CN109234285A

CN109234285A - Application of the Zm-Remorin gene in corn stalk rot disease prevention and treatment

Info

Publication number: CN109234285A
Application number: CN201811122868.3A
Authority: CN
Inventors: 吴刘记; 王顺喜; 陈赞; 张君
Original assignee: Henan Agricultural University
Current assignee: Henan Agricultural University
Priority date: 2018-09-26
Filing date: 2018-09-26
Publication date: 2019-01-18

Abstract

The invention discloses application of the Zm-Remorin gene in corn stalk rot disease prevention and treatment.The present invention provides following 1) -3) in application of any substance in regulation Genes For Plant Tolerance stem rot characteristic of disease；1) albumen Zm-Remorin；2) DNA molecular of albumen Zm-Remorin is encoded；3) recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA molecular containing coding albumen Zm-Remorin；The experiment proves that Zm-Remorin plays an important role in plant resists the infecting of pathogen, extends, the resistance to stem rot can be significantly improved.

Description

Application of the Zm-Remorin gene in corn stalk rot disease prevention and treatment

Technical field

The invention belongs to field of biotechnology more particularly to a kind of Zm-Remorin gene in corn stalk rot disease prevention and treatment Using.

Background technique

Corn is one of the cereal crops cultivated the most extensively in the world.On the one hand, corn provides for human and animal A large amount of food source, but then, maize diseases can lead to huge economic loss.Especially corn in recent years Disease generation is increasingly frequent, and disease species are increasing, seriously affected the development of Maize Industry.The use of chemical pesticide is one Determine to improve the control action to maize diseases in degree, but the use of pesticide not only polluted environment, long-time service can also Make corn generate drug resistance, meanwhile, caused by medicament residue also have potential threat to the life security of the mankind.Therefore, right In the disease-resistant research of corn, people, which are dedicated to finding neither, influences the method that environment again can effectively prevent maize diseases.

Corn stalk rot disease is also known as Causal Organism of Maize Basal Stalk, bacterial wilt, and the disease is independent by a variety of pathogens or Combined Infection draws It rises, corn stalk rot disease is typical soil-borne disease, and pathogenic bacteria are overwintering on soil, fertilizer, invalid body or corn seed, invalid body And corn seed is main primary source of infection in spite of illness, pathogen is propagated by wind, water, machinery and insect etc., invades root And rhizome portion wound, cause plant to fall ill.Since corn inbred line in recent years and cenospecies are introduced a fine variety frequently interregional, lead to stem Maize ear rot is propagated in corn-growing regions large area.Relevant report points out, annual stem rot main maize area disease incidence in 10%- 20%, some times are even more to reach 60%, cause production loss up to 25% (Wu Haiyan etc., 2007).In recent years, although identifying The Quantitative site of several corn stalk rot diseases, but resistance contribution rate is all limited, and the resistance molecule of corn stalk rot disease Mechanism is also known little about it (Zhang et al.2016), therefore, excavates new corn stalk rot disease resistant gene and its resistance mechanism, It is of great significance to the genetic improvement and production of corn.

Summary of the invention

It is an object of the present invention to provide following 1) -3) in any substance purposes.

The present invention provides following 1) -3) in application of any substance in regulation Genes For Plant Tolerance stem rot；

1) albumen Zm-Remorin；

2) DNA molecular of albumen Zm-Remorin is encoded；

3) recombinant vector, expression cassette, transgenic cell line or the recombination of the DNA molecular containing coding albumen Zm-Remorin Bacterium；

The albumen Zm-Remorin is following (1) or (2):

(1) protein that the amino acid sequence shown in sequence 2 in sequence table forms；

(2) by amino acid sequence shown in sequence 2 in sequence table by one or several amino acid residues substitution and/or Deletion and/or addition and the protein with the same function as derived from (1).

In above-mentioned application, the DNA molecular is following 1) -4) in any DNA molecular:

1) code area is DNA molecular shown in sequence 1 in sequence table；

2) code area is DNA molecular shown in sequence 3 in sequence table；

1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and encode the DNA with identical function protein Molecule；

1) or 2) 4) at least have 70% with the DNA sequence dna limited, at least have 75%, at least having with 80%, at least Have 85%, at least have with 90%, at least with 95%, at least with 96%, at least with 97%, at least 98% or at least With 99% homology and coding has the DNA molecular of identical function protein.

In above-mentioned application, the regulation Genes For Plant Tolerance stem rot is to improve Genes For Plant Tolerance stem rot.

In above-mentioned application, the stem rot is corn stalk rot disease；

Or the pathogen of the stem rot is Fusarium graminearum；

Or the plant is dicotyledon or monocotyledon.

Above-mentioned 1) -3) application of any substance in prevention and treatment plant stem rot evil is also the scope of protection of the invention in；

Or, above-mentioned 1) -3) in any substance cultivating the application in anti-stem rot plant be also the model that the present invention protects It encloses；

Or, above-mentioned 1) -3) in any substance cultivating the application in highly resistance stem rot plant be also what the present invention protected Range.

In above-mentioned application, the stem rot is corn stalk rot disease；

Or the pathogen of the stem rot is Fusarium graminearum；

Or the plant is dicotyledon or monocotyledon；

Or the plant is monocotyledon, the monocotyledon is specially corn.

Another object of the present invention is to provide a kind of method for cultivating highly resistance stem rot genetically modified plants.

Method provided by the invention, includes the following steps:

The expression quantity and/or activity for encoding the DNA molecular of albumen Zm-Remorin in purpose plant are improved, transgenosis is obtained Plant,

Or, improving albumen Zm-Remorin activity in purpose plant, genetically modified plants are obtained,

The anti-stem rot characteristic of disease of the genetically modified plants is higher than the purpose plant；

The albumen Zm-Remorin is following (1) or (2):

In the above method, it is described improve purpose plant in encode albumen Zm-Remorin DNA molecular expression quantity and/or Activity is that the DNA molecular of the coding albumen Zm-Remorin is imported purpose plant.

In the above method, the stem rot is corn stalk rot disease；

Or the pathogen of the stem rot is Fusarium graminearum；

In the above method, the plant is dicotyledon or monocotyledon.

Or the plant is monocotyledon, the monocotyledon is specially corn.

The experiment proves that the present invention is divided by the Disease Resistance Identification to Zm-Remorin transgenic line with expression Analysis, the study found that the Spot expansion speed of transgenic positive strain is far smaller than negative strain after being inoculated with Fusarium graminearum, After pathogen invasion, positive strain can effectively prevent pathogen in the intracorporal extension of plant.In conjunction with the difference to Lesion size The opposite sex carries out data statistic analysis, 5 days after inoculation, 10 days, 15 days, 20 days, the difference of transgenic positive strain and negative strain It is different to have reached the level of signifiance.It can be found that Zm-Remorin is played in plant resists the infecting of pathogen, extends Important role can significantly improve the resistance to stem rot.

Detailed description of the invention

Fig. 1 is subcellular localization of the Zm-Remorin in arabidopsis as a result, each icon ruler is 50 μm.

Fig. 2 is Bar gene PCR testing result.

Fig. 3 is inoculation method and position view.

Fig. 4 is the phenotypic evaluation of transgenic line.

Fig. 5 is the Lesion size statistical result of transgenic line.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

Corn inbred line B73 is the preservation of this laboratory in following embodiments, and bacillus coli DH 5 alpha is the preservation of this laboratory, RNA extraction reagent TRIZOL Reagent, reverse transcription reagent box, Ago-Gel DNA QIAquick Gel Extraction Kit, carrier T PMD18-T, Taq enzyme, plasmid extraction kit, restriction enzyme, T4 ligase, DEPC water are purchased from precious bioengineering Co., Ltd, survey Sequence and primer synthesis are carried out in the raw work of Hua Da and Shanghai respectively.

The clone of embodiment 1, Zm-Remorin gene

1, the extraction of plant total serum IgE

The RNA of blade when extracting tetra- leaf of corn inbred line B73 wholeheartedly.

2, DNA of plants extracts

The genomic DNA of blade when extracting tetra- leaf of corn inbred line B73 wholeheartedly.

3, the synthesis of the first chain of cDNA

The RNA that above-mentioned 1 obtains is illustrated that configuration reverse transcription system carries out the conjunction of the first chain of cDNA according to reverse transcription reagent box At obtaining cDNA.

Reverse transcription is as follows:

RNA 6μl

Oligo(DT) 1μl

4 μ l of DEPC water

65 DEG C warm bath 5 minutes, then on ice place 2 minutes, add following reagent:

RNase inhibitor 1μl

M-mlv buffer 4μl

DNTP(25nml) 3μl

1 μ l of M-mlv reverse transcriptase

It is as follows that reverse transcription PCR program is set,

42℃ 1h

72℃ 10min

4℃ forever

After be stored in -20 DEG C.

4, the clone of Zm-Remorin

1) clone of cDNA

Design primer is as follows:

Zm-Remorin F1:5'AAAACCGGTTGCTATTAGTAC 3'；

Zm-Remorin R1:5'GAAGAAAACAAAATGTCTGC 3'；Target fragment length 971bp.

The cDNA obtained with above-mentioned 3 is template, carries out PCR expansion with Zm-Remorin F1 and Zm-Remorin F1 primer Increase, obtains pcr amplification product.

Above-mentioned PCR amplification system is as follows:

Above-mentioned PCR response procedures are as follows:

Above-mentioned pcr amplification product is connected on PMD 18-T and is sequenced, by sequencing, which has sequence 1 Shown in gene, which is Zm-Remorin, and the ORF sequence of the gene is sequence 1, and the albumen of gene coding is sequence Sequence 2 in list, the albumen are named as Zm-Remorin.

2) clone of DNA

It is as follows to design Zm-Remorin DNA cloning primer:

Zm-Remorin R2:5'GTGTTGAACGAAACGAACGTTGC 3'；

Zm-Remorin F2:5'GTCATCAAATAACTGCTAGCAT 3', target fragment 1586bp.

Zm-Remorin R3:5'ACGACGTGGCCATCGTAGGTT 3'；

Zm-Remorin F3:5'CTTTGGTTGTGCATAAGCAGGCT 3'.Target fragment 1443bp.

Zm-Remorin R4:5'TGCTGTTATCTGGTTTATCT 3'；

Zm-Remorin F4:5'GATAGAGCGAGAGGACCAAGCA 3'.Target fragment 2054bp.

The DNA obtained respectively using above-mentioned 2 carries out PCR amplification as template, with above-mentioned 3 pairs of primers, obtains 3 kinds of PCR amplifications and produces Object.By above-mentioned 3 kinds of pcr amplification product amplified productions through connection, conversion, sequencing, splicing, the Zm-Remorin of 4140bp is obtained Genomic dna sequence (sequence 3), by with its cDNA sequence compare, discovery Zm-Remorin gene DNA sequence contain 5 Exon and 4 intrones.

Two, the subcellular localization of Zm-Remorin

B73 corn seed, arabidopsis seed, vector plasmid pCAMBIA 1304 are the preservation of this laboratory.Plasmid extracts examination Agent box, restriction enzyme NcoI, SpeI, T4DNA ligase, PCR related reagent etc..Laser Scanning Confocal Microscope, centrifuge, liquid relief Device, shaking table, gel imaging system, culture dish, glass slide, coverslip, tweezers etc..

1, the building of GFP fusion expression vector

GFP fusion expression vector pCAMBIA 1304-Zm-Remorin-GFP is by Zm- shown in sequence 1 in sequence table Remorin gene replacement carrier pCAMBIA-1304 (is recorded in the following literature: " Ruchi Pandey, Avinash Mishra,G.K.Garg.Plant promoter driven heterologous expression of HMW glutenin gene(s)subunit in E.coli.Mol Biol Rep(2008)35:153–162."；The public can be from Agricultural University Of He'nan It obtains；Have GFP on the carrier) NcoI and SpeI double enzyme site between carrier.

Above-mentioned pCAMBIA 1304-Zm-Remorin-GFP is transferred in Agrobacterium GV3101, recombinational agrobacterium is obtained GV3101/pCAMBIA 1304-Zm-Remorin-GFP。

Empty carrier pCAMBIA 1304 is transferred in Agrobacterium GV3101, recombinational agrobacterium GV3101/pCAMBIA is obtained 1304。

2, the conversion of arabidopsis

1) respectively by GV3101/pCAMBIA 1304-Zm-Remorin-GFP and recombinational agrobacterium GV3101/pCAMBIA In the 1304 YEB fluid nutrient mediums (kanamycins concentration is 50 μ g/ml) for being inoculated in that resistance of 500ml card (while being inoculated with several Difference clone), 28 DEG C shaken cultivation 6-12 hours (OD600=0.8-1.0).

2) 4000rpm/min, room temperature are centrifuged 5 minutes, collect thallus.

3) 200ml MS salting liquid suspension thalline is used.

4) it is watered with water on the day before mentioning the wildtype Arabidopsis thaliana of full-bloom stage (col-0), arabidopsis floral is immersed in Agrobacterium Suspension in one minute or so, put on moisturizing one day with freshness protection package.Plant was taken out from freshness protection package in second day, dark is placed It is put back to after one day on illumination cultivation frame, normal growth to harvest 0 generation of mature T turns Zm-Remorin arabidopsis seed and T0 generation turns sky Carrier arabidopsis seed.

3, the screening of transgenic arabidopsis positive plant

1) resistance screening of transgenic arabidopsis

According to the experiment that laboratory is previous, 30mg/ml be hygromycin arabidopsis screening most suitable concentration, therefore just with Concentration of the hygromycin of 30mg/ml as arabidopsis resistance screening.

In T0 generation after drying, is turned into Zm-Remorin arabidopsis seed, it is flat to be seeded in the 1/2MS containing 30mg/ml hygromycin In plate culture medium, until arabidopsis it is long to 6 leaves or so when, can normal growth be to turn Zm- in resistance screening positive T0 generation Remorin arabidopsis seed will grow normal arabidopsis and move to normal growth in compost.

2) the PCR detection of transgenic arabidopsis

In resistance screening positive T0 generation, turns Zm-Remorin arabidopsis and moves in Nutrition Soil when growing to 14 leaves or so, extracts Arabidopsis thaliana genomic dna carries out PCR detection.

Above-mentioned PCR detection the primer is as follows:

18S R:5'CCTGCGGCTTAATTGACTC 3'；

18S F:5'GTTAGCAGGCTGAGGTCTCG 3'

Pcr amplification product is detected, purpose product segment 174bp is to turn Zm-Remorin arabidopsis in positive T0 generation.

In above-mentioned transformant per generation, will be subjected to resistance screening and PCR detection, positive strain plant division harvest turns until obtaining T3 Zm-Remorin arabidopsis seed carries out follow-up test.

4, subcellular localization of the Zm-Remorin in arabidopsis

In T3 generation, is turned into Zm-Remorin arabidopsis referring to above-mentioned arabidopsis implantation methods and T3 turns the plantation of empty carrier arabidopsis In the 1/2MS plating medium containing hygromycin resistance, after being protected from light 4 DEG C of vernalization 3 days, are moved under light (21 DEG C) one weeks of growth When about 6mm or so (root growth to), the tip of a root of clip transformant is placed on the centre of glass slide, drips clear water, covers Coverslip after being pressed lightly on thumb, moves under Laser Scanning Confocal Microscope, observes position of the green fluorescent protein in arabidopsis cell It sets.

As a result as shown in Figure 1, A, B, C are the fluorescence results for turning Zm-Remorin arabidopsis root in T3 generation；D, E, F are that T3 turns sky The fluorescence results of carrier arabidopsis root；A, D is the arabidopsis root cells picture under fluorescence signal；B, E is quasi- under light field signal Southern mustard root cells picture；C, F is A, B and D, the superimposed photo of E；It can be seen from the figure that T3 turns the empty carrier arabidopsis tip of a root There is fluorescence signal in nucleus, cell membrane and cytoplasm, and in T3 generation, turns the arabidopsis tip of a root of Zm-Remorin arabidopsis only Fluorescence signal is detected in cell membrane, illustrates that Zm-Remorin albumen is a film positioning protein matter.

The application of embodiment 2, Zm-Remorin in corn stalk rot disease prevention and treatment

1, the building of Zm-Remorin over-express vector

Zm-Remorin over-express vector pCAMBIA 3301-Zm-Remorin is by Zm-Remorin shown in sequence 1 3301 carrier of gene replacement pCAMBIA (is recorded in the following literature: " Production of purple-colored creeping bentgrass using maize transcription factor genes Pl and Lcthrough It is disclosed in Agrobacterium-mediated transformation.Plant Cell Rep (2009) 28:397-406 " Cross, the public can obtain from Agricultural University Of He'nan) in II restriction enzyme site of NcoI restriction enzyme site and Bgl between DNA molecular, obtain Carrier.

Above-mentioned pCAMBIA 3301-Zm-Remorin is transferred in Agrobacterium GV3101, recombinational agrobacterium GV3101/ is obtained pCAMBIA 3301-Zm-Remorin。

Empty carrier pCAMBIA 3301 is transferred in Agrobacterium GV3101, recombinational agrobacterium GV3101/pCAMBIA is obtained 3301。

2, turn the acquisition of Zm-Remorin corn

Above-mentioned GV3101/pCAMBIA 3301-Zm-Remorin is conducted into corn with the method that Agrobacterium is infected II (hereinafter also referred to wild-type corn of kind Hi；Corn variety Hi II is in document " Biolistic gun-mediated maize genetic transformation.Methods Mol Biol.(2009)；It is disclosed in 526:29-45 ", the public can be from river Southern agriculture university obtains) callus of IMMATURE EMBRYOS CULTURE, it is subsequent to carry out screening and regeneration induction (the method bibliography " agriculture bar The foundation for the good inbred lines genetic transformation body that bacterium mediates.Agricultural University Of Shenyang's journal, 2002-06,33 (3): 195- 199 "), in acquisition T0 generation, turns Zm-Remorin corn.

Recombinational agrobacterium GV3101/pCAMBIA 3301 is transferred in wild-type corn using same method, obtains T0 In generation, turns empty carrier corn.

3, turn the identification of Zm-Remorin corn

1) herbicide screening (PPT:200mg/L)

In T0 generation, turns Zm-Remorin corn and passes through herbicide screening (PPT:200mg/L), specific as follows:

Non-transgenic corn seedling is smeared with the PPT of various concentration first, determines suitable smearing concentration；Choose second newly Raw maize leaf, and smear in blade tip the PPT of various concentration simultaneously in tow sides, concentration used be followed successively by 50mg/L, 100mg/L,200mg/L,300mg/L,400mg/L.After a week, blade tip phenotype is observed.By repeating three times, discovery is dense when smearing When degree is 200mg/L, blade tip starts obviously withered, and when 400mg/L, blade tip is substantially all withered.So final choice 200mg/L PPT smear identification transgenic seedling.Then, Zm-Remorin maize seedling is turned to T0 generation and carries out smearing identification, carried out after a week Phenotypic Observation, blade tip turn Zm-Remorin without obviously withered as Herbicid resistant seedling, as herbicide screening positive T0 generation Corn.

2) reporter gene Bar gene PCR

When herbicide screening positive T0 generation turning Zm-Remorin plant and growing to 4 leaf, blade genome is extracted DNA is expanded with following primer:

BarF8:TGACGCACAATCCCACTATCCTTC

BarR8:CCAGAAACCCACGTCATGCCAGT

As a result as shown in Fig. 2, swimming lane is the not homophyletic for turning Zm-Remorin plant in herbicide screening positive T0 generation System, the first two swimming lane do not detect that Bar gene, rear ten swimming lanes detected Bar gene, it can be seen that in addition to 243,241 Outside strain, other strains are to turn Zm-Remorin plant in positive T0 generation.

Sowing, per generation carries out herbicide screening and Bar gene PCR screening, select two kinds screening be the positive as Next time, selfing was maternal, obtained that T2 generation turns Zm-Remorin plant and T2 generation turns empty carrier corn.

4, Resistance Identification of the transgenic corns to stem rot

For trying pathogen: Fusarium graminearum (Fusarium graminearum) PH-1 is in document " RUBELLA S.GOSWAMI AND H.CORBY KISTLER.Heading for disaster:Fusarium graminearum on Cereal crops.Molecular Plant Pathology (2004) 5 (6): 515-525. " it is disclosed in, the public can be from river Southern agriculture university obtains；Specifically from the corn for carrying Fusarium graminearum Fusarium graminearum (Fusarium graminearum) PH-1 Blade isolates and purifies preservation.

1) strain culturing is bred

Fusarium graminearum PH-1 bacterial strain after activation is placed in PDA culture medium, after bacterial strain produces spore, uses sterile purified water Spore is eluted, being configured to concentration is 1 × 10⁵The spore suspension of/ml, for use.

PDA culture medium: cleaning peeling for fresh potato, 200g claimed to be cut into small pieces, and adds the ripe rear 6 layers of filtered through gauze of boiling, It weighs 20g glucose and filtrate is added in 15g agar powder, be settled to l L, 12l DEG C of high pressure sterilization 30min, take out plate processed.

2) plantation of transgenic corn plant

By T2 generation turn Zm-Remorin corn strain 231,233, above-mentioned negative strain 241,243 it is (non-to turn Zm-Remorin Corn strain) and wild-type corn plantation in greenhouse, when the 10 leaf phase of corn, prepare inoculation.40 plants of each strain.

3) it is inoculated with

Firstly, by the T2 of 10 leaf phases 2) generation turn Zm-Remorin corn 231,233, above-mentioned negative strain 241,243 it is (non- Turn Zm-Remorin corn strain) and wild-type corn be inoculated with using needle point method, be inoculated with position third internode on soil, needle Pierce depth 1cm, every plant of 10 μ l 1*10 of injection⁶Spore suspension.

Scab measurement is carried out respectively within 5 days after inoculation, 10 days, 15 days, 20 days, measurement method is the Maize Stem taken after inoculation Stalk, with tool therefrom between rive and measure scab (Fig. 3).

As a result as shown in Figure 4, it can be seen that with the increase of days post inoculation, all strains by infected tissue gradually Expand, for the difference between strain, strain 241, the expansion rate of 243 scabs obviously turn Zm-Remorin corn than T2 generation 231,233 strains are big.

Wild-type corn and negative strain 241,243 (non-to turn Zm-Remorin corn strain) are without significant difference.

5 days after inoculation, 10 days, 15 days, progress scab measurement in 20 days it is (long to Longitudinal Extension of the scab in corn stem Degree measures；, data statistic analysis is carried out to the otherness of scab.

As a result as shown in figure 5, negative strain 241,243 and T2 generation turns the difference between Zm-Remorin corn 231,233 strains It is different all to have reached the level of signifiance at 5 days, 10 days, 15 days and 20 days.

Sequence table

<110>Agricultural University Of He'nan

<120>application of the Zm-Remorin gene in corn stalk rot disease prevention and treatment

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 597

<212> DNA

<213> 1

<400> 1

atggctgagg aggaggccaa gaaggtggag gtggaggtca ccaaggagcc cgaggcggcg 60

gcgaaggagg acgtagccga tgacaaggcc gtcatccccg cgaccgaccc gccgccgccg 120

ccgccgccgg ccgacgactc caaggccctg gccatcgtcg agaaagttgc agatgaacct 180

gctcccgcga agcctgcccc tgcgaagcaa gggggctcca atgacaggga tctcgctctt 240

gcaagggtgg aaacagagaa gaggaactct ttgatcaaag cttgggaaga gaatgagaag 300

acaaaagctg agaacaaggc tgctaagaaa gtatccgcta ttctttcatg ggaaaacaca 360

aagaaagcaa acatagaagc tgaactgaag aagattgagg aacaactgga aaagaagaag 420

gctgaatatg cagagaagat gaagaacaag gttgcaatga tacacaagga agccgaagag 480

aagcgagcga tggtggaggc aaaacgcggt gaggaggtcc tgaaggccga ggagatggct 540

gccaagtacc gggccaccgg ccacgctcct aagaagctca tcggttgctt cggagcc 597

<210> 2

<211> 199

<212> PRT

<213> 2

<400> 2

Met Ala Glu Glu Glu Ala Lys Lys Val Glu Val Glu Val Thr Lys Glu

1 5 10 15

Pro Glu Ala Ala Ala Lys Glu Asp Val Ala Asp Asp Lys Ala Val Ile

20 25 30

Pro Ala Thr Asp Pro Pro Pro Pro Pro Pro Pro Ala Asp Asp Ser Lys

35 40 45

Ala Leu Ala Ile Val Glu Lys Val Ala Asp Glu Pro Ala Pro Glu Lys

50 55 60

Pro Ala Pro Ala Lys Gln Gly Gly Ser Asn Asp Arg Asp Leu Ala Leu

65 70 75 80

Ala Arg Val Glu Thr Glu Lys Arg Asn Ser Leu Ile Lys Ala Trp Glu

85 90 95

Glu Asn Glu Lys Thr Lys Ala Glu Asn Lys Ala Ala Lys Lys Val Ser

100 105 110

Ala Ile Leu Ser Trp Glu Asn Thr Lys Lys Ala Asn Thr Glu Ala Glu

115 120 125

Leu Lys Lys Ile Glu Glu Gln Leu Glu Lys Lys Lys Ala Glu Tyr Ala

130 135 140

Glu Lys Met Lys Asn Lys Val Ala Met Ile His Lys Glu Ala Glu Glu

145 150 155 160

Lys Arg Ala Met Val Glu Ala Lys Arg Gly Glu Glu Val Leu Lys Ala

165 170 175

Glu Glu Met Ala Ala Lys Tyr Arg Ala Thr Gly His Ala Pro Lys Lys

180 185 190

Leu Ile Gly Cys Phe Gly Ala

195

<210> 3

<211> 4140

<212> DNA

<213> 3

<400> 3

atggctgagg aggaggccaa gaaggtggag gtggaggtca ccaaggagcc cgaggcggcg 60

gcgaaggagg acgtagccga tgacaaggcc gtcatccccg cgaccgaccc gccgccgccg 120

ccgccgccgg ccgacgactc caaggccctg gccatcgtcg agagtgagta cagcctgctc 180

tctgctctgc tttattaatt aattctgccc ccctctatgt agtccaaggc ttgcgatgga 240

aacatggcgc tggcggactg gtgtgtgctt tagattcatg tgccgcgaat tgggagaaac 300

tttcctcctc tctctaccct atgttttggt tcgtcgctct gtactttctg gtagctgtac 360

tgtggctggc agtactaggt acttgtgact tgtaatcctt ggcagtcggt ttgcttctcc 420

ttttcatggg ttccctgatt tgttgccggc gtgatccttt ggtgttggtt gtacttgtac 480

acccgaacgt atttggtccg attacttctc ttagacaaca aaattttctt gttagggggt 540

tgtgaggtgc aaatcacatt ggaaccttcg accaagttct aaagtactct agttctgtcg 600

taaaaaaaaa cgtactgaag taaatctgcg agtcatcgat tttcaggatt atttaccagc 660

ttcctaactg gtttccccct ttttttagag tggtagccac gcctgctaac ttgccaacta 720

ctacggacga attgcttgtc aagttccgaa agggcgcacg gggtaaaaag gttttaacat 780

ttttgggata gtcgcctcac ttcgaaaatt ggttttagga cgacgtggcc atcgtaggtt 840

tttggtttga gggttctaaa agtatgctag cagttatttg atgactaggc atgtagtatt 900

tcctttgctt gcgatttatt ttcagcgaaa atttcagatt ttgattcaga gaaaaagatg 960

gctctggaac tttcctgaat tctccacttt ctctccgcct tttgggcgtg ttcggctggc 1020

tacaagccga cactgttgca gctgtttgga ttgctgcagc tgcaatccat agagagaaaa 1080

atactgtaga agccgcagcc gcagccggat tgcagccgca gcaagccgca gcgaacaagc 1140

tgtttgtccc ttgttgcctg ctcttatcgt tcttcccttt attcaatccc tgttccctct 1200

aaaataacaa aaaaaaggcc ttagggcctg tttgtttcgg cttctggcag cttctggcca 1260

ccaaaatctg ctgcggactg ccaaacgctc agcttttcag ccagcctcta taaaattcgt 1320

tgggggcaaa aaccatccaa aatcaacata aacacataac cggttgagtc gttgtaatag 1380

taggaatccg tcactttcta gatcctaagt cctatgaata actttatctt cctccacacg 1440

taatcgtaat gatactcaga ttcttcccat agccagattc ttcctacagt cagattttca 1500

gaaaaactgg tcagaaaaaa ctgaaccaaa catgccctta gaatctgcat gtatgccgac 1560

cgtttttcta tctcagtata atgacgtgca ggcgcagctt tcgcgttcaa aaaagaataa 1620

atcctaaact ctatagaaag attcgaagtt tcatgctaag aggaaagtaa tcagacagaa 1680

acaaaggagt atgaagaaca attttgcata ctgttaagaa agttagaatt taccataaac 1740

cttattatga ttcatctgtc atttgaaatc tgtactcact aatctaaatc gaacaacaaa 1800

gcaggaaaaa aacagaattt gtcttttcta acacccaaat aattcctcca tgatttgaag 1860

aaataggaag aactgtctga tacttcacaa aaaatagaca tgccccatca cagcttgatg 1920

acaattgctt tctgttgctg ctaagtcttc aaagatgtac atcagttcct tgcataggcg 1980

ggcaaatgat gaaaccatgc gcttttgaag cattcagttt cactaaggtt atgcagatat 2040

acaaaataag ctcctgaaaa ttcaacttat ttctattctt taaatagcca aaaacatgag 2100

catataatca accgaacaga gtgggtggca aatttgagct ggcgttccag ttccaggcaa 2160

cttgctgtta tctggtttat ctattttatc atgttgatcc atcatccatc tttagttata 2220

tgcctatatt aatcctccaa agcctgctta tgcacaacca aagccgtctt gcctggaact 2280

atatattttt ctcgaggcac aaaaatttag caaggtgcca acatacttgt atacaagttg 2340

aacattatgt ctcacacata cagctaatta atcaaccaag acaccatatt ctaaaaattt 2400

gttaaacaca gcacaaatac atagaagaat attcagtttt gtagtcacta gtttttttta 2460

attattttgc attaactatg ctggtgacct ggtcttggat cttcagaaga ccaaccactt 2520

tcgttttctg aacaaaaaga caagagctct gccactcttt gagaagaaga gcagaagact 2580

gaccattgaa tacttagaag ttggaacact atgtcatcat ttggtaattc cttcctgaaa 2640

gatctagaga ggtttctatg gttactatca atactatcta ttgctttgta gttcgtgtag 2700

tttagaataa gattaatcct acgcatgcaa gagtgtacta gtcaaataag agaaaggaaa 2760

tctacaatct ttctcactga acaagctatg taagcagcag ttacgcagga cctggatatg 2820

gacacaaata agttgagcat tgcaaactca agtgcatgct cctgcaaaga taatagtata 2880

gcgacataaa ttacattttg ctctgtgatg ctaatgggtt ggattggatc attgatcagc 2940

atacaaccac ttgctagctt ctttcttcca tataaaattg ttcagcaaaa actgtttatg 3000

aatctgaatt tagtttttgc gccaaagcag gcataaattc tctatttttt tctgtctttc 3060

cagaagttgc agatgaacct gctcccgcga agcctgcccc tgcgaagcaa gggggctcca 3120

atgacagggg taattattga ataattgttg tgtcatcgag attgagtaca agttgccaat 3180

taaaacctga aacatggtct gcagatctcg ctcttgcaag ggtggaaaca gagaagagga 3240

actctttgat caaagcttgg gaagagaatg agaagacaaa agctgagaac aagtatgttt 3300

ctcaccttat ccattcccct gaaatcgtct tcagtggaac cattatttgt ctgttgcagt 3360

agatgcaatt tttgcaatgc tttcttcagt catctataat tctttcatca aagcaaattg 3420

gaagtttaat actggtttct gtacagccag ggcagtgtgg atataaaatt ctgctcagtt 3480

caaactaaaa caagaaaaag ccataagggc aaacaggata acatagtatg tcaattggaa 3540

gatatcatat ttagattctc aatatccaat agaagttgat ataaaccata ggcaggagat 3600

gtggaaattc ctaacttgaa ttaatacgca taactgtgac agggctgcta agaaagtatc 3660

cgctattctt tcatgggaaa acacaaagaa agcaaacata gaagctgaac tgaagaagat 3720

tgaggtatgt cattgaagga atactctttt ttatcgtctg tgcacttact agtttaagtc 3780

tgtcccatat tttaatagag acttgagcca ccgataacaa ttaatcaatt atagaggaat 3840

ttggaaaaga atagatccag tggaactaat atgccacccc ccctcccccc ctaaaaggtg 3900

atatcctctt agctacagct tatatggttt attcatgttc aggaacaact ggaaaagaag 3960

aaggctgaat atgcagagaa gatgaagaac aaggttgcaa tgatacacaa ggaagccgaa 4020

gagaagcgag cgatggtgga ggcaaaacgc ggtgaggagg tcctgaaggc cgaggagatg 4080

gctgccaagt accgggccac cggccacgct cctaagaagc tcatcggttg cttcggagcc 4140

Claims

1. following 1) -3) application of any substance in regulation Genes For Plant Tolerance stem rot in；

1) albumen Zm-Remorin；

2) DNA molecular of albumen Zm-Remorin is encoded；

3) recombinant vector, expression cassette, transgenic cell line or the recombinant bacterium of the DNA molecular containing coding albumen Zm-Remorin；

The albumen Zm-Remorin is following (1) or (2):

(2) amino acid sequence shown in sequence 2 in sequence table is passed through to the substitution and/or missing of one or several amino acid residues And/or addition and the protein with the same function as derived from (1).

2. application according to claim 1, it is characterised in that:

The DNA molecular is following 1) -4) in any DNA molecular:

1) code area is DNA molecular shown in sequence 1 in sequence table；

2) code area is DNA molecular shown in sequence 3 in sequence table；

1) or 2) 3) hybridize under strict conditions with the DNA sequence dna limited and encode the DNA molecular with identical function protein；

1) or 2) 4) at least have 70% with the DNA sequence dna limited, at least have 75%, at least having with 80%, at least 85%, at least with 90%, at least with 95%, at least with 96%, at least with 97%, at least have 98% or at least have There is 99% homology and coding has the DNA molecular of identical function protein.

3. application according to claim 1 or 2, it is characterised in that:

The regulation Genes For Plant Tolerance stem rot is to improve Genes For Plant Tolerance stem rot.

4. application according to claim 1 to 3, it is characterised in that:

The stem rot is corn stalk rot disease；

Or the pathogen of the stem rot is Fusarium graminearum；

Or the plant is dicotyledon or monocotyledon.

Following 1) -3 during 5. claim 1-4 is any) application of any substance in prevention and treatment plant stem rot evil in；

Or, following 1) -3 during claim 1-4 is any) in any substance cultivating the application in anti-stem rot plant；

Or, following 1) -3 during claim 1-4 is any) in any substance cultivating the application in highly resistance stem rot plant.

6. application according to claim 5, it is characterised in that:

The stem rot is corn stalk rot disease；

Or the pathogen of the stem rot is Fusarium graminearum；

Or the plant is dicotyledon or monocotyledon；

Or the plant is monocotyledon, the monocotyledon is specially corn.

7. a kind of method for cultivating highly resistance stem rot genetically modified plants, includes the following steps:

The expression quantity and/or activity for encoding the DNA molecular of albumen Zm-Remorin in purpose plant are improved, transgenosis plant is obtained Object,

The albumen Zm-Remorin is following (1) or (2):

8. according to the method described in claim 7, it is characterized by:

The expression quantity and/or activity that the DNA molecular of albumen Zm-Remorin is encoded in the raising purpose plant are by the volume The DNA molecular of code albumen Zm-Remorin imports purpose plant.

9. method according to claim 7 or 8, it is characterised in that:

The stem rot is corn stalk rot disease；

Or the pathogen of the stem rot is Fusarium graminearum.

10. according to the method described in claim 9, it is characterized by:

The plant is dicotyledon or monocotyledon.