CN102796745A

CN102796745A - Method for quickly identifying manihot esculenta mildew-resistance locus (MLO) gene by applying comparative genomics

Info

Publication number: CN102796745A
Application number: CN2012100950274A
Authority: CN
Inventors: 钱孝英
Original assignee: CHANGSHU ZHITANG TOWN XINSHENG TECHNICAL CONSULTATION SERVICE CO LTD
Current assignee: CHANGSHU ZHITANG TOWN XINSHENG TECHNICAL CONSULTATION SERVICE CO LTD
Priority date: 2012-03-31
Filing date: 2012-03-31
Publication date: 2012-11-28

Abstract

The invention discloses a method for quickly identifying a manihot esculenta mildew-resistance locus (MLO) gene, relates to knowledge of plant comparative genomics, genetics, bioinformatics and the like and belongs to the field of plant biotechnology science. The method mainly comprises the following steps of: 1) downloading a manihot esculenta whole genome sequence, and collecting the MLO gene; 2) identifying the MLO gene; 3) identifying the MLO gene according to the MLO gene phylogenetic relationship; and 4) comparing the MLO genes. By the method, the discovery cycle of the manihot esculenta MLO gene is shortened effectively, and the MLO gene can be quickly identified; corresponding coseparation functional markers (single nucleotide polymorphism (SNP) and specific combining ability (SCA)) can be developed by the identified candidate MLO gene, and the method can be quickly used for molecular marker auxiliary selection of the MLO gene, and is high in accuracy; by combining other disease-resistant gene molecular markers, multiresistance breeding materials can be prepared, the breeding cycle is shortened, and the breeding efficiency is improved; and the foundation is laid for elaborating a manihot esculenta MLO gene molecular mechanism.

Description

Utilization comparative genomics Rapid identification cassava powdery mildew gene

Technical field

The present invention is by means of cassava order-checking whole genome sequence; Utilize method Rapid identification cassava powdery mildew genes such as plant comparative genomics, genetics, information biology and candidate gene strategy, be mainly concerned with the download of cassava whole genome sequence, the evaluation of candidate gene; The comparison of gene; Means such as cluster, and then identify powdery mildew gene, belong to the Plant Biotechnology scientific domain.

Background technology

Cassava is the shrub shape perennial plant of Euphorbiaceae cassava, originates in american torrid zone, and widely cultivate torrid areas, the whole world.Its piece root is edible, can grind Tapioca Starch, make bread, provides tapioca(flour) and wash and starch with starch and even beverage.About 160 kinds of cassava is the happiness sunlight plant that originates in America, the what torrid zone.The rubber cassava (M. glaziovii) of Brazil northeast can produce Sai Ala (Ceara) rubber.The crust rice of glutinous mush in West Africa (gelatinous fufu) and Jamaica is stuck with paste (bami mush) and is made by cassava.Cassava flexibility is strong, and is drought-enduring anti-lean.In year-round average temperature more than 18 ℃, frostless season the area more than 8 months, mountain region, Plain all can be planted; Be suitable for most about 27 ℃ of year-round average temperatures, 6～7 ℃ of the per day temperature difference, annual rainfall 1000～2000mm and being evenly distributed, pH6.0～7.5, sunny, soil layer is deep, the growth of well-drained soil.

The disease of cassava comprises the multiple diseases that is caused by fungi, bacterium and virus.Powdery Mildew is to be caused by obligate live body parasitical fungi, in land for growing field crops and protection ground, greenhouse cassava cultivation and production, extensively takes place, and spraying fungicide is this sick main method of defence with the plantation disease-resistant variety.But the life-time service sterilant can endanger environmental safety, and is prone to cause that the variation of germ microspecies produces antagonistic action.The popularizing planting disease-resistant variety is safety, environmental protection and control strategy efficiently.In the conventional breeding practice, be very difficult for the mildew-resistance material chosen: the one side seed selection cycle is long, needs the experience hybridization and the select procedure of complicacy of backcrossing; The combined influence that receives several factors of Powdery Mildew on the other hand, for example: temperature, humidity and germ microspecies etc., identify that the process of resistant material is not easy control.Therefore, excavate the process that powdery mildew gene can be accelerated the seed selection resistant variety.But China's cassava Powdery Mildew research data is less, and work lags behind, and this has hindered the work paces of clone cassava disease-resistant gene virtually.

MLO type disease-resistant gene is one type of special disease-resistant gene of plant.The mankind find that the earliest the MLO resistance starts from 1937-1938, and the fritz has gathered the barley of a lot of kinds in Ethiopia, two strains systems wherein to the white powder germ ( Biumeriograminisfs P.hordei, Bgh) physiological strains that all oneself know all have efficient resistance.Further research shows, the recessive mutation mlo of barley MLO gene can make barley that the physiological strain of nearly all oneself knowledge barley powdery mildew bacteria is produced resistance lasting, wide spectrum.Recently, the investigator finds that the powdery mildew gene of a lot of plants all is the control of MLO type disease-resistant gene, like tomato, and pea, Arabidopis thaliana, rose, capsicum, Root or stem of Littleleaf Indianmulberry or the like.Therefore breeding has important effect to the plant mildew-resistance to excavate MLO type disease-resistant gene in the plant.

At present, the disease-resistant gene method commonly used of excavating commonly used has map based cloning, methods such as transposon tagging.But because the fundamental research of cassava is not deep enough, not only the time is long but also very difficult these genes of cloning exactly therefore to utilize these methods.Therefore, how the MLO type disease-resistant gene in the Rapid identification cassava will become the important prerequisite of cassava mildew-resistance breeding.

Plant comparative genomics (Comparative Genomics) is based on Genome Atlas and the order-checking basis, and known gene and genome structure are compared, and understands the subject of function, expression mechanism and the spore of gene.Utilize between model plant genome and other Plant Genome on the coded sequence and structural homology, clone's other plant gene discloses gene function and molecular mechanism, illustrates spore relation and genomic immanent structure.Method that this patent adopted and thinking: the research of model plant arabidopsis gene group has disclosed the function of MLO type gene; Utilize the homology clone cassava MLO type disease-resistant gene on its order of gene; According to the characteristics of meliority on the model plant Arabidopis thaliana experimental system and known MLO type disease-resistant gene, quick " seizure " cassava mildew-resistance gene.In recent years, the completion of cassava gene order-checking provides condition for our fast mining cassava powdery mildew gene.It is prerequisite that this patent has been introduced with the cassava whole genome sequence, in conjunction with knowledge such as comparative genomics, genetics, genomics, information biology and candidate gene strategy, fast mining powdery mildew gene.

Summary of the invention

Technical problem

The purpose of this invention is to provide a kind of through combining knowledge such as plant comparative genomics, plant genetics, genomics and information biology, fast mining cassava mildew-resistance gene.Its result can be used for the exploitation of cassava powdery mildew gene compact linkage molecule mark on the one hand, carries out the molecular marker assisted selection breeding, also for other crop powdery mildew gene identification reference frame is provided on the other hand.

Technical scheme

Cardinal principle: first plant mildew-resistance gene (MLO) is cloned from barley, discovers that this gene is one type of special disease-resistant gene, is different from most of NBS (nucleotide-binding site) type disease-resistant gene of previous clone; Subsequently, the investigator has cloned powdery mildew gene in succession from plants such as tomato, Arabidopis thaliana, pea, capsicum, Root or stem of Littleleaf Indianmulberry, and what discover these genes encodings all is MLO type disease-resistant gene.Subsequently, numerous investigators confirm that through test of many times MLO type disease-resistant gene has become one type of mildew-resistance gene of plant specific.Find that further plant MLO type gene is a gene family; And the MLO gene family that derives from different plant species is carried out the Phylogenetic Relationships analysis finds, in the different plant species mildew-resistance gene always cluster become one type together, this type MLO gene all has the characteristic feature of mildew-resistance gene sequence.The completion of cassava gene order-checking provides a convenient for excavating powdery mildew gene.Therefore, can identify the cassava powdery mildew gene by means of the Phylogenetic Relationships of MLO gene family in the full genome of the cassava of having checked order and the MLO powdery mildew gene of having cloned and for the amino acid conservative property of keeping powdery mildew gene MLO critical function.

Key step is following:

1) collection of the download of cassava whole genome sequence and MLO type gene thereof

At first download the cassava whole genome sequence from cassava sequenced genes group DB (http://www.phytozome.net/search.php); Use " DNATOOLS " software that the full genome amino acid sequence data of cassava that obtains is set up DB; Use pfam DB (protein family DB then; Http:// pfam.janelia.org/search/sequence) hidden Markov model in (HMM) carries out Blastp (E-value=0.001) sequence alignment to the aminoacid sequence of MLO structural domain with the full genome amino acid sequence database of having set up of cassava, and preliminary screening goes out candidate gene sequence.Secondly, utilize the MLO type gene order of having announced, the cassava genome database is carried out the BLAST comparison, obtain candidate gene sequence.

2) evaluation of cassava MLO type gene family

With the candidate gene of the homologous nucleotide sequence that obtains in the The above results, analyze through Pfam (E-value=1.0), remove the gene order (Fig. 1) of not having ' MLO ' structural domain.The ClustalW instrument that again candidate's disease-resistant gene sequence is provided through MEGA3.1 software (multisequencing comparison program) carries out the multisequencing comparison, removes Tumor-necrosis factor glycoproteins.

3) Phylogenetic Relationships through plant MLO type gene is identified candidate's cassava MLO type powdery mildew gene

Because previous research is verified; Dicotyledons MLO type powdery mildew gene is positioned at the same district of plant MLO Phylogenetic Tree group; Therefore in Phylogenetic Relationships research; We are MLO type mildew-resistance gene and the cluster analysis together of cassava MLO type gene of the MLO type gene family of Arabidopis thaliana and some other crops, to obtain candidate's cassava mildew-resistance gene (Fig. 2).

4) comparison of cassava powdery mildew gene and known plant MLO powdery mildew gene

Utilize BioXM 2.6 softwares the aminoacid sequence of the MLO powdery mildew gene of cassava candidate's MLO type powdery mildew gene and Arabidopis thaliana, tomato, pea, barley to be converted to the file of Fasta form; These files are imported BioEdit 7.0 softwares; Use in this software Clustal software to carry out the multisequencing comparison, disclose the conservative property in candidate's powdery mildew gene important amino acid residue and zone.Thereby further identify cassava candidate's powdery mildew gene (Fig. 3).

Positively effect of the present invention:

1) shortens the cassava powdery mildew gene and excavated the cycle, helped the Rapid identification of powdery mildew gene.Employing ordinary method (map based cloning, transposon tagging etc.) excavation mildew-resistance gene not only takes time and effort, efficient is low, and is difficult to successfully.The present invention is based on plant comparative genomics, genetics, bioinformatics method fast mining cassava powdery mildew gene, not only can shorten the time, can also improve powdery mildew gene and identify efficient.

2) cassava ( Manihot esculenta) be one of important cash crop in the whole world.Because the cassava hereditary basis is narrow, the germ plasm resource variety is low, therefore identifies relatively difficulty of cassava powdery mildew gene through conventional molecule marker (RAPD, ISSR, SSR, AFLP etc.).The candidate's powdery mildew gene exploitation that is tested and appraised is divided into from functional mark (SNP, SCAR etc.) accordingly, can be used for the molecular marker assisted selection of disease-resistant gene fast, and accuracy is high.

3) initiative of multiresistance breeding material.Based on the functional molecular marker of the powdery mildew gene of new evaluation exploitation, combine the molecule marker of localized other disease-resistant genes, carry out the initiative of multiresistance breeding material, can shortening the breeding cycle, the raising breeding efficiency.

4) lay a good foundation for setting forth cassava mildew-resistance molecular mechanism.The evaluation of cassava mildew-resistance gene; Gene silencing (virus induced gene silencing through transgenic technology, RNAi, virus induction; VIGS) molecular mechanism of research mildew-resistance such as technology provides genetic resources, helps setting forth fast the mechanism of action of cassava mildew-resistance.

Description of drawings

The evaluation of Fig. 1 cassava MLO gene;

That this figure shows is 20 MLO type gene identification results, and each gene all contains ' MLO ' conserved domain.

The evaluation of the Phylogenetic Relationships analysis of Fig. 2 plant MLO gene family and cassava MLO type powdery mildew gene thereof;

Arabidopis thaliana is the model plant of plant science research; Grow in the tree at constructing system; The powdery mildew gene (PsMLO) of 15 MLO type genes of Arabidopis thaliana (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12), tomato mildew-resistance gene (SlMLO), barley powdery mildew gene (HvMLO and HvMLO02) and pea is selected and is used for and the cluster analysis of cassava MLO type gene.Identify 4 cassava candidates' MLO type powdery mildew gene altogether.The gene of italic mark is exactly a candidate cassava powdery mildew gene among the figure.

The compare of analysis of Fig. 3 cassava MLO type powdery mildew gene;

4 cassava powdery mildew genes and barley (HvMLO), tomato (SlMLO), pea (PsMLO), Arabidopis thaliana powdery mildew gene (AtMLO02; AtMLO06 and AtMLO12) compare, identify that powdery mildew infects the amino-acid residue and regional conservative type that plays an important role.TM1-TM7 representes 7 revolving die zones of cassava MLO type powdery mildew gene among the figure; The black round dot representes that powdery mildew infects important amino-acid residue; CaMBD representes the calmodulin land; I and II represent powdery mildew is infected important amino acid region.

Embodiment

The evaluation of disease-resistant gene has important effect in research of crop disease-resistant theory of heredity and disease-resistant variety seed selection.Present method can Rapid identification go out the cassava powdery mildew gene.The practical implementation process is following:

1) collection and the evaluation of cassava MLO type gene

In order to obtain the whole MLO type gene family member of cassava; We are at first with the MLO type gene of Arabidopis thaliana; The mildew-resistance MLO gene order of tomato, pea, rose, capsicum, Root or stem of Littleleaf Indianmulberry makes up the HMM model, from the cassava genome sequence, receives rope MLO type gene; Secondly with the MLO gene order delivered in the Different Crop as target sequence (from DFCI DB: TC171015, TC267529, DFCI:TC327983, TC289653, TC312087, TC132500; TC133436, TC317623, TC317025, TC315947, TC325903, TC315944; TC315912, TC322759, TC322059, TC330654, TC282713, TC293173; TC281861, TC283253, TC283383, TC285032, TC290021, TC302716; TC283487, TC282866, TC283441, TC281428, TC285118, TC285090; From GenBank DB: AY967408, AF384145, AF384144; AY029312-AY029315, AY029317-AY029319, Z95352; AF369563-AF369565, AF369567, AF369569-AF369576; Z83834, Z95496, AY581255); Cassava DB (http://www.phytozome.net/search.php) is carried out the BLAST comparison, select the highest sequence of similarity to download, obtained 20 candidates' MLO type gene (cassava4.1_004402m.g altogether; Cassava4.1_029705m.g; Cassava4.1_033658m.g; Cassava4.1_022918m.g; Cassava4.1_025431m.g; Cassava4.1_007579m.g; Cassava4.1_033401m.g; Cassava4.1_023541m.g; Cassava4.1_013598m.g; Cassava4.1_004793m.g; Cassava4.1_030963m.g; Cassava4.1_031151m.g; Cassava4.1_004823m.g; Cassava4.1_031835m.g; Cassava4.1_028675m.g; Cassava4.1_033120m.g; Cassava4.1_004507m.g; Cassava4.1_005640m.g; Cassava4.1_004964m.g; Cassava4.1_004283m.g; ).

2) evaluation of cassava MLO type gene family

In order further to verify these MLO gene accuracys, we carry out the evaluation of conserved domain " MLO " to these 20 candidates' MLO gene.Aminoacid sequence with each candidate's MLO type gene is a benchmark, on PFAM (http://pfam.sanger.ac.uk/) website, carries out the evaluation of ' MLO ' conserved domain, and concrete outcome is seen Fig. 1.

3) the Phylogenetic Relationships analysis of cassava MLO type gene

In the research formerly, find that the dicotyledons powdery mildew gene aggregates into district's group; Therefore; Grow in the tree at constructing system; We have selected the powdery mildew gene and the cassava MLO type gene cluster analysis cluster analysis together of 15 MLO type genes (wherein 3 genes are powdery mildew genes: AtMLO02, AtMLO06 and AtMLO12), tomato mildew-resistance gene, barley powdery mildew gene and the pea of model plant Arabidopis thaliana.Cassava MLO type gene and other crop powdery mildew gene protein sequences are carried out the multisequencing couplet join (adopting Clustal X 1.83 softwares to carry out), and utilize Genedoc software (http://www.nrbsc.org/gfx/genedoc/index.html) to show that multisequencing joins the result who joins.The Clustal multisequencing is joined the result who joins output in MEGA 4.0 softwares, and (neighbor-joining NJ), utilizes the Bootstrapping method that these evolutionary trees are assessed to utilize this software to make up the adjacency tree respectively.The result finds in dicotyledons mildew-resistance gene district group, to have 4 cassava candidates' MLO type powdery mildew gene (see figure 2).

4) comparison of cassava MLO type disease-resistant gene

In the research of barley MLO type powdery mildew gene, found some important areas and single amino acids in the research in succession, they infect big wheat powdery mildew has irreplaceable effect.In the cassava powdery mildew gene of identifying 4 candidates; Whether these important areas and amino acid high conservative, and we have carried out compare of analysis to 3 mildew-resistance genes (AtMLO02, AtMLO6 and AtMLO12), tomato powdery mildew gene (SlMLO), the powdery mildew of pea gene (PsMLO) from Arabidopis thaliana.4 candidates' of discovery cassava powdery mildew gene and 7 of known MLO type powdery mildew genes are striden the film district, 30 important amino acid, 1 calmodulin land (CaMBD) and two important zone (I and II) high conservatives (Fig. 3).

Claims

1. cassava mildew-resistance gene is characterized in that being selected from one of following 4 genes or its:

1)cassava4.1_023541m.g

Amino acid:

MAGGGGGRSLEETPTWAVAIVCFVLVLISIIIEYIIHLIGKWLKKKHKRALYEALEKIKSELMLLGFISLLLTVGQGLISNICIPEKVGSTWHPCSKKEEEKLNNSPSTDDDDETRRKLLSISDSGGSFRRVLAGSATTDKCGEGKVPFVSSDGIHQLHIFIFVLAVFHVLYSFLTMALGRAKMRRWKSWEKETRTIEYQFSHDPERFRFARETSFGRRHLSFWTKTPVLIWVVCFFRQFVRSVPKVDYLTLRHGFIMAHLAPQSHMKFNFQKYINRSLEEDFKVVVGISPPIWFFAVLFLLFNTHGWYSYLWLPFIPLIIILLVGTKLQVIITKMAIRIQERGEVVKGVPVVQPGDHLFWFNRPSLLLYLINFVLFQNAFQLAFFAWSWKEFGIKSCFHEHLEDIIIRISMGVLIQILCSYVTLPLYALVTQMGSSMKPTIFNERVAAALRNWHQTAKKQIKRNKGSITPMSSKPTTPSHHISPVHLLRYYQNDIHNLQDSPRRSNFGWETDSPSPSHPNYGEGSSSSHYLNRGDDSISHHYSFQQQQIELNNIESDRNVNEPSSSQVASISEHEISVVPKEFSFDRRTSV

Nucleotide:

ATGGCTGGCGGTGGCGGAGGAAGATCTCTGGAGGAGACGCCAACCTGGGCAGTCGCCATAGTTTGTTTTGTTTTAGTTTTGATTTCAATAATCATCGAATACATCATCCATCTTATAGGAAAGTGGTTAAAGAAGAAACACAAGAGAGCTCTTTATGAAGCACTTGAAAAGATCAAATCAGAGCTTATGTTGTTAGGTTTTATTTCCTTGCTTCTAACAGTAGGACAAGGTCTGATTTCAAATATATGCATACCAGAAAAAGTTGGATCAACCTGGCATCCATGCAGCAAGAAGGAAGAAGAGAAACTAAACAACTCCCCATCAACAGATGATGATGATGAAACCAGAAGAAAACTTCTCAGCATATCGGACTCCGGTGGAAGTTTCCGGCGTGTCTTGGCTGGCTCGGCAACAACAGACAAATGTGGTGAGGGTAAAGTTCCATTTGTGTCGTCAGATGGGATTCATCAACTCCATATTTTCATATTCGTGCTCGCAGTTTTTCATGTGCTTTACAGTTTCCTCACAATGGCTTTGGGCAGAGCCAAGATGAGGCGTTGGAAATCTTGGGAGAAGGAAACAAGAACTATTGAATACCAGTTTTCACACGATCCGGAAAGGTTCAGGTTTGCAAGAGAAACATCATTTGGAAGGAGACACTTGAGCTTTTGGACAAAGACACCTGTCCTTATTTGGGTTGTTTGCTTCTTTAGGCAATTTGTGAGGTCGGTTCCTAAAGTTGACTATTTAACATTGAGACATGGTTTTATCATGGCACATTTGGCACCTCAAAGCCACATGAAATTTAATTTCCAAAAATATATTAATAGGTCATTAGAAGAGGATTTCAAGGTTGTTGTTGGAATAAGCCCACCAATTTGGTTCTTCGCAGTTCTATTCTTACTCTTTAACACTCATGGGTGGTATTCTTATCTATGGCTTCCATTTATTCCACTTATAATCATCCTGTTGGTGGGGACAAAGCTACAGGTGATAATAACCAAAATGGCGATCAGAATTCAAGAGAGAGGTGAGGTAGTGAAGGGTGTGCCTGTGGTTCAGCCTGGAGATCACCTCTTCTGGTTCAACCGTCCAAGCCTTCTTCTTTATCTTATCAATTTTGTTCTCTTTCAGAATGCCTTCCAGCTTGCTTTTTTTGCATGGAGTTGGAAAGAATTTGGCATAAAATCTTGTTTCCATGAACATTTGGAGGATATAATCATCAGAATTTCAATGGGGGTACTTATACAAATACTTTGCAGCTATGTCACTCTCCCTCTCTATGCCCTTGTCACACAGATGGGTTCATCAATGAAGCCAACAATTTTCAACGAAAGAGTAGCTGCAGCGCTAAGAAACTGGCATCAAACGGCTAAAAAACAAATCAAAAGAAATAAGGGGTCCATCACCCCTATGTCTAGTAAACCAACCACACCATCCCACCATATATCGCCAGTGCACCTTCTCCGATATTACCAAAACGACATTCACAATCTTCAAGATTCTCCTAGAAGATCAAATTTCGGTTGGGAAACAGACTCTCCATCTCCTTCTCATCCTAATTATGGTGAAGGTTCATCGTCCTCACATTATCTGAATCGCGGTGACGATTCAATATCCCATCACTATTCCTTTCAGCAACAACAAATAGAGTTAAATAATATAGAATCCGATAGAAATGTAAATGAACCAAGTTCGAGTCAAGTGGCATCGATCTCAGAACATGAAATTAGTGTAGTGCCAAAGGAGTTTTCATTTGATAGAAGAACAAGTGTTTAA

2)cassava4.1_030963m.g

Amino acid:

MAGGGGGRSLEKTSTWAVAIVCFVLVLISLIIEYIIHLIGKWLKKKQKGALYEALEKIKSELMLLGFISLLLTIGQSPISNICISEKVGSTWHPCSKKKEVNINKVELPAREDENRRKLLKVSDSGGSLRRLLAGGTTDNCGTGKVPFVSSDGIHQLHIFIFVLAVFHVLYCVITMALGRAKMRRWKSWEMETGTAEYQFSHDPERFRFARETSFGRRHLSFPTKAPLLIWIVCFSRQFVRSVPKVDYLTLRHGFIMAHLAPQSHQKFNFQKYINRSLEEDFKVVVGISAPIWLFAIIFLLFNTHGWYTYLWLPFIPLIIILLVGTKLQVIITQMALRIQERGEVVKGVPVVQPGDDLFWFNRPRLILYLINFVLFQNAFQLAFFAWSWKEFGLRSCFHEHLEDIIIRVSMGILVQILCSYVTLPLYALVTQMGSSMKPTIFNERVAAALRKWHQAAKKHIKRKKGPVSITPISSKPATPLHHYMSPLHLLKYYQNEMDSLQNSPKKSNLIRWKSDTPSPSYTNYQGNDSSSTYHPNSGDGSSSQHHHQLQRVELSYGIEYEKKGNNEASSSEVRPISQHENDVEPKEFSFDRRASV

Nucleotide:

ATGGCCGGTGGTGGAGGTGGAAGATCTCTGGAGAAAACGTCAACTTGGGCAGTAGCCATAGTTTGTTTTGTTTTGGTTTTGATTTCATTAATCATCGAATACATTATTCATCTTATTGGAAAGTGGTTAAAGAAGAAACAAAAGGGAGCTCTTTATGAAGCACTTGAAAAGATCAAGTCAGAGCTTATGCTATTAGGGTTTATATCCTTGCTTCTAACGATAGGACAAAGTCCAATATCAAACATATGCATATCAGAAAAAGTTGGATCTACTTGGCATCCATGCAGCAAGAAGAAAGAAGTGAATATAAACAAGGTTGAATTACCAGCAAGAGAAGATGAGAATCGCAGGAAACTTCTAAAGGTATCAGATTCCGGTGGAAGTCTCCGACGTTTATTGGCTGGGGGAACCACCGACAATTGTGGCACGGGTAAAGTCCCGTTTGTGTCGTCAGATGGCATTCATCAACTCCACATTTTCATATTCGTATTAGCGGTTTTTCATGTGCTTTACTGTGTCATCACCATGGCTTTGGGCAGAGCCAAGATGAGACGGTGGAAATCTTGGGAAATGGAAACAGGAACAGCCGAGTACCAGTTCTCTCACGATCCAGAAAGGTTCAGATTTGCGAGAGAAACATCATTTGGGAGGAGACACTTGAGCTTTCCGACCAAGGCACCACTCCTTATATGGATTGTTTGCTTCTCTAGGCAATTTGTAAGATCGGTTCCTAAAGTTGACTATTTGACCTTGAGACATGGTTTTATCATGGCACATTTGGCACCTCAAAGCCACCAGAAATTTAATTTCCAAAAATATATTAATAGGTCATTGGAAGAAGATTTCAAAGTCGTTGTGGGAATAAGTGCACCAATTTGGCTTTTCGCGATTATATTCTTACTCTTCAACACTCATGGGTGGTATACTTATCTATGGCTTCCATTTATTCCACTGATTATCATCCTTTTGGTGGGGACGAAGCTACAGGTAATAATAACCCAAATGGCACTTAGAATTCAAGAGAGAGGAGAAGTAGTGAAGGGAGTGCCTGTGGTTCAGCCTGGAGATGATCTCTTCTGGTTCAACCGTCCTCGCCTTATTCTTTACCTTATCAATTTTGTCCTCTTTCAGAATGCCTTCCAGCTTGCGTTCTTTGCATGGAGTTGGAAAGAATTTGGGCTAAGATCTTGTTTCCATGAACATTTGGAGGACATAATCATCAGAGTTTCAATGGGGATCCTTGTACAAATACTCTGCAGCTATGTTACTCTCCCTCTGTATGCCCTAGTAACTCAGATGGGCTCATCGATGAAACCAACCATCTTTAACGAGAGAGTAGCTGCAGCTCTAAGAAAATGGCACCAAGCGGCTAAAAAACACATTAAACGAAAGAAGGGACCTGTCTCTATCACCCCCATATCTAGCAAACCAGCCACACCATTGCATCACTATATGTCTCCGTTGCACCTACTTAAATACTATCAAAATGAAATGGATAGTCTCCAGAATTCTCCTAAAAAATCAAATTTAATTAGATGGAAAAGCGATACTCCGTCACCTTCTTACACTAACTATCAAGGCAATGATTCATCATCGACCTATCATCCTAATTCTGGCGATGGATCATCTTCACAACACCACCACCAACTGCAACGGGTTGAACTAAGTTATGGAATAGAGTATGAAAAGAAAGGCAATAATGAGGCAAGTTCAAGTGAAGTGAGACCAATTTCACAACATGAAAATGATGTAGAGCCAAAGGAATTTTCATTTGATAGAAGAGCAAGTGTTTAA

3)cassava4.1_004402m.g

Amino acid:

MSDTSKARSLEETPTWAVAVVCFVMIVISILIEHVIHMIEKWFKKIHKPALVEALEKIKAELMLMGFISLLLTALQDPISEICISQSVASTWHPCKSQKESKTETDSTDNRRRLLQFLDAGGSTRRYLAGKSEDKCAENGKVAFVSAYGIDQLHYFIFVLAVVHVLYCIITYILGRTKMRKWKAWERETKTLEYQYHNDPERFRFARDTSFGRRHLNLWSRSTVFVWIVCFFRQFFGSVTKIDYLTLRHGFIMAHLAPGSETRFDFQKYINRSLEDDFKVVVGISPVIWFIACLLLLTSTHGWYAYLWLPFIPLIIILVVGAKLQVIITQLGLRIQERGDVVKGAPVVQPGDDLFWFGRPRFILFLIHLVLFQNAFQLAFFAWSVWKIGTDSCYHDRTEDIVIKITMGVIIQFLCSYVTLPLYALVTQMGSSMRSTVFNDRVAAALKNWHQAAKKHAKHSKHSASQTPMSSRPATPTHGMSPIHLLHNYRSSTAPNSLQASPRNHNYNVDNWDPEALSSVHNQEADELEHIESPDIRDHDIEVEEQNSNSIMQLPPAPGSIRTQHELGVSLREFTFRK

Nucleotide:

ATGTCTGATACCAGTAAAGCACGCTCTCTTGAAGAAACGCCTACATGGGCTGTTGCTGTGGTGTGCTTTGTGATGATTGTTATTTCAATCTTGATTGAGCATGTGATTCATATGATAGAAAAGTGGTTTAAGAAGATACATAAGCCAGCTCTTGTGGAAGCTCTTGAAAAGATTAAAGCAGAGCTGATGCTTATGGGATTTATATCCTTGCTTCTAACTGCTCTACAAGATCCCATCTCTGAAATTTGCATTTCACAGAGTGTTGCATCCACCTGGCATCCTTGCAAGAGTCAGAAAGAAAGCAAGACAGAAACAGATTCTACTGATAATCGTCGAAGACTTCTTCAGTTCTTAGATGCTGGAGGAAGCACTAGACGTTATTTAGCAGGCAAATCTGAAGATAAATGTGCAGAAAATGGTAAAGTTGCCTTTGTATCAGCATATGGAATTGATCAGCTCCATTATTTCATCTTTGTGCTAGCAGTTGTCCATGTGCTTTACTGCATAATTACATATATTTTGGGTAGAACAAAGATGAGAAAGTGGAAGGCATGGGAGAGAGAGACAAAGACACTTGAGTACCAATACCATAATGATCCAGAGAGGTTCAGGTTTGCAAGGGATACATCATTTGGACGAAGACATCTGAATCTATGGAGTCGATCAACAGTTTTCGTTTGGATCGTTTGTTTCTTTAGACAATTCTTTGGATCAGTCACCAAAATTGATTACCTGACATTGAGACATGGATTTATCATGGCACATTTGGCCCCTGGAAGTGAAACAAGATTTGATTTCCAGAAATACATCAACAGATCACTTGAAGATGACTTTAAAGTTGTAGTGGGAATCAGTCCAGTTATTTGGTTTATTGCCTGTTTGTTGCTGCTGACCAGCACACATGGTTGGTATGCTTATCTATGGTTACCTTTCATCCCACTAATTATAATTTTGGTGGTTGGGGCTAAGCTGCAAGTGATCATAACTCAACTGGGGCTAAGGATTCAAGAGAGAGGAGATGTAGTTAAGGGTGCTCCTGTGGTTCAACCAGGAGATGACCTCTTCTGGTTCGGACGTCCACGCTTTATTCTCTTCCTTATTCACTTGGTTCTCTTTCAGAATGCATTTCAGCTGGCTTTCTTCGCGTGGAGCGTGTGGAAAATTGGAACTGACTCTTGTTACCATGATCGCACTGAGGATATTGTAATCAAAATCACAATGGGGGTCATCATACAGTTCCTTTGCAGTTATGTGACACTGCCTCTATATGCTCTAGTGACACAGATGGGTTCTAGCATGAGATCAACAGTCTTTAATGACAGAGTAGCAGCAGCACTGAAGAACTGGCACCAGGCAGCCAAAAAACATGCTAAACACAGCAAACATTCAGCGTCTCAAACACCAATGTCAAGCAGACCAGCAACTCCAACACACGGCATGTCGCCTATCCATCTCTTGCATAACTACCGTAGCAGCACTGCTCCTAACAGCTTACAGGCTTCTCCAAGAAACCATAACTATAATGTAGACAATTGGGACCCTGAAGCACTAAGTTCTGTACACAATCAGGAGGCTGATGAGCTTGAACACATTGAAAGTCCTGATATTAGGGATCATGATATAGAAGTTGAAGAGCAAAACTCAAACTCAATAATGCAATTGCCTCCAGCACCAGGTTCCATCCGTACACAACATGAACTTGGTGTCAGCTTAAGAGAGTTCACGTTCAGGAAATGA

4)cassava4.1_004823m.g

Amino acid:

MSDTSKERSLGETPTWAVAVVCLVMIAISIFIEKVIHFIEKWFKKIHKPALVEALEKIKEELMLMGFISLLLTVLQGPISGICVSESIASTWHPCNKKKGNSKTETDSSNNRRRLFQFLDSGASNRRVLAAKSGDKCADEGKVTLISAYGIDQLHYFIFVLAVFHVLYCIITYILGRTKMRKWKTWENETRTIEYQYHNDPERFRFARDTSFGKRHLKLWSRSTVFVWIVCFFRQFFGSVTKVDYLTLRHGFIMAHLPPGSETSFDFQKYINRSLEDDFKSVVGIRILTLIRVLCSPLIWFLACLMMLTSTNGWYAYLWLPFIPLVVILVIGAKLQVIITKMGLRIQERGDVVKGAPVVQLGDDLFWFGRPRLILFLIHLVLFQNAFQLAFFIWSVWKIGPDSCYHDRIEDIVIKVTMGVIIQVLCSYVTLPLYALVTQMGSSMRPTIFNDRVATALKNWHHTAKKHAKHSKHSESHTPMSSRTATPTYGMSPVHLLHNYRSSTAPDSLQNSPRNYNYDADNWDPEALNTMQNLESDDSSHDNEHPEVEDQIQSIQVEEPNSNSILQLPQGTQHETGSREFTFRN

Nucleotide:

ATGGAAAAAAAAAAGATTGATGAAGGCAAATCTTTGGCCATAACCCCTACATGGGCTTTGGCTACAGTTGTCACTGTTATGGTTTGTTTTGGTTTCTTCTTCCAAGTCCTTTTAGATCAGTTTGGAAAGTGGTTGGATAAGACTAAGAGGAAAGCGCTACTTTCAGCTCTGGAAAAGATCAAAGATGAGCTAATGCTTTTTGGGCTTCTGTCGTTGTTGATGGGTCATTGGGTTGTAATGGTGGCCAAGATTTGTGTCAAAACATCTACGGTGAGCAGCAGATTTTTCCCATGTGCAGTATATGATAATCTAAAACCAGAAGAAGGCAGGTTTGATTCAGCTTCAGGTTATGCAAATCATTCCTCTGATAGACAGGAGACGTACACACTGGTGCATGGACATGATAATTGCCCTGAGGGTCGCGAGTCTTTTGCTTCACAAGAAAGTCTAGAGCAGCTTCACCGTTTGATGTTTGTCCTAGGCGTTATCCATGTCTTGTATAGCTTTATTGCCATTGCCCTGGCAATGATTAAGATTTATAGCTGGAAAATTTGGGAACAACAAGCTAGGAAAATGGCGATTCAGTGCGCTCCTGGTTCTTCTCAAGCTGCATTGTTTAATAGAAGACTCTCTCGATTAACTACTTTCATTTCCAACCGTACATCCCATCCATGGAGCCGGCACAGCGTTCTTGTTTGGCTGCTCTGCTTCAGCCGCCAATTCTGGAGCTCTATAAACTATGCTGATTACATGGCTTTGCGTTACGGATTTGTCAATACACATGAACTTCCCTTGACTTATGATTTCCATAATTTTATGCTTCGAAGCATGGAGGAAGAATTTCGTGATGTTGTTGGCATTAGCTTGCCTCTCTGGATATATGCTATATGTTGCATTTTTCTGGATTTCCATGAAACTAAAATTTACTTTTGGATCTCCTTTCTTCCGGCCATTTTAATACTGCTAATTGGTACAAAACTTCACCGGGTAGTGGTCAAGTTGGCTGTTGAAATTTTAGATGCAGCTCCAAGGATGGGAAATCATCAGTTAAACCTGAGGGATGAGCTTTTTTGGTTTGGGAAGCCTAAACTTCTTTTGTGGTTAATTCAATTAATATCATTTCAAAATTCGTTCGAGATGGCAGCATTTGTATGGTCCCTGTGGGAGATCAGAGATTCTTCTTGTTTCATGAGTAATGAACTGTTTGCTATAATCCGGTTGATATTCGGGGTAGTCACACAGTTCTGGTGCAGCTTCATTACACTCCCACTCTATATAATCATCACACAGATGGATGCAAGGTTCAAGAAAGCTGTAGTATCTGAAAATGTAAGGCAATCTCTACATGGATGGAAAAGGAGAGTGAGGGCCAGGAATAGTTCCTCTTCTCTACACCACACTGGTGCATCATCTAAGTCCTCACTTAGTTCCACTTCTGCACACCTGAAAGGTTTATTATTCAGTTCCTCAAGTTCTGGCAAGCATAAGAACAAAAACAATGATTCTGCCTCGAGCAGCAGGCAAGGAAACAACACATCAGAAGTTCCAGATACACCAATCTCAAGTCAAGAGGCCTGTAATCCACAAGCTAATAAAAATTTTCCTGGGAATGAGCTTGATGATGGTAATGATAACGATCACAGACACAGAAATATCAGAAAGGGATAA。

2. the application of the said Rapid identification cassava of claim 1 powdery mildew gene comprises:

1) initiative of breeding material.

3.2) breeding practice of mildew-resistance.

4.3) mildew-resistance fundamental research.