CN102630616A - Method for improving ratio of female fish in cynoglossus semilaevis cultured fingerlings - Google Patents

Abstract

The invention relates to a method for improving the ratio of female fish in cynoglossus semilaevis cultured fingerlings. The method comprises the following steps of: 1) screening male parent fish; 2) performing artificial propagation and family establishment; 3) cultivating fish fries with different families and detecting the ratio of male and female fish; and 4) cultivating a high-female and fast-growing family and propagating, wherein a genetic marker used in the step 1) is SChen-SSR2. According to the invention, a method for identifying cynoglossus semilaevis genetic female fish and genetic male fish is established by the SChen-SSR2 marker, and then a method for improving the ratio of female fish in cynoglossus semilaevis cultured fingerlings is established by breeding generations from the high-quality normal male fish or establishing a cynoglossus family with a high female ratio bred by the families. The method provided by the invention can be used for solving the most common problems of too high ratio of male fish and too low ratio of physiological female fish in the cultured populations, and thus the method is of great importance in the scale production and cultivation of high-quality cynoglossus semilaevis fingerlings, the improvement of cultivation yield and economic benefit, and the promotion of continuous and rapid development of the cynoglossus semilaevis cultivation industry.

Description

Improve the method for cynoglossus semilaevis cultivation seed raun ratio

Technical field

The invention belongs to the sex controlling technical field in the marine fish culture, be specifically related to a kind of method that improves cynoglossus semilaevis cultivation seed raun ratio.

Background technology

Cynoglossus semilaevis (Cynoglossus semiliaevis) is the distinctive a kind of famous and precious economic seawater fish of China, belongs to coastal waters warm water property demersal fishes, and China is coastal all to have distribution, is many with the Huanghai Sea, the Bohai Sea.Cynoglossus semilaevis is welcome by consumers in general deeply owing to its delicious flavour, fine and tender taste, nutritious, its market value is high, and the breed prospect is boundless.As one of principal item of China's marine fish culture, Cynoglossus semilaevis year cultured output reach more than 10,000 ton at present, calculate by average 120 yuan/500 grams of the market price, the annual at present output value of cynoglossus semilaevis cultivation industry reaches more than 2,400,000,000 yuan.

In view of the breed potentiality of Cynoglossus semilaevis and potential economic and social benefits; In recent years, China scientific worker has carried out big quantity research to Cynoglossus semilaevis genital regulating and natural spawning technology, and 2003-2007 mainly adopts the method for Artificial Control illumination and water temperature to stimulate the Cynoglossus semilaevis parent population ripe; And induce its natural spawning in indoor cement pit; Obtain Cynoglossus semilaevis fertilized egg, and produced semi-smooth tongue sole offspring breed (Liu Xuezhou etc., 2006).This Cynoglossus semilaevis seedling raising manners; Basically be with artificially controlling temperature, control light stimulus parent population maturation and in culturing the pond, carry out natural spawning and natural insemination that it is not too high to exist controllability, the parent population spawning rate is lower; The low deficiency that waits of fertilization rate is unfavorable for planned arranging production.Particularly this natural spawning mode can not obtain the unfertilized egg of Cynoglossus semilaevis, is not suitable for cynoglossus semilaevis gynogenesis and induces and family foundation, has influenced the process of semi-smooth tongue sole offspring breed propagation in scale and prevalent variety cultivation.Therefore; Experts and scholars have carried out Cynoglossus semilaevis artificial induced spawning Study on Technology subsequently, have set up the technology that makes parent population grow and ovulate synchronously through the injection hormone, can obtain unfertilized egg in a large number through the artificial induced spawning technology; Thereby be that important foundation (Yang Jingfeng has been established in the foundation of Cynoglossus semilaevis artificial gynogenesis and family; Chen Songlin etc., 2010), for Cynoglossus semilaevis scale breeding, sex controlling and prevalent variety cultivation provide technological means.

Cynoglossus semilaevis cultivation practice in recent years and research show that there are huge difference in Cynoglossus semilaevis female individuals and male on growth rate, and its female individuals than the big 3-4 of male doubly.After the Cynoglossus semilaevis fry was cultured through 1 year half, female individuals can be grown the 500-750 gram, and male then has only the 50-150 gram.Because it is slow that male was grown, influenced the quality of marketable fish, reduced the cultured output of Cynoglossus semilaevis, increase aquaculture cost, thereby had a strong impact on the popularization of semi-smooth tongue sole offspring breed and the development of aquaculture industry.Particularly nearest, research such as aspect mountain (2010) is illustrated in Cynoglossus semilaevis and propagates artificially and exist male pseudo-milter on female in a small amount of heredity, the physiology in the colony, and the growth rate of these pseudo-milters is starkly lower than raun.Simultaneously; Investigation shows, in some Cynoglossus semilaevis nursery and plant, Cynoglossus semilaevis propagates that the ratio of milter reaches 70-90% in the colony artificially; These milters are failed to grow up; And the ratio of the raun that can grow up is merely 10-30% (Chen Songlin etc.), has had a strong impact on raiser's enthusiasm, has influenced the development of industry.Therefore, the method for milter ratio, raising raun ratio is extremely important for the cultured output and the product quality that improve Cynoglossus semilaevis in the searching minimizing cultured population.If can with the physiology raun ratio in the cynoglossus semilaevis cultivation colony bring up to 50% or more than; Promptly on present breed level with cynoglossus semilaevis cultivation colony in the ratio of raun improve about 20%; After carrying out the large tracts of land popularization, will increase by the economic benefit of hundred million yuan of 2-4 every year.

Find out the high reason of physiology milter ratio in the common seed that Cynoglossus semilaevis propagates artificially; Must set up Cynoglossus semilaevis genetic sex and physiology sex authenticate technology; Find out the source of milter in the common seed of Cynoglossus semilaevis; And then take measures, reduce the quantity of male fry, improve the ratio of female fry.Therefore at first must screen the special molecular labeling of sex.The sex specific molecular marker is a very potential technological means of identifying sex.But only on a few fish, carried out about the research of fish sex linkage molecule mark and rapid identification method at present, screened the special dna fragmentation of chinook Y chromosome like the breadboard Devlin of Canadian West Vancouver (1994); Griffiths etc. (2000) have found two male special AFLP marks in three vertebra sticklebacks (Gasterosteus aculeatus L.).But, when being applied to other two kinds of sticklebacks, but can not correctly identify its sex.Rachael etc. (2003) have compared the Y linkage collection of illustrative plates of 4 kinds of salmons (arctic salmon, Atlantic salmon, brown trout and rainbow trout), in arctic salmon and rainbow trout, have found 2 and 6 AFLP marks that sex is chain respectively.But these marks have the specificity of planting, so range of application is narrower.Because the fish sex differentiation is comparatively original, male and female sex chromosome difference is little, thereby the evaluation of its genetic sex is comparatively difficult.Aspect the screening of Cynoglossus semilaevis sex specific molecular marker; Chen etc. (2007) are separated to the female specific AFLP mark of Cynoglossus semilaevis; After converting it into the SCAR mark; Set up the PCR method of identifying Cynoglossus semilaevis genetic sex, identifying for Cynoglossus semilaevis genetic sex provides new technological means, but the special microsatellite marker of relevant employing sex is through the ratio of female in the detection cynoglossus semilaevis cultivation colony, milter and pseudo-milter; And the method that how to improve raun ratio in the cynoglossus semilaevis cultivation colony, do not appear in the newspapers as yet both at home and abroad so far.

Summary of the invention

The purpose of this invention is to provide a kind of method that improves raun ratio in the cynoglossus semilaevis cultivation fry, thereby solve the difficult problem that the raun ratio is low excessively, cultured output is not high in the present cynoglossus semilaevis cultivation colony.

The present invention at first adopts sex chromosome linkage molecule mark that breeding is screened with parent population; Therefrom select high-quality normal male parent population; And then adopt the male parent population of high-quality to set up family; Through physiology sex ratio of more different family fries and the growth rate of different family fries; The family that therefrom filters out physiology raun ratio height, fast growth is cultured and is bred as superior families, thereby overcomes the low problem of raun ratio in the cultured population, and then improves physiology raun ratio, raising growth rate and cultured output in the cynoglossus semilaevis cultivation seed.

Technical scheme of the present invention is following:

1) screening of the male parent population of Cynoglossus semilaevis: the male parent population of Cynoglossus semilaevis is carried out genetic sex identifies, with genetic sex be male, the physiology sex also is that male parent fish selection comes out simultaneously;

Describedly the male parent population of Cynoglossus semilaevis is carried out genetic sex identify, through the evaluation of increasing of designed primer from the Cynoglossus semilaevis sex-specific marker;

A kind of sex specific molecular marker is the chain microsatellite marker SChen-SSR2 of Cynoglossus semilaevis sex chromosome (male and female consensus sequence and female peculiar sequence):

Male and female have fragment sequence (274bp): SEQ ID NO:1

CAGTGTGTGTTTATTTAAAGGTTAGTTGGGGGCCTATTTGTAATATTTCAGTACTAGATGTATCCCTACAAATTGTGTTTAGAGGTAAGCATTTAAATAGTGGTTTTTATTGACAAATATGCAGATTGGATGTCGGGAGGTCGTCGTGCAGCTCATATAACTAGACATTATCGCCTGTTGAGTTTGTGGCTAGAAGCCAACTGGAAGGTTAGATTGTAGAAAATTGTTTTTTTTTTTTTTTGTCGTG TGAGTACAACAC TAGTCCAACTAGTGC；

Female peculiar fragment sequence (302bp): SEQ ID NO:2

CAGTGTGTGTTTATTTAAAGGTTAGTTGGGGACAATTTTGTAATATTTCAATCCTAGATGTATCCCTATAAATTGTGTTTAGAGGTAAGCATTTAGATGTGGTTTAGAAGTGGTTTTTATTGTATTGTATTGTATTGTATTGTATTGTATGCAGCTTAGCTGTCAGGAGGTCGTCGTGTGGTTCATTTAACTAGACATTATCACCTGCTGAGTTTGTGGCCAGAAGCCAACTGGAAGGTTAGATTGTAGAAAACAGTTTATTTTTATGTGTTGTG TGAGTACAACACTAGTCCAACTAGTGC；

Going up designed primer from SChen-SSR2 is Primer 1: (SEQ ID NO:3:CAG TGTGTGTTTATTTAAAGGTTAGTTGGGG) and Primer 2 (SEQ ID NO:4:GCACTAGTTGGACTAGTGTTGTACTCA); Above-mentioned primer is used to identify the genetic sex of Cynoglossus semilaevis; The amplified production that it is characterized in that Cynoglossus semilaevis heredity female individuals is 2 dna fragmentations, and size is respectively 300-304 and 272-276bp; The amplified production of heredity male is 1 dna fragmentation, and size is 272-276bp.

The primer that is used to detect Cynoglossus semilaevis genetic sex can also adopt other female specific AFLP mark of Cynoglossus semilaevis or the chain microsatellite marker primer of sex.

The normal milter of high-quality of adopting above-mentioned sex linkage molecule label screening to go out can be used for seed and breed in a large number, improves the physiology raun ratio of seed, also can be used for family and make up, and screens high female family.

2) artificial propagation and family are set up:

To the male parent population that filters out in the step 1) with reach sexually matured female parent population and carry out temperature control control light and artificial induced spawning, the ovum of the seminal fluid of 1 tail milter and 1 tail raun is carried out artificial insemination sets up a family, and the family of setting up is carried out seed selection;

The number that carries out the family of seed selection is 30-50;

Adopt the belly extrusion to obtain seminal fluid of milter and the mature egg of raun; To be placed in the tank of 1 2.5-3.5 cubic meter from the 50-100ml of family come-up fertilized egg and hatch and fry rearing, water temperature is controlled at 19-24 ℃;

3) detection of cultivation of different family fries and female-male proportion:

With step 2) the fry of different familys use the different fluorescent dye mark respectively after; Culture at same breeding water body; In the time of mixed breed 12-16 month; Carry out that body is long, measured body weight and female, male physiological other identify, with physiology raun ratio be higher than 45% and the family of fast growth confirm as high female, the family of growing fast, these familys are screened proceed to cultivate;

4) high female, the grow cultivation and the breeding of family fast

To cultivate to match after the maturation from female, the milter of the female family of same height and raise up seed; Or the milter of the raun of a high female family or milter and another high female family or raun matched raise up seed; Can produce physiology raun ratio in a large number reaches more than 45% and the high fast female fry of growth; Thereby improve the physiology raun ratio in the cynoglossus semilaevis cultivation seed, improve cynoglossus semilaevis cultivation output.

The present invention screens 1 of the chain microsatellite marker of Cynoglossus semilaevis sex chromosome; Adopt this mark to set up the method for Cynoglossus semilaevis heredity raun and the evaluation of hereditary milter; Set up the tongue sole family that family selective breeding goes out high female ratio through normal milter, thereby set up the method that improves physiology raun ratio in the cynoglossus semilaevis cultivation seed.Method of the present invention has advantages such as accurate, efficient; Physiology milter ratio too high (usually up to 70-90%) in the ubiquitous cultured population, physiology raun ratio is on the low side (being generally 10-30%) problem have been solved in the cynoglossus semilaevis cultivation industry; Large-scale production and breed for semi-smooth tongue sole offspring breed; Improve cultured output and economic benefit, promote the lasting, fast-developing of cynoglossus semilaevis cultivation industry, significant and using value.

Description of drawings:

Fig. 1: the chain microsatellite marker of sex chromosome is to the qualification result electrophoretogram of Cynoglossus semilaevis raun and milter.

Embodiment

Below in conjunction with accompanying drawing and embodiment the present invention is done further detailed explanation.

One, the screening of the male parent population of Cynoglossus semilaevis high-quality

1, the acquisition of the chain microsatellite marker of Cynoglossus semilaevis sex chromosome:

The chain microsatellite marker sequence of sex chromosome that the present invention uses derives from the gene order-checking project that we carry out Cynoglossus semilaevis.Adopt the SOLEXA sequencing technologies to carry out genome sequencing respectively to Cynoglossus semilaevis female individuals and male; Female individuals genome sequence and male genome sequence are compared; Therefrom filter out 1 special microsatellite sequence of sex chromosome; Called after SChen-SSR2, its male and female consensus sequence are SEQ ID NO:1, and female peculiar sequence is SEQ ID NO:2.

Male and female have fragment sequence (274bp): SEQ ID NO:1

CAGTGTGTGTTTATTTAAAGGTTAGTTGGGGGCCTATTTGTAATATTTCAGTACTAGATGTATCCCTACAAATTGTGTTTAGAGGTAAGCATTTAAATAGTGGTTTTTATTGACAAATATGCAGATTGGATGTCGGGAGGTCGTCGTGCAGCTCATATAACTAGACATTATCGCCTGTTGAGTTTGTGGCTAGAAGCCAACTGGAAGGTTAGATTGTAGAAAATTGTTTTTTTTTTTTTTTGTCGTG TGAGTACAACAC TAGTCCAACTAGTGC

Female peculiar fragment sequence (302bp): SEQ ID NO:2

CAGTGTGTGTTTATTTAAAGGTTAGTTGGGGACAATTTTGTAATATTTCAATCCTAGATGTATCCCTATAAATTGTGTTTAGAGGTAAGCATTTAGATGTGGTTTAGAAGTGGTTTTTATTGTATTGTATTGTATTGTATTGTATTGTATGCAGCTTAGCTGTCAGGAGGTCGTCGTGTGGTTCATTTAACTAGACATTATCACCTGCTGAGTTTGTGGCCAGAAGCCAACTGGAAGGTTAGATTGTAGAAAACAGTTTATTTTTATGTGTTGTG TGAGTACAACACTAGTCCAACTAGTGC

According to 1 pair of the sequences Design primer of the chain microsatellite marker SChen-SSR2 of this sex chromosome, be respectively Primer 1: (SEQ ID NO:3:CAG TGTGT GTTTATTTAAAGGTTAGTTGGGG) and Primer 2 (SEQ ID NO:4:GCACTAGTTGGACTAGTGTTGTACTCA).

2, the checking of the chain microsatellite marker of sex chromosome: adopt 12 tail Cynoglossus semilaevis males and 12 tail female individuals DNA samples that the special microsatellite marker of this sex is carried out pcr amplification, 15 μ l systems, wherein distilled water 10.8 μ l are adopted in amplification; 10 * Buffer, 1.5 μ l; DNTP (2.5mM) 0.8 μ l; Each 0.4 μ l of upstream and downstream primer; For guaranteeing active last Takara enzyme (rTaq 5U/ μ l) the 0.1 μ l that adds of enzyme; Fully spiral mixing packing adds corresponding dna profiling 1.5 μ l then; 15 μ l altogether.The PCR response procedures is: 95 ℃ of 5min, 1 circulation; 95 ℃ of 30s, 58 ℃ of 30s, 72 ℃ of 30s, 30 circulations; 1 circulation of 72 ℃ of 7min; After the PCR EP (end of program) in 4 ℃ of preservations.Amplified production is electrophoresis in 6% denaturing polyacrylamide gel, and dyes through silver staining method, observes expansion product number of fragments and the size of microsatellite marker in the male and female individuality then.The result shows that this microsatellite marker all amplifies 2 dna fragmentations in 12 tail rauns, and size is respectively 300-304 and 272-276bp; The amplified production of 12 tails heredity male is 1 dna fragmentation, and size is 272-276bp (Fig. 1).

3, the screening of the male parent population of high-quality

Adopt the special primer of the chain microsatellite marker SChen-SSR2 of Cynoglossus semilaevis sex to identify the genetic sex of the male parent population of Cynoglossus semilaevis, the amplified production of Cynoglossus semilaevis heredity female individuals is 2 dna fragmentations, and size is respectively 300-304bp and 272-276bp; And the amplified production of hereditary male is 1 dna fragmentation, and size is 272-276bp.If certain bar physiology milter amplifies two DNA bands of 300-304 and 272-276bp, explain that this fish is pseudo-milter, i.e. heredity is gone up to being male milter on female, the physiology.And only amplify the dna fragmentation of 1 272-276bp, then be normal milter.

Can also adopt other Cynoglossus semilaevis special numerator mark; (having delivered document according to the inventor carries out: Chen etc. such as the female specific AFLP mark of Cynoglossus semilaevis CseF382; 2007; Isolation of female-specific AFLP markers and molecular identification of genetic sex in half-smooth tongue sole (Cynoglossus semilaevis) .Mar Biotech; 9:273-280.) or the chain microsatellite marker primer of sex CseF-SSR1 (having delivered document according to the inventor carries out: Chen et al., 2012 Induction of mito-gynogenetic diploids and identification of WW super-female using sex-specific SSR markers in half-smooth tongue sole (Cynoglossus semilaevis).Mar Biotechnol 14:120-128.), carries out genetic sex to Cynoglossus semilaevis breeding with male parent population and identifies, with genetic sex be male, the physiology sex also is that male parent fish selection comes out simultaneously, is used for family structure and high female excellent strain seed selection.

The sequence and the primer sequence of CseF382 AFLP mark are:

Primer?CseF382N1

ATTCACTGACCCCTGAGAGCGGCGAAGTTAGGCAGTTCGCTGAGTCCAGTGCAAACATCAACGTTCTTATATGCCAACAGACTTTAGAAGCCAAGAATTATGTGTCATATTTGTTTTGACTCCAGGTTCAGTTTACTTAGGACAAACTCAGGGATTTGAAATGACGAGCAACATCTTATCGCCTCAAGTGCACATGGGTAAAAAGATCCTTCCGAGCCAGGGCTGGAGAAAGCAGGCTTCTCAGGTGACACAGTGGGTTTGGCCGAGACTAGTTTTAC AATGATGGTGCCACAAAAAAAGAAAGGGAAACTCTATGAGTGGACACAGACTGAG ACATTTGTCGTGTGTGAG

Primer?CseF382C1。

The sequence of CseF-SSR1 microsatellite marker is:

A: female peculiar microsatellite marker sequence (218bp)

Gaggccgacaggatcgtacataatcccaacttcacaataactccacaattggcactttttgttttgtttttctcttttactttcttaacaattatacacactcggagcccgtatcgcaatgtcacaccgagggtttgtttcttctaaggtcacacacacacacacacacacaggcatgactgaagagtttctgtcg aaaaccaccggagtacgtcgta

B: male and female have microsatellite marker sequence (206bp)

Gaggccgacaggatcgtacatcctcccaacttcacaataactccacaattggcacttttttttttctcttttactttcttaacaattacacacactcggagcccgtatcacaatgtcacaccgagggtctgtttcttctaaggtcaaacacacacacacgggcatgactgaagagtttcagttg aaaaccaccggagtacgtcgta。

Adopt said method in recent years we Huanghai Aquatic Products Co.,Ltd., Haiyang City carries out pseudo-milter with Mingbo Aquatic Product Co., Ltd., Laizhou to stock male parent population and detects in Yantai, show testing result is summarized in table 1.

Table 1:2011-2012 in Haiyang and Laizhou 2 companies to male parent population detection summary sheet

Visible by table 1; In the male parent population of the Cynoglossus semilaevis ordinary group of propagating artificially in the cynoglossus semilaevis cultivation field; Nearly 27.8% milter is pseudo-milter, and the ratio of normal milter is 72.2%, is illustrated in thus that to have an appointment in the common seed of Cynoglossus semilaevis artificial propagation 28% be the offspring of pseudo-milter.

4. the comparison of normal milter offspring and pseudo-milter offspring seed raun ratio

In recent years; Genetic sex and the physiology sex ratio of normal milter (being the ZZ type in the heredity) colony and pseudo-milter (being to be milter on ZW type, the physiology in the heredity) offspring of colony seed compared in our investigation; The result shows that the ratio of hereditary raun among the normal milter offspring of colony (being the ZW type in the heredity) is 47%-51%, and the ratio of physiology raun (gonad development is an ovary) is 41%-43%; On the contrary; Hereditary raun (being the ZW type in the heredity) ratio in the pseudo-milter offspring of the colony seed is up to 69%-71%; But the ratio of physiology raun (gonad development is an ovary) has only 5.2%-6.2%, is physiology milter (table 2) and the hereditary raun sex reversal of 91.2-92.5% is arranged.And physiology milter poor growth, individual little does not have commercial value.Therefore; Need pseudo-milter be removed from milter colony in the Cynoglossus semilaevis artificial propagation with in growing seedlings; Be used for seed breeding and normal high-quality milter picked out; Could guarantee the physiology raun ratio in the tongue sole seed like this, solve problems such as the milter ratio is too high in the common cultured population, growth rate is slow, cultured output is low.

Normal milter of table 2 and the pseudo-milter offspring of colony seed sex ratio are relatively

The normal milter of adopting said method to filter out can be used to the seed that raises up seed in a large number, can the physiology raun ratio in the cultured population seed be brought up to about 40%, can apply.And for more a high proportion of raun, just need carry out family selective breeding and obtain high female family.

Two, artificial propagation and family are set up

Above-mentioned research shows the physiology raun ratio of physiology raun ratio in the pseudo-milter offspring among the normal milter offspring, has application value.But, The above results is that the normal milter seminal fluid of many tails mixes the result that insemination obtains.So, whether variant on physiology raun ratio between the different normal milter offsprings? Can cultivate the higher seed of physiology raun ratio among the offspring? Therefore, we adopt normal milter parent population to carry out family structure and high female family screening.We to the male parent population of normal high-quality that filters out with reach sexually matured 3 ages and above female parent population carries out temperature control control light and artificial propagation, carried out the parent fish pond water temperature in preceding about 2 months in breeding and control with illumination; Water temperature by per 10 days rising 0.5-1 ℃, progressively be elevated to 22-23 ℃ from 17-19 ℃, and maintain 22-23 ℃; Illumination then prolonged 1 hour by per 10 days, by 8 hours every days light application time extend to illumination 16 hours every days, and maintain illumination in 16 hours.Touch inspection through observation and hand and select sexual gland obviously to swell, gently press sexual gland to have tangible sense of fulfillment and sexual gland front end that the raun of certain pliability is arranged in both sides up and down, be used for the artificial induced spawning breeding; Male parent population then selects gently to squeeze the sexual gland position, sees that seminal fluid outflow person uses.Adopt the belly extrusion to obtain seminal fluid of milter and the mature egg of raun: after raun picks up, pin the gonopore position with towel earlier from water, prevent that ovum from flowing out, wrap the fish body with towel rapidly simultaneously, gonopore one side is exposed at the outside and wipes seawater.Push the sexual gland position with hand from back to front gently in both sides up and down, ovum is extruded, be connected in the dry beaker.During semen collection, push ripe milter belly, with suction pipe the seminal fluid of extruding is forwarded in the dry bottle and preserve, or directly seminal fluid is extruded in the beaker of ovum with hand.Smart ovum is mixed, add 2 times of seawater to the ovum amount and promptly accomplish the insemination operation, the unnecessary seminal fluid of flush away can change in the hatching cylinder and hatch behind the 20min.Seminal fluid of 1 tail milter and the ovum of 1 tail raun are carried out artificial insemination, promptly form a family, will be placed in the tank of 1 2.5-3.5 cubic meter from the 50-100ml of family come-up fertilized egg and hatch and fry rearing, water temperature is controlled at 19-24C; Should set up family 30-50, each family should be cultivated screening and growth fraction that 300-500 tail fry is used for high female family at every turn.

2010, we built together in Mingbo Aquatic Product Co., Ltd., Laizhou and have found 35 of tongue sole familys, and wherein cultivating into family alive is 25, and existing information with 25 familys is summarized in table 3.

Table 3:2010 tongue sole families is set up situation (20100701-20110410)

Three, the detection of cultivation of different family fries and female-male proportion:

When different family fries grow to the 12-16 centimeter length; Each family picked at random 200-250 tail fry adopts fluorescent dye to carry out mark; The identical dye combinations of same family mark; Different family fries behind the mark are placed on carry out mixed breed in the same cement pit, every square meter water body is put 30-40 tail fry in a suitable place to breed, when fry grows to the 20-25 centimeter length; Cultivation density is adjusted into every square meter water body 15-20 tail fry; Continue to culture to raun (big specification fish) wherein and grow to more than 40 centimetres, when body weight 350 grams are above, carry out the physiology sex identification of different family fishes and body is long, measured body weight, the physiology sex identification adopts the method at strong illumination sexual gland position to carry out.With the write by hand net fish is got,, observe the sexual gland CF in outside of belly sexual gland position with the irradiation of strong fluorescent lamp from sexual gland position, the fish body back side; If sexual gland is longer and narrower; Color is faint yellow or transparence is a raun, if sexual gland is short and little, and color black in color or navy blue then are milter.Reach more than 45% physiology raun ratio and the family of fast growth is confirmed as high female family, these familys are screened proceed to cultivate.

Transfer to Changyi tongue sole plant after we respectively select 200 tail fries to carry out fluorescence labeling in June, 2011 and carry out mixed breed test from 22 family, altogether mark 4323 tail fries transfer to three new aquatic products Co., Ltds, be placed in 2 breed ponds and culture.Tongue sole family fry to mixed breed carried out body length, measured body weight in every subsequently separated 3-5 month, when experiment finishes, chose several familys and carried out the physiology sex identification.Different familys growth comparative results are summarized in table 4, with the normal milter family of representativeness physiological at present

Other qualification result is summarized in table 5.

Table 4:2010 tongue sole families growth fraction

Physiology raun ratio summary sheet in the representative normal milter family of table 5:2010 Cynoglossus semilaevis

Visible by table 5, normal milter is individual different, and the physiology raun ratio in the generation also is not quite similar thereafter; Although the physiology raun ratio (19%-68%) in the normal milter offspring seed is all apparently higher than pseudo-milter offspring (referring to table 1); But the physiology raun proportional difference between the different familys of normal milter is also bigger, such as, the physiology raun ratio of No. 16 familys is up to 68%; Next is No. 57 familys; Its physiology raun ratio also reaches 47%, and apparently higher than other family, so these 2 familys are high female family; And the physiology raun ratio of No. 44 familys has only 19%, therefore, can filter out the high family of physiology raun ratio through the family selective breeding mode.Through being compared, proterties such as the growth of 25 familys, sex ratio just filter out that 1 physiology raun ratio is high, superior families-No. 16 family of fast growth among the present invention; The breed survival rate of this family is up to 73%, and its relative weight gain rate during culturing in 300 days is up to 8.1; Also screen high, family-No. 57 family faster of growing also of 1 raun ratio simultaneously, its physiology raun ratio reaches 47%, and its relative weight gain is also higher, reaches 4.1.In addition, the breed survival rate of No. 17 familys is also up to 75%, and is suitable with No. 16 familys, and the daily gain of No. 17 familys also has 0.45, and these familys all are the superior families with better proterties.Therefore, we filter out several female ratios high, grow fast or the high superior families (No. 16, No. 57 and No. 17) of survival rate to adopt the present invention's technology, and these familys all have great application value and wide promotion prospect.

Four, the breed of high female superior families and breeding

With the physiology raun ratio that screens is that high female family adult fish more than 45% is cultivated as reserve parent fish; The high female family reserve parent fish of difference carried out being blended in the same cement pit behind the fluorescence labeling culture; When arrive mating season, carry out temperature control control light; When the parent population gonadal maturation, carry out artificial induced spawning and breeding.During artificial propagation; To cultivate to match after the maturation from female, the milter of the female family of same height and raise up seed; Or the milter of the raun of a high female family or milter and another high female family or raun matched raise up seed; Can produce the high female seed of physiology raun ratio height, fast growth so in a large number, thereby improve the raun ratio in the cynoglossus semilaevis cultivation colony, improve the cultured output and the economic benefit of Cynoglossus semilaevis.Existing breed result shows that female ratio has significant raising than the family that does not have screening among the high female family offspring that we set up, and has the excellent popularization using value.

Claims (6)

1. a method that improves cynoglossus semilaevis cultivation seed raun ratio comprises the steps:

1) screening of the male parent population of Cynoglossus semilaevis: the male parent population of Cynoglossus semilaevis is carried out genetic sex identifies, with genetic sex be male, the physiology sex also is that male parent fish selection comes out simultaneously;

2) artificial propagation and family are set up:

To the male parent population that filters out in the step 1) with reach sexually matured female parent population and carry out temperature control control light and artificial induced spawning, the ovum of the seminal fluid of 1 tail milter and 1 tail raun is carried out artificial insemination sets up a family, the family of setting up is carried out seed selection;

3) detection of cultivation of different family fries and female-male proportion:

With step 2) different family fries use the different fluorescent dye mark respectively after; Culture at same breeding water body; In the time of mixed breed 12-16 month; Carry out that body is long, measured body weight and female, male physiological other identify, with physiology raun ratio greater than 45% and the family of fast growth confirm as high female family, these familys are screened proceed to cultivate;

4) high female, the grow cultivation and the breeding of family fast

To cultivate to match after the maturation from female, the milter of the female family of same height and raise up seed; Or the milter of the raun of a high female family or milter and another high female family or raun matched raise up seed; High and the high fast female fry of growth of a large amount of production physiology raun ratios, thus the physiology raun ratio in the cynoglossus semilaevis cultivation seed improved.

2. the method for claim 1 is characterized in that the male parent population of Cynoglossus semilaevis is carried out genetic sex identify through the evaluation of increasing of designed primer from Cynoglossus semilaevis sex linkage molecule mark in the described step 1).

3. method as claimed in claim 2 is characterized in that described Cynoglossus semilaevis sex linkage molecule is labeled as the chain microsatellite marker SChen-SSR2 of Cynoglossus semilaevis sex chromosome, is divided into total fragment sequence of male and female and female peculiar fragment sequence;

The total fragment sequence of male and female is SEQ ID NO:1:

CAGTGTGTGTTTATTTAAAGGTTAGTTGGGGGCCTATTTGTAATATTTCAGTACTAGATGTATCCCTACAAATTGTGTTTAGAGGTAAGCATTTAAATAGTGGTTTTTATTGACAAATATGCAGATTGGATGTCGGGAGGTCGTCGTGCAGCTCATATAACTAGACATTATCGCCTGTTGAGTTTGTGGCTAGAAGCCAACTGGAAGGTTAGATTGTAGAAAATTGTTTTTTTTTTTTTTTGTCGTGTGAGTACAACACTAGTCCAACTAGTGC；

Female peculiar fragment sequence is SEQ ID NO:2:

CAGTGTGTGTTTATTTAAAGGTTAGTTGGGGACAATTTTGTAATATTTCAATCCTAGATGTATCCCTATAAATTGTGTTTAGAGGTAAGCATTTAGATGTGGTTTAGAAGTGGTTTTTATTGTATTGTATTGTATTGTATTGTATTGTATGCAGCTTAGCTGTCAGGAGGTCGTCGTGTGGTTCATTTAACTAGACATTATCACCTGCTGAGTTTGTGGCCAGAAGCCAACTGGAAGGTTAGATTGTAGAAAACAGTTTATTTTTATGTGTTGTGTGAGTACAACACTAGTCCAACTAGTGC。

4. method as claimed in claim 3 is characterized in that described microsatellite marker SChen-SSR2 is used to design primer, and institute's designed primer is Primer 1 and Primer 2, and wherein Primer 1 primer sequence is SEQ ID NO 3:

CAG?TGTGT?GTTTATTTAAAGGTTAGTTGGGG；

The primer sequence of Primer 2 is SEQ I D NO 4:

GCACTAGTTGGACTAGTGTTGTACTCA。

5. method as claimed in claim 4 is characterized in that described primer Primer 1 and Primer 2 are 2 dna fragmentations at the amplified production of Cynoglossus semilaevis heredity female individuals, and size is respectively 300-304 and 272-276bp; At hereditary male amplified production is 1 dna fragmentation, and size is 272-276bp.

6. the method for claim 1 is characterized in that described step 2) artificial propagation and family foundation, the number that wherein carries out the family of seed selection is 30-50.

Images