagtgccc aaaattgaca 2640

actctacctg aagcaccaaa gctcaagatt ttaaatctaa atgaaaacaa agcgcagctg 2700

tccttgtcat tgcttcaatc cagctatata tcctcattgt ccaagctaag attggaaata 2760

gatgacaaag aaacaaccct gcagctgctt gatcagatcc acgaatcatc tctctcagaa 2820

atggagttaa cacattgcaa cattctcttc cccttgagcc catcacagtc aaaaatgagg 2880

atctgggaat ggcttggaca acttgttgag ctgaaaatcg actcctgcga ttcgctcatc 2940

tactggccag aagaagagtt cctatgcttg gtatccctga agaaattgac catcaaggag 3000

tgctataacc taattggccg tcctacccag gtgacaggaa atccaactct cctgccacat 3060

ctcacatcgc tttatgtttc taagtgtgtc aggttgagag agctctttgt tcttccacca 3120

tctatcaaat atattacaat taatgactcc atttgtcttg agagcttctc attcccctcc 3180

tatcatctgc catgcctaga acgtctaagt ttctggaatt gtcgttcagt ggtaacactt 3240

cagaacctac caccatgcct tatgctgtcc attgatgcat gttgggagct tcaatcgctg 3300

tcagggcagc tggatgaact caagcatttg ggcattgtac gctgcaataa actggagtca 3360

ctgaattgct tgggagaatt gccatcactg gaacatcttg accttaagat gtgcaaacgt 3420

ctagcatcgg cgccatgtgg cccaaggagt tactcatctc ttttgagtat tacaatccaa 3480

gactgcccaa gaatgaatat gaagaaggta tatgagtggc tccggccacg gctggatagc 3540

cttgaggaaa gagacctgtc acatgctcat acaagagtaa tttatgaaga gtctaaatgc 3600

ccgacactaa aatcatggaa atatgctatt actcgccgtt ggtga 3645

<210> 2

<211> 1214

<212> PRT

<213>rice (Oryza sativa)

<400> 2

Met Ala Glu Phe Leu Val Arg Pro Leu Leu Ser Thr Val Gln Asn Ala

1 5 10 15

Ser Ser Tyr Leu Ala Gly Gln Tyr Arg Val Met Glu Gly Met Glu Glu

20 25 30

Gln Arg Lys Ala Leu Glu Arg Met Leu Pro Leu Ile Leu Thr Val Ile

35 40 45

His Asp Ala Gln Asn Arg Thr Lys Gln Ser Gln Val Gly Ala Trp Leu

50 55 60

Gln Glu Leu Lys Lys Val Ser Tyr Glu Ala Thr Asp Val Phe Asp Glu

65 70 75 80

Phe Arg Tyr Glu Ala Leu Arg Arg Glu Ala Arg Arg Lys Gly His Gly

85 90 95

Ala Val Ser Leu Phe Ser Ser Arg Asn Pro Ile Val Phe Arg Tyr Arg

100 105 110

Met Gly Lys Lys Leu Arg Lys Ile Val Gln Arg Ile Lys Glu Leu Val

115 120 125

Glu Glu Met Asn Ser Phe Gly Leu Val His Arg Gln Glu Thr Pro Arg

130 135 140

Gln Ser Arg Gln Thr Asp Ser Val Met Leu Asp Phe Glu Lys Asp Ile

145 150 155 160

Val Ser Arg Ser Arg Asp Glu Glu Lys Arg Lys Val Val Lys Ile Leu

165 170 175

Val Asp Glu Ala Ser Asp Arg Glu Leu Thr Val Leu Pro Val Val Gly

180 185 190

Met Gly Gly Leu Gly Lys Thr Thr Phe Ala Gln Leu Ile Tyr Asn Asp

195 200 205

Pro Glu Ile Leu Lys His Phe Gln Leu Arg Arg Trp Cys Cys Val Ser

210 215 220

Asp Glu Phe Asp Val Val Ser Ile Ala Asn Asn Ile Cys Val Ser Thr

225 230 235 240

Glu Arg Asn Arg Glu Arg Ala Leu Gln Asp Leu Gln Lys Glu Val Ser

245 250 255

Gly Lys Lys Phe Leu Ile Val Leu Asp Asp Val Trp Asn Arg Asp Ser

260 265 270

Asp Lys Trp Gly Lys Leu Met Thr Cys Leu Lys Gln Gly Ser Arg Gly

275 280 285

Ser Val Val Leu Thr Thr Thr Arg Asp Val Lys Val Ala Thr Ile Met

290 295 300

Ala Thr Ser Glu Val Glu Val Tyr Asn Leu Gly Lys Leu Gly Glu Val

305 310 315 320

Tyr Leu Lys Glu Ile Ile Gln Ser Lys Ala Ile Gly Leu Pro Gly Ser

325 330 335

Asp Glu His Leu Glu Val Leu Asn Lys Ile Val Gln Arg Cys Asp Gly

340 345 350

Ser Pro Leu Ala Ala Lys Ser Phe Gly Ser Val Leu Ser Ser Arg Ser

355 360 365

Thr Val Gln Glu Trp Lys Asp Ile Leu Ala Lys Ser Asn Ile Cys Asn

370 375 380

Glu Gly Glu Asp Thr Ile Phe Pro Ile Leu Arg Leu Ser Tyr Asp Asp

385 390 395 400

Leu Pro Phe Asp Met Lys Gln Cys Phe Ala Phe Cys Ala Ile Phe Pro

405 410 415

Lys Asp Tyr Val Ile Asp Val Glu Thr Leu Ile Lys Leu Trp Leu Ala

420 425 430

His Asp Phe Ile Pro Leu Gln Glu Asp Asp Asn Leu Glu Ser Ala Ala

435 440 445

Glu Asp Ile Phe Lys Glu Leu Val Trp Arg Ser Phe Phe Gln Asp Val

450 455 460

Lys Lys Ser Ser Ile Trp Thr Thr Cys Lys Ile His Asp Leu Met His

465 470 475 480

Asp Ile Ala Gln Ser Val Met Gly Lys Glu Cys Val Ser Ile Ala Gly

485 490 495

Arg Ser Asn Phe Ile Ser Leu Leu Ser Glu His Pro Arg Tyr His Phe

500 505 510

His Ser Ser Tyr Lys Glu Thr Val Leu Leu Asp Asp Phe Met Arg Lys

515 520 525

Gln Ser Pro Thr Leu Arg Ser Leu Leu Phe Glu Arg Trp Phe Asn Tyr

530 535 540

Phe Ser Thr Ser His Leu Ser Lys Cys Ser Ser Leu Arg Ala Leu Lys

545 550 555 560

Leu Leu Arg Cys Ser Glu Phe Leu Pro Ile Gly His Leu Gln His Leu

565 570 575

Arg Tyr Leu Asn Ile Ser Ser Asn Ser Cys Ile Lys Lys Leu Pro Lys

580 585 590

Asp Ile Cys Ile Leu Tyr Asn Leu Gln Thr Leu Val Leu Ser Tyr Cys

595 600 605

Lys Asn Leu Val Glu Leu Pro Lys Asp Met Lys Tyr Met Lys Asn Leu

610 615 620

Arg His Leu Tyr Thr Asp Gly Cys Pro Lys Leu Lys Tyr Met Pro Pro

625 630 635 640

Asp Leu Gly Gln Leu Thr Ser Leu Gln Ile Leu Thr Ser Phe Val Val

645 650 655

Gly Ala Arg Ser Gly Cys Ser Asn Leu Arg Glu Leu Arg Thr Leu Asn

660 665 670

Leu Cys Gly Arg Leu Gln Leu Cys Gly Leu Glu Asn Glu Lys Glu Glu

675 680 685

Asn Ala Lys Ala Ala Asn Leu Arg Asn Lys Glu Lys Leu Thr His Leu

690 695 700

Ser Leu Glu Trp Asn Ser Asn Cys His Leu Glu Gly Thr Asn Ser Pro

705 710 715 720

Tyr Lys Val Leu Asp Ala Leu Lys Pro His His Arg Leu Gln Met Leu

725 730 735

Lys Val Ile Ser Tyr Thr Gly Ser Ser Phe Pro Ala Trp Ile Thr Asp

740 745 750

Leu Gly Val Leu Gln Asn Leu Ile Glu Leu His Leu Glu Gly Cys Thr

755 760 765

Met Cys Gly Glu Phe Pro Gln Phe Ile Arg Phe Lys Phe Leu Gln Val

770 775 780

Leu Tyr Leu Ser Arg Leu Asp Asn Leu Gln Thr Leu Cys Arg Glu Glu

785 790 795 800

Gly Arg Gln Gly Thr Glu Gln Ala Phe His Gln Leu Glu Lys Val Val

805 810 815

Ile Asn Ile Cys Pro Lys Phe Gln Thr Leu Cys Ser Gly Val Ala Ser

820 825 830

Thr Ala Phe Pro Glu Leu Lys Glu Val Lys Leu Met Asp Leu Glu Ser

835 840 845

Phe Glu Thr Trp Val Ala Met Glu Gly Arg Gln Gly Tyr Met Pro Thr

850 855 860

Phe Pro Leu Leu Glu Glu Val Glu Ile Asn Lys Cys Pro Lys Leu Thr

865 870 875 880

Thr Leu Pro Glu Ala Pro Lys Leu Lys Ile Leu Asn Leu Asn Glu Asn

885 890 895

Lys Ala Gln Leu Ser Leu Ser Leu Leu Gln Ser Ser Tyr Ile Ser Ser

900 905 910

Leu Ser Lys Leu Arg Leu Glu Ile Asp Asp Lys Glu Thr Thr Leu Gln

915 920 925

Leu Leu Asp Gln Ile His Glu Ser Ser Leu Ser Glu Met Glu Leu Thr

930 935 940

His Cys Asn Ile Leu Phe Pro Leu Ser Pro Ser Gln Ser Lys Met Arg

945 950 955 960

Ile Trp Glu Trp Leu Gly Gln Leu Val Glu Leu Lys Ile Asp Ser Cys

965 970 975

Asp Ser Leu Ile Tyr Trp Pro Glu Glu Glu Phe Leu Cys Leu Val Ser

980 985 990

Leu Lys Lys Leu Thr Ile Lys Glu Cys Tyr Asn Leu Ile Gly Arg Pro

995 1000 1005

Thr Gln Val Thr Gly Asn Pro Thr Leu Leu Pro His Leu Thr Ser

1010 1015 1020

Leu Tyr Val Ser Lys Cys Val Arg Leu Arg Glu Leu Phe Val Leu

1025 1030 1035

Pro Pro Ser Ile Lys Tyr Ile Thr Ile Asn Asp Ser Ile Cys Leu

1040 1045 1050

Glu Ser Phe Ser Phe Pro Ser Tyr His Leu Pro Cys Leu Glu Arg

1055 1060 1065

Leu Ser Phe Trp Asn Cys Arg Ser Val Val Thr Leu Gln Asn Leu

1070 1075 1080

Pro Pro Cys Leu Met Leu Ser Ile Asp Ala Cys Trp Glu Leu Gln

1085 1090 1095

Ser Leu Ser Gly Gln Leu Asp Glu Leu Lys His Leu Gly Ile Val

1100 1105 1110

Arg Cys Asn Lys Leu Glu Ser Leu Asn Cys Leu Gly Glu Leu Pro

1115 1120 1125

Ser Leu Glu His Leu Asp Leu Lys Met Cys Lys Arg Leu Ala Ser

1130 1135 1140

Ala Pro Cys Gly Pro Arg Ser Tyr Ser Ser Leu Leu Ser Ile Thr

1145 1150 1155

Ile Gln Asp Cys Pro Arg Met Asn Met Lys Lys Val Tyr Glu Trp

1160 1165 1170

Leu Arg Pro Arg Leu Asp Ser Leu Glu Glu Arg Asp Leu Ser His

1175 1180 1185

Ala His Thr Arg Val Ile Tyr Glu Glu Ser Lys Cys Pro Thr Leu

1190 1195 1200

Lys Ser Trp Lys Tyr Ala Ile Thr Arg Arg Trp

1205 1210

<210> 3

<211> 5273

<212> DNA

<213>rice (Oryza sativa)

<400> 3

gagagagagg gagagatgaa tgcataaaaa gagaaaagtt ttagtgggac tcacattaag 60

aatggtgcac tatggagctt gtatcctatg tgtggctttg tcctacgtga catctctttt 120

tttatgagag agtggcctgc atagtgtatg tccgtggtac ttttttagtt atggaggcct 180

ctctatgtca ccatccttga gcaggtacca ctgttttcta tgtaaaattt ggtacctctt 240

gttaccttag gtactagaag gtaccaaatt ttaagtttta ctctcatccc tcctttttta 300

tcttaaggta ccggtatctc gcggtaccaa atcatttatg atcgttggat caaacagtgc 360

acatcctatt tagctagatc caatggtgag aaacgatttg gtatctcgag gtactggtac 420

ctcgaggtat aaaaggaagg ataagagtaa aactcaccaa attttacata taaaacagtg 480

gtacctcttg taccttctta aggatggaaa aaaaactctt ttaacaacat atattgtcta 540

aaaaatacca gcaggatgct tgcatcggat cgttggtaac gaaaaattac ggggcattta 600

actttttgtc actcttaaaa ttggttaata ataaatttat cactcattat atatgatata 660

tacgctctga tatgttaggt ccaatgataa atatgttaat tattgccggt tatgtacgcc 720

gtgtgtccag agcatctcat taaagtagga atcactctat cttctctccc acatcgatcg 780

accacctctc tctcttccat ctccatccac agcatcccct cggagattag ggcctccgtt 840

ctctgatcga tctagatcga tcccccacaa catctagatc gggtctcgac gaaggttagt 900

gccgctagct agctgcctgc gatatcatat catttcagtt ctgcaatgtg gagtaattaa 960

ccgtgttccc tctcccatcc atgatgcaga gaagagaacg aagcatcatc ttcagaggga 1020

gcaacgatgg ctgagttttt ggttcggccg ctgctgtcca cggtgcagaa cgcttccagc 1080

tatcttgcag gccagtacag ggtgatggaa ggcatggagg agcagcgcaa agctctggag 1140

cgcatgcttc cactcatcct caccgtcatc cacgacgcac agaacagaac caaacaatcc 1200

caagtaggcg cttggctgca agagctcaag aaggtgtcct acgaggcgac cgacgtgttc 1260

gacgagttca gatacgaggc gctccggcgc gaagccagga ggaaagggca cggcgctgta 1320

agcctcttct cctctcgtaa cccaatcgtg tttcgctaca ggatgggcaa gaagctgcgg 1380

aagatcgtgc agagaatcaa ggaacttgtc gaggagatga attcctttgg gctcgtacac 1440

cggcaggaaa caccgaggca gtcgaggcaa actgattcag tgatgcttga ttttgagaag 1500

gatattgtta gcagatccag agatgaggag aagaggaagg ttgtcaagat attggtggat 1560

gaagctagcg acagggagct cacagtcctt cctgttgttg gaatgggtgg tcttggcaag 1620

actacatttg cacagctcat ctacaatgac cctgaaatcc tgaagcattt tcagcttcgc 1680

aggtggtgtt gtgtgtctga tgaatttgat gtcgttagca tcgcaaacaa catatgtgtg 1740

agcacagaga gaaatcgtga aagggcactg caagatctgc agaaggaagt aagtggaaag 1800

aagtttctga tagtgttgga tgatgtgtgg aatagggatt ctgacaagtg gggaaagtta 1860

atgacctgcc ttaagcaggg ctccaggggc agtgtggtac taacaacaac tcgggatgtc 1920

aaagtcgcta caattatggc taccagtgaa gttgaagtgt ataatcttgg taagctagga 1980

gaagtgtatt tgaaggaaat aatccaaagt aaagcaattg gtttgccagg aagtgatgag 2040

catttggaag ttcttaataa aattgttcag agatgtgatg gctctccttt agctgcaaaa 2100

tcctttggct ctgtgttgtc tagcaggagt actgtacaag aatggaagga tatattagcc 2160

aaaagtaaca tttgcaatga gggggaggac acaatttttc ctatacttcg tctcagctat 2220

gacgacttac catttgacat gaagcaatgc tttgctttct gtgctatatt cccaaaagat 2280

tatgtgattg atgtggagac tttgattaag ctatggttgg cacatgactt cataccatta 2340

caagaggatg acaatctaga atcggcagcc gaagatatct tcaaggagct agtttggagg 2400

tcattttttc aagatgtaaa gaaatcttct atatggacca catgcaagat acatgatctt 2460

atgcacgaca ttgctcaatc tgttatggga aaagaatgtg tcagcatagc tggaaggtcc 2520

aattttataa gtctgttatc agaacatcct aggtatcact ttcactcatc atacaaagag 2580

actgttctct tagatgactt tatgagaaaa caatctccaa ctctccggag tttattgttt 2640

gaacgatggt ttaattactt cagcacatca catttatcca agtgcagttc tctgcgagca 2700

ctgaagctcc tacgatgcag cgaattctta ccaatcgggc accttcagca cctaagatat 2760

ctcaatatct catcaaacag ttgtatcaaa aagcttccta aagatatatg catactctac 2820

aatctacaga ctttggtcct ctcttattgt aaaaatcttg tcgaacttcc aaaggatatg 2880

aagtatatga aaaatctgcg acacctttat acggatggat gtccaaaatt gaagtacatg 2940

cctccggacc ttggacagtt aacttccctg cagatattaa catcttttgt ggtgggagct 3000

aggtctggtt gcagtaacct tagagaattg cgtaccttaa acctttgtgg caggctacag 3060

ttatgtggcc tagaaaatga aaaggaagaa aatgcgaaag cagccaatct tcgaaacaaa 3120

gagaaactta cacatttgtc tcttgagtgg aatagcaact gccatcttga aggaacaaat 3180

tccccttata aggttcttga tgctcttaaa cctcatcaca ggctgcagat gcttaaggta 3240

atttcctata caggcagttc ttttccagca tggataacag accttggtgt cctgcaaaac 3300

ttgatagagc tccatttaga gggctgtaca atgtgtggag aatttcctca gttcattcgt 3360

ttcaagtttc ttcaggttct ttatctgagt agacttgata acttgcaaac cctatgtcgc 3420

gaggaaggaa gacaaggaac agaacaagca tttcatcagc ttgagaaggt tgtcatcaac 3480

atctgtccaa agtttcaaac attgtgctct ggtgtggcat ccactgcatt tccagaacta 3540

aaggaagtca agttaatgga tttggagagc tttgagacat gggtggcaat ggaagggagg 3600

caaggttaca tgccaacatt tcctctgctt gaggaggttg aaatcaacaa gtgcccaaaa 3660

ttgacaactc tacctgaagc accaaagctc aagattttaa atctaaatga aaacaaagcg 3720

cagctgtcct tgtcattgct tcaatccagc tatatatcct cattgtccaa gctaagattg 3780

gaaatagatg acaaagaaac aaccctgcag ctgcttgatc agatccacga atcatctctc 3840

tcagaaatgg agttaacaca ttgcaacatt ctcttcccct tgagcccatc acagtcaaaa 3900

atgaggatct gggaatggct tggacaactt gttgagctga aaatcgactc ctgcgattcg 3960

ctcatctact ggccagaaga agagttccta tgcttggtat ccctgaagaa attgaccatc 4020

aaggagtgct ataacctaat tggccgtcct acccaggtga caggaaatcc aactctcctg 4080

ccacatctca catcgcttta tgtttctaag tgtgtcaggt tgagagagct ctttgttctt 4140

ccaccatcta tcaaatatat tacaattaat gactccattt gtcttgagag cttctcattc 4200

ccctcctatc atctgccatg cctagaacgt ctaagtttct ggaattgtcg ttcagtggta 4260

acacttcaga acctaccacc atgccttatg ctgtccattg atgcatgttg ggagcttcaa 4320

tcgctgtcag ggcagctgga tgaactcaag catttgggca ttgtacgctg caataaactg 4380

gagtcactga attgcttggg agaattgcca tcactggaac atcttgacct taagatgtgc 4440

aaacgtctag catcggcgcc atgtggccca aggagttact catctctttt gagtattaca 4500

atccaagact gcccaagaat gaatatgaag aaggtatatg agtggctccg gccacggctg 4560

gatagccttg aggaaagaga cctgtcacat gctcatacaa gagtaattta tgaaggtaca 4620

ctccattgct agcattttcc ttctttttcc gtttttcgtt tcttttacat agatgaatag 4680

attttatgtt cctgtgccag tgtatatctg cactcaaagt tccaatcatc aggccctgtg 4740

ttttataact gaataagata gaaattgtgt ttcttggtta aagagattct agtctaacct 4800

tgatcgaaca aaggttcgtt ccaccaaaac cataggagct ccatcactgt ttattgacaa 4860

gtttgtgtct acctgtgagg tgtgctatgt gactgcattt gtagcttcct ataatattca 4920

acataattta gtcggtgtcg ataccatgca tgaaatgagc atttttttta tcctcgagaa 4980

actattataa ggaagcactg ttttttatat aaaatttggt actttctagt atctaatata 5040

ctaacagtgg tacctcttag taccttctca aggatcgtaa tatcgctcgc atggaatagt 5100

tcctttccct ctgtactcca ttttattttt tctctttttc tgcagtttat ttcgattgtg 5160

agatattatc taaaaaaaat tcggttgtga gactgacatt tatttttcat gctacagagt 5220

ctaaatgccc gacactaaaa tcatggaaat atgctattac tcgccgttgg tga 5273

Claims

1. following 1) -3) application of any substance in regulation disease resistance of plant in:

1) albumen RWR1；

2) DNA molecular of albumen RWR1 is encoded；

The albumen RWR1 is following (1) or (2):

(2) amino acid sequence shown in sequence 2 in sequence table is passed through to the substitution and/or missing of one or several amino acid residues And/or addition and the protein with the same function as derived from (1).

2. application according to claim 1, it is characterised in that:

The DNA molecular is following 1) -4) in any DNA molecular:

1) code area is DNA molecular shown in sequence 1 in sequence table；

2) code area is DNA molecular shown in sequence 3 in sequence table；

4) at least have 70% with the DNA sequence dna 1) limited, at least have 75%, at least with 80%, at least with 85%, extremely Less with 90%, at least with 95%, at least with 96%, at least with 97%, at least with 98% or at least with 99% Homology and coding have the DNA molecular of identical function protein.

3. application according to claim 1 or 2, it is characterised in that: described disease-resistant for blast resisting.

4. application according to claim 1 to 3, it is characterised in that:

The plant is dicotyledon or monocotyledon；

Or the plant is monocotyledon, the monocotyledon is specially rice.

5. following 1) -3 in claim any one of 1-4) any substance is cultivating the application in disease-resistant plants in.

6. application according to claim 5, it is characterised in that: described disease-resistant for blast resisting；

Or, the plant is dicotyledon or monocotyledon；

Or the plant is monocotyledon, the monocotyledon is specially rice.

7. a kind of method for cultivating disease-resistant transgenic plant includes the following steps: to improve coding albumen RWR1 in purpose plant The expression quantity and/or activity of DNA molecular, obtain genetically modified plants, and the disease resistance of the genetically modified plants is planted higher than the purpose Object；

The albumen RWR1 is following (1) or (2):

8. according to the method described in claim 7, it is characterized by:

The expression quantity and/or activity that the DNA molecular of albumen RWR1 is encoded in the raising purpose plant are by the coding albumen The DNA molecular of RWR1 imports purpose plant.

9. method according to claim 7 or 8, it is characterised in that: described disease-resistant for blast resisting.

10. according to the method any in claim 7-9, it is characterised in that: the plant is dicotyledon or list Leaf plant；

Or the plant is monocotyledon, the monocotyledon is specially rice.