WO2026010353A1 - B형 간염 바이러스의 숙주 침투를 저해하는 신규한 pres1 유도체 화합물 - Google Patents
B형 간염 바이러스의 숙주 침투를 저해하는 신규한 pres1 유도체 화합물Info
- Publication number
- WO2026010353A1 WO2026010353A1 PCT/KR2025/009408 KR2025009408W WO2026010353A1 WO 2026010353 A1 WO2026010353 A1 WO 2026010353A1 KR 2025009408 W KR2025009408 W KR 2025009408W WO 2026010353 A1 WO2026010353 A1 WO 2026010353A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- peptide
- virus
- hepatitis
- amino acid
- acid sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
- A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
- A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
- A23L33/17—Amino acids, peptides or proteins
- A23L33/18—Peptides; Protein hydrolysates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2730/00—Reverse transcribing DNA viruses
- C12N2730/00011—Details
- C12N2730/10011—Hepadnaviridae
- C12N2730/10111—Orthohepadnavirus, e.g. hepatitis B virus
- C12N2730/10122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- the present invention relates to a novel PreS1 derivative compound that inhibits the penetration of hepatitis B virus.
- Hepatitis B virus (HBV) infection is known to be closely associated with an increased risk of liver dysfunction such as hepatocellular cirrhosis and liver cancer. Approximately 250 million people suffer from chronic HBV infection, and approximately 1 million people die from hepatocellular carcinoma caused by chronic HBV infection each year.
- Immunomodulators e.g., interferon- ⁇ (IFN- ⁇ ) or pegylated IFN- ⁇
- nucleotide analogs e.g., tenofovir or entecavir
- IFN- ⁇ interferon- ⁇
- nucleotide analogs e.g., tenofovir or entecavir
- cccDNA covalently closed circular DNA
- HBsAg hepatitis B virus surface antigen
- the first step in inhibiting HBV infection is blocking the viral entry step. Targeting this step can block viral infection and transmission at an early stage.
- the entry inhibitor was designed with inspiration from the L protein and optimized through structure-activity relationship studies. Shorter peptides, truncated to 48 amino acids at the C-terminus, exhibited enhanced inhibitory activity compared to the full-length peptide. When the myristoyl group was removed, the peptide not only exhibited inhibitory activity but also blocked liver accumulation.
- Myrcludex B (MyrB), a 47-amino acid residue derived from the N-terminal PreS1 (surface protein) domain of HBV, is a well-known early entry inhibitor for hepatitis B virus (HBV) and hepatitis delta virus (HDV). MyrB competitively blocks HBV attachment to the same site and exhibits in vitro HBV entry inhibition activity at low concentrations, i.e., picomolar concentrations. In various animal models, including monkeys, dogs, and humanized mice, a reduction in HBV DNA and its accumulation in the liver were observed, demonstrating its in vivo pharmacokinetic and biological profiles.
- HBV hepatitis B virus
- HDV hepatitis delta virus
- the inventors of the present invention have studied a drug design strategy capable of improving stability while maintaining HBV entry inhibitory activity, and as a result, have synthesized a second-generation MyrB derivative with significantly improved HBV entry inhibitory activity and whole blood stability compared to linear peptide MyrB, thereby leading to the present invention.
- One object of the present invention is to provide a linear or cyclic peptide represented by the following chemical formula 1 or chemical formula 2.
- Another object of the present invention is to provide a pharmaceutical composition and a food composition for preventing or treating hepatitis virus infection disease, which contain a peptide represented by the following or chemical formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient.
- n is an integer from 10 to 14
- n is an integer from 1 to 6
- o is an integer from 1 to 3
- A is O or NH
- R 1 is a peptide having an amino acid sequence of either SEQ ID NO: 1 or SEQ ID NO: 2,
- R 2 is a peptide having an amino acid sequence of any one of sequence numbers 3 to 8,
- R 3 is a direct bond or a peptide having an amino acid sequence of any one of SEQ ID NOs. 9 to 15,
- R 4 is hydroxy, -NR 5 R 6 or morpholinyl
- R 5 and R 6 are each independently hydrogen or C 1 to C 3 alkyl.
- n is an integer from 10 to 14
- n is an integer from 1 to 6
- o is an integer from 1 to 3
- A is O or NH
- R 1 is a peptide having an amino acid sequence of either SEQ ID NO: 1 or SEQ ID NO: 2,
- R 2 is a peptide having an amino acid sequence of any one of sequence numbers 3 to 8,
- R 3 is a direct bond or a peptide having an amino acid sequence of any one of SEQ ID NOs. 9 to 15,
- R 4 is hydroxy, -NR 5 R 6 or morpholinyl
- R 5 and R 6 are each independently hydrogen or C 1 to C 3 alkyl.
- the peptide represented by the chemical formula 1 of the present invention may be any one of peptides 1 to 4 and 6 in the manufacturing examples of Table 1 in the present specification, and the peptide represented by the chemical formula 2 of the present invention may be any one of peptides 5, 7, 8 to 18 in the manufacturing examples of Table 1 in the present specification.
- m is an integer of 12
- R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1
- R 2 is a peptide having an amino acid sequence of SEQ ID NO: 3 or 4
- R 3 is a peptide having an amino acid sequence of any one of SEQ ID NOs: 9 to 12
- R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 1 is a linear peptide
- m is an integer of 12
- R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1
- R 2 is a peptide having an amino acid sequence of SEQ ID NO: 3
- R 3 is a peptide having an amino acid sequence of SEQ ID NO: 12
- R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 2 is a linear peptide, in which m in the chemical formula 1 is an integer of 12, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 4, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 12, and R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 3 is a linear peptide, wherein in the chemical formula 1, m is an integer of 12, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 3, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 10, and R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 4 is a linear peptide, wherein in the above chemical formula 1, m is an integer of 12, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 3, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 9, and R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 6 is a linear peptide, wherein in the above chemical formula 1, m is an integer of 12, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 3, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R 4 may be a hydroxyl peptide, but is not limited thereto.
- m is an integer of 10 to 14
- n is an integer of 1 to 6
- o is an integer of 1 to 3
- A is O or NH
- R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1 or 2
- R 2 is a peptide having an amino acid sequence of any one of SEQ ID NOs: 3 to 8
- R 3 is a direct bond or a peptide having an amino acid sequence of any one of SEQ ID NOs: 9 to 15
- R 4 is hydroxy, -NR 5 R 6 or morpholinyl
- R 5 and R 6 may each independently be a peptide that is hydrogen or a C 1 to C 3 alkyl, but are not limited thereto.
- n and o may be 2 to 9, and may be specifically characterized as being 2 to 8, but is not limited thereto.
- peptide 7 is a cyclic peptide
- m is an integer of 12
- n is 1
- o is 1
- A is O
- R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1
- R 2 is a peptide having an amino acid sequence of SEQ ID NO: 3
- R 3 is a peptide having an amino acid sequence of SEQ ID NO: 11
- R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 8 is a cyclic peptide, wherein in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 7, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 9 is a cyclic peptide, in which in the above chemical formula 2, m is an integer of 12, n is 1, o is 1, A is NH, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 1, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 8, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 10 is a cyclic peptide, in which in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 11, and R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 11 is a cyclic peptide
- m is an integer of 12
- n is 4, o is 1
- A is NH
- R 1 is a peptide having an amino acid sequence of SEQ ID NO: 2
- R 2 is a peptide having an amino acid sequence of SEQ ID NO: 6
- R 3 is a peptide having an amino acid sequence of SEQ ID NO: 11
- R 4 may be a peptide having -NH 2 , but is not limited thereto.
- peptide 12 is a cyclic peptide, wherein in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 13, and R 4 may be a hydroxyl peptide, but is not limited thereto.
- peptide 13 is a cyclic peptide
- m is an integer of 12
- n is 4, o is 1
- A is NH
- R 1 is a peptide having an amino acid sequence of SEQ ID NO: 2
- R 2 is a peptide having an amino acid sequence of SEQ ID NO: 6
- R 3 is a peptide having an amino acid sequence of SEQ ID NO: 13
- R 4 is -NH 2 , but is not limited thereto.
- peptide 14 is a cyclic peptide, and in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R 3 is a direct bond, and R 4 is -NH 2 , but is not limited thereto.
- peptide 15 is a cyclic peptide, and in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 14, and R 4 is -NH 2 , but is not limited thereto.
- peptide 16 is a cyclic peptide, and in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 15, and R 4 is -NH 2 , but is not limited thereto.
- peptide 18 is a cyclic peptide, in which in the above chemical formula 2, m is an integer of 12, n is 4, o is 1, A is NH, R 1 is a peptide having an amino acid sequence of SEQ ID NO: 2, R 2 is a peptide having an amino acid sequence of SEQ ID NO: 6, R 3 is a peptide having an amino acid sequence of SEQ ID NO: 14, and R 4 may be a peptide that is morpholinyl, but is not limited thereto.
- amino acid sequence numbers 1 to 18 constituting the peptide of the present invention are shown in Table 1 below.
- a pharmaceutical composition for preventing or treating hepatitis virus infection disease which comprises a peptide represented by the following chemical formula 1 or chemical formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient:
- the pharmaceutically acceptable salt may include an acid or base addition salt.
- the compound may be in the form of an organic or inorganic acid addition salt.
- the salt may include, but is not limited to, any salt that has a desired effect on the patient when administered to the patient and maintains the activity of the parent compound.
- salts include inorganic and organic salts, such as acetic acid, nitric acid, aspartic acid, sulfonic acid, sulfuric acid, maleic acid, glutamic acid, formic acid, succinic acid, phosphoric acid, phthalic acid, tannic acid, tartaric acid, hydrobromic acid, propionic acid, benzenesulfonic acid, benzoic acid, stearic acid, lactic acid, bicarboxylic acid, bisulfuric acid, bitartaric acid, oxalic acid, butyric acid, calcium idet, carbonic acid, chlorobenzoic acid, citric acid, idetic acid, toluenesulfonic acid, fumaric acid, gluceptic acid, esilic acid, pamoic acid, gluconic acid, methyl nitrate, malonic acid, hydrochloric acid, hydroiodoic acid, hydroxynaphtholic acid, isethionic acid, lactobionic acid
- the addition salts of bases may include salts of alkali metals or alkaline earth metals, such as salts of ammonium, lithium, sodium, potassium, magnesium, calcium, etc.; salts with organic bases, such as salts of benzathine, N-methyl-D-glucamine, hydrabamine, etc.; and salts with amino acids, such as arginine, lysine, etc.
- these salts can be converted into free forms by treatment with an appropriate base or acid.
- the compound represented by Chemical Formula 1 or Chemical Formula 2 of the present invention can very effectively prevent, improve, or treat hepatitis virus infection diseases.
- the composition of the present invention can be very effectively used for the prevention, improvement, or treatment of hepatitis virus infection diseases because it can inhibit the entry of the virus in the early stage of hepatitis virus infection by inhibiting degradation by in vivo hydrolytic enzymes.
- hepatitis virus is a virus that causes hepatitis, and has been reported to include hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), hepatitis G virus (HGV), etc.
- HAV hepatitis A virus
- HBV hepatitis B virus
- HCV hepatitis C virus
- HDV hepatitis D virus
- HEV hepatitis E virus
- HGV hepatitis G virus
- the "hepatitis B virus (HBV)" of the present invention is a small enveloped DNA virus belonging to the Hepadnaviridae family.
- the 3.2 kb double-stranded DNA and viral DNA polymerase are surrounded by a nucleocapsid protein (HBcAg), and this particle is surrounded by a surface protein (HBsAg).
- HBcAg nucleocapsid protein
- HBsAg surface protein
- Invasion by enveloped viruses is generally mediated through specific interactions between the viral surface and cell receptors on the cell surface, which induces membrane fusion or endocytosis.
- HBV is known to invade hepatocytes through two steps, each involving rough binding and tight binding.
- the virus attaches to the hepatocyte surface through rough attachment mediated by heparan sulfate proteoglycans (HSPGs), followed by tight binding to sodium taurocholate cotransporting polypeptide (NTCP), inducing endocytosis-mediated internalization.
- NTCP sodium taurocholate cotransporting polypeptide
- the HBV surface protein is composed of three units called small (S), middle (M), and large (L) surface proteins.
- S protein contains the S domain, which is involved in rough interaction with HSPGs, and the M protein contains PreS2 and S domains.
- the L protein is composed of PreS1, PreS2, and S domains, and the N-terminus of the PreS1 domain of the L protein mediates tight binding of HBV to NTCP.
- the hepatitis virus of the present invention may be at least one selected from the group consisting of hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), hepatitis D virus (HDV), hepatitis E virus (HEV), hepatitis G virus (HGV), Epstein-Barr virus, and cytomegalovirus (CMV), but is not limited thereto.
- HAV hepatitis A virus
- HBV hepatitis B virus
- HCV hepatitis C virus
- HDV hepatitis D virus
- HEV hepatitis E virus
- HGV hepatitis G virus
- Epstein-Barr virus Epstein-Barr virus
- CMV cytomegalovirus
- the hepatitis virus infection disease of the present invention may include all diseases and complications that are directly or indirectly caused by infection with a hepatitis virus, and may specifically be hepatitis, liver cirrhosis, or hepatocellular carcinoma, but is not limited thereto as long as it corresponds to a disease that is directly or indirectly caused by infection with a hepatitis virus.
- prevention of the present invention may include, without limitation, an act of blocking, suppressing or delaying symptoms caused by infection with a hepatitis virus by using the composition of the present invention.
- the above “improvement” of the present invention may include, without limitation, any act that improves or benefits symptoms caused by infection with a hepatitis virus by using the composition of the present invention.
- treatment of the present invention may include, without limitation, any act in which symptoms caused by infection with a hepatitis virus are improved or beneficial by using the composition of the present invention.
- compositions of the present invention can be implemented as pharmaceutical compositions or food compositions.
- the pharmaceutical composition is not limited to these, but may be formulated and used in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, etc., external preparations, suppositories, and sterile injection solutions, respectively, according to conventional methods.
- the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
- the pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a fragrance, etc.
- for oral administration may include a mixture of buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, and stabilizers for injections, and may include a base, excipients, lubricants, and preservatives for topical administration.
- the pharmaceutical composition of the present invention can be prepared in various forms by mixing it with a pharmaceutically acceptable carrier as described above.
- a pharmaceutically acceptable carrier for example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and for injections, it can be prepared in the form of unit dose ampoules or multiple doses.
- it can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.
- Examples of carriers, excipients, and diluents suitable for the formulation of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or mineral oil.
- fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like may be additionally included.
- the routes of administration of the pharmaceutical composition of the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred.
- parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques.
- the pharmaceutical composition of the present invention may vary depending on various factors including the activity of the specific compound used, age, body weight, general health, sex, dosage form, administration time, administration route, excretion rate, drug combination, and severity of the specific disease to be prevented or treated, and the dosage of the pharmaceutical composition may vary depending on the patient's condition, body weight, degree of disease, form of medicine, administration route, and period, but may be appropriately selected by those skilled in the art, and may be administered at 0.0001 to 50 mg/kg or 0.001 to 50 mg/kg per day. The administration may be administered once a day or divided into several times. The dosage does not limit the scope of the present invention in any way.
- the pharmaceutical composition according to the present invention may be formulated as a pill, a dragee, a capsule, a liquid, a gel, a syrup, a slurry, or a suspension.
- the food composition of the present invention can be manufactured in the form of various foods, such as beverages, gum, tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, etc.
- the amount may be added in a ratio of 0.1 to 50% of the total weight, but is not limited thereto.
- the natural carbohydrates may include monosaccharides such as glucose, disaccharides such as fructose, sucrose, and other polysaccharides, dextrin, cyclodextrin, and other typical sugars, and sugar alcohols such as xylitol, sorbitol, and erythritol.
- the flavoring agents may include natural flavoring agents (thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)) and synthetic flavoring agents (saccharin, aspartame, etc.).
- natural flavoring agents thaumatin, stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.)
- synthetic flavoring agents sacharin, aspartame, etc.
- the food composition of the present invention may further include various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.
- flavoring agents such as synthetic flavoring agents and natural flavoring agents
- coloring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloid thickeners, pH regulators, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.
- the ingredients included in the food composition of the present invention may be used independently or in combination.
- the proportion of the additives is not a key element of the present invention, but may be selected within the range of 0.1 to about 50 parts by weight per 100 parts by weight of the food composition of the present invention, but is not limited thereto.
- a method for preventing, improving or treating a hepatitis virus infection disease comprising administering to a subject in need of administration an effective amount of a composition comprising a peptide represented by the following chemical formula 1 or chemical formula 2 or a pharmaceutically acceptable salt thereof as an active ingredient:
- the term “administration” means providing a predetermined composition of the present invention to a subject by any appropriate method.
- the "subject" requiring the administration may include both mammals and non-mammals.
- mammals include, but are not limited to, humans, non-human primates such as chimpanzees, other apes, or monkey species; livestock animals such as cows, horses, sheep, goats, and pigs; farmed animals such as rabbits, dogs, or cats; and laboratory animals such as rodents such as rats, mice, or guinea pigs.
- non-mammals in the present invention may include, but are not limited to, birds or fish.
- the peptides included as active ingredients in the composition of the present invention can be combined with a carrier to enhance the efficacy of treating hepatitis virus infection.
- a carrier that is biocompatible and capable of achieving the desired effects of the present invention may be used without limitation. Examples include, but are not limited to, serum albumin, peptides, immunoglobulins, hemocyanins, and polysaccharides.
- the formulation of the composition administered as described above is not particularly limited, and may be administered as a solid formulation, a liquid formulation, or an aerosol formulation for inhalation, and may be administered as a solid formulation intended to be converted into a liquid formulation for oral or parenteral administration immediately before use, and may be administered by being formulated in the form of, for example, oral formulations such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injectable solutions, but is not limited thereto.
- oral formulations such as powders, granules, capsules, tablets, and aqueous suspensions, external preparations, suppositories, and sterile injectable solutions, but is not limited thereto.
- an adjuvant may be further added together with the composition of the present invention during the administration, and any adjuvant known in the art as a pharmaceutical or immunological substance may be used without limitation.
- any adjuvant known in the art as a pharmaceutical or immunological substance may be used without limitation.
- sugars or amino acids may be used as stabilizers, and mineral oil, vegetable oil, alum, aluminum phosphate, bentonite, silica, muramyl dipeptide derivatives, thymosin, interleukin, etc. may be used as adjuvants.
- a pharmaceutically acceptable carrier may be additionally administered together with the composition of the present invention during the administration.
- the pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersant, a stabilizer, a suspending agent, a pigment, a fragrance, etc. for oral administration, and may include a mixture of a buffer, a preservative, an analgesic, a solubilizer, an isotonic agent, a stabilizer, etc. for injections, and may include a base, an excipient, a lubricant, a preservative, etc. for topical administration.
- composition of the present invention may be prepared in various ways by mixing it with the pharmaceutically acceptable carrier described above.
- the composition may be prepared in the form of a tablet, troche, capsule, elixir, suspension, syrup, wafer, etc. for oral administration, and may be prepared in the form of a unit dosage ampoule or a multiple dosage form for injections. It can be formulated as a solution, suspension, tablet, capsule, sustained-release preparation, etc.
- examples of carriers, excipients, and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, or mineral oil.
- fillers, anticoagulants, lubricants, wetting agents, fragrances, emulsifiers, preservatives, and the like may be additionally included.
- Routes of administration of the composition according to the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal. Oral or parenteral administration is preferred.
- parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional, and intracranial injection or infusion techniques.
- the composition of the present invention may also be administered in the form of a suppository for rectal administration.
- a "pharmaceutically effective amount” refers to a sufficient amount of an agent to produce a desired biological result. This result may be a reduction and/or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration in a biological system.
- an "effective amount” for preventive or therapeutic use is the amount of a composition disclosed herein required to produce a clinically significant reduction in a disease.
- An appropriate "effective” amount in any individual case can be determined by one skilled in the art using routine experimentation. Accordingly, the expression “effective amount” generally refers to an amount of an active agent that has a therapeutic effect.
- the active agent is a peptide represented by Chemical Formula 1 or Chemical Formula 2, or a pharmaceutically acceptable salt thereof, and is an agent for the prevention, improvement, or treatment of a hepatitis virus infection disease.
- composition of the present invention may vary depending on various factors including the activity of the active ingredient used, age, body weight, general health, sex, diet, administration time, administration route, excretion rate, drug combination, and severity of the specific disease to be prevented or treated, and the dosage of the composition may vary depending on the patient's condition, body weight, degree of disease, drug form, administration route, and period, but may be appropriately selected by those skilled in the art, and may be administered at 0.0001 to 100 mg/kg or 0.001 to 100 mg/kg per day. Administration may be administered once a day or divided into several times. The dosage does not limit the scope of the present invention in any way.
- the composition according to the present invention may be formulated as a pill, a dragee, a capsule, a liquid, a gel, a syrup, a slurry, or a suspension.
- composition of the present invention may be used alone or in combination with methods using surgery, hormone therapy, chemotherapy, and biological response modifiers.
- Another embodiment of the present invention provides a method for improving the stability of a drug.
- the method may include a step of obtaining a drug for stabilization; and a step of forming a macrocycle by forming a cyclic amide on at least two amino acids among the amino acid sequences included in the drug.
- the cyclic amide may be a cyclic amide cyclized through lactamization or lactonization, and specifically, may be a cyclic amide cyclized through lactamization, but is not limited thereto.
- the cyclic amide is characterized by including N-methylation, C-term modification, or a combination thereof at an amino acid residue adjacent to an amino acid participating in cyclization.
- the lactamization or lactonization ring in the cyclic amide may be composed of 5 to 9 ring atoms, specifically 6 to 8 ring atoms, and most specifically 7 ring atoms, but is not limited thereto.
- the ring atom of lactamization or lactonization means a carbon or hetero atom participating in lactam or lactone cyclization for a linear peptide (e.g., R 2 of the above chemical formula 2), and the atoms constituting the peptide that is the target of cyclization (e.g., R 2 of the above chemical formula 2) are excluded from the number of lactamization or lactonization ring atoms.
- the drug targeted for stabilization may be at least one selected from the group consisting of a virus entry inhibitor, a cccDNA-targeting drug, a nucleocapsid inhibitor, a polymerase inhibitor, an HBsAg inhibitor, and an immunosuppressant, and may be specifically a virus entry inhibitor, but is not limited thereto.
- the viral entry inhibitor may be at least one selected from the group consisting of Myrcludex B (MyrB), Cyclosporin A, and Ezetimibe, and specifically may be the drug Myrcludex-B (MyrB), but is not limited thereto.
- Myrcludex B (MyrB) is a drug that irreversibly inhibits the NTCP receptor and blocks the hepatitis B virus from invading liver cells.
- Myrcludex B composed of 47 amino acids derived from the N-terminus of the PreS1 (surface protein) domain, which is a surface protein of HBV, is well known as an early entry inhibitor for hepatitis B virus (HBV) and hepatitis delta virus (HDV), but has the problem of being rapidly decomposed by in vivo hydrolytic enzymes because it is a linear peptide.
- the method of the present invention has discovered a macrocyclization method as a drug design strategy for improving the stability of the drug, and the macrocyclization can be performed through lactamization or lactonization, and the cyclic amide includes N-methylation, C-term modification, or a combination thereof of amino acids adjacent to amino acids participating in the cyclization, thereby significantly reducing the decomposition of the drug by body hydrolytic enzymes and maximizing the effect of inhibiting the invasion of hepatitis viruses.
- novel peptide according to the present invention can be very effectively used for the prevention, improvement or treatment of hepatitis B virus infection diseases by very effectively inhibiting the host penetration of hepatitis B virus.
- FIG. 1 is a diagram showing the results of confirming the in vitro HBV entry inhibition activity of PreS1 derivatives (MyrB-old and peptides 6 to 9) according to one embodiment of the present invention.
- Figure 2 is a diagram showing the results of monitoring for up to 24 hours for peptides 6 to peptide 9 to confirm whole blood stability according to one embodiment of the present invention.
- FIG. 4 is a diagram showing the results of confirming in vitro HBV entry inhibitory activity for (a) a control group (MyrB-old, peptide 8, and MyrB) and PreS1 derivatives (peptides 10 to peptide 13) according to one embodiment of the invention, and (b) the results of confirming HBV entry inhibitory activity in a lower range (0-2.5 nM) of peptides 12 and 13.
- Figure 5 is a diagram showing the results of confirming the stability of rat whole blood for MyrB and peptide 13 according to one embodiment of the present invention.
- FIG. 6 is a diagram showing the results of administering peptide 13 via subcutaneous injection at 1 mg/kg using a humanized mouse model to evaluate the in vivo HBV entry inhibition efficacy of peptide 13 according to one embodiment of the present invention, and confirming (a) serum HBV DNA, (b) intracellular cccDNA, (c) HBsAg, and (d) HBeAg.
- FIG. 7 is a diagram showing the results of an in vivo pharmacokinetic study (PK study) performed on a mouse intravenously injected with peptide 13 according to one embodiment of the present invention.
- PK study in vivo pharmacokinetic study
- FIG. 8 is a diagram illustrating (a) an analysis of an immune response induced by MyrB or peptide 13 without an adjuvant for the evaluation of immunotoxicity of peptide 13 (DL-5-99) when no adjuvant is used according to one embodiment of the present invention, (b) measuring the body weight of mice every three days according to a subcutaneous injection schedule, and (c) analyzing the immune response through flow cytometry, and comparing the results between groups using Kruskal-Wallis statistics.
- FIG. 9 is a diagram illustrating an analysis of an immune response induced by (a) MyrB or peptide 13 and an adjuvant for evaluating the immunotoxicity of peptide 13 (DL-5-99) when administered in combination with an adjuvant according to one embodiment of the present invention, (b) measuring the body weight of mice every three days according to a subcutaneous injection schedule, and (c) analyzing the immune response using flow cytometry. The results are compared between groups using Kruskal-Wallis statistics.
- FIG. 10 is a diagram showing the results of analysis of antibodies induced by MyrB or peptide 13 for antigenicity evaluation of peptide 13 (DL-5-99) according to one embodiment of the present invention.
- FIG. 11 is a diagram showing the results of designing a third library (3 rd library) of peptide 13 derivatives (peptide 14 to peptide 18) according to one embodiment of the present invention.
- FIG. 12 is a diagram comparing the in vitro entry inhibitory activity of MyrB, peptide 13 (DL-5-99) or various derivative compounds according to one embodiment of the present invention.
- Figure 13 is a diagram comparing the in vitro entry inhibitory activity of MyrB, peptide 13 (DL-5-99), or derivative compound peptide 18 (DL-7143) according to one embodiment of the present invention.
- Figures 14 and 15 are diagrams showing HPLC chromatogram results according to one embodiment of the present invention.
- Rink amide MBHA resin, 2-chlorotrityl resin, Fmoc-D-Pro-OH, Fmoc-Lys(Alloc)-OH, and PyBOP were purchased from Novabiochem (Darmstadt, Germany).
- HOAt and Fmoc-Asp(OAll) were purchased from Advanced ChemTech (Louisville, KY, USA).
- HATU and amino acids were purchased from Chem-Impex International, Inc. (Wood Dale, IL, USA).
- TFA and DMF (> 99.9%, peptide synthesis grade) were purchased from Acros Organics (Fair Lawn, NJ, USA).
- 2,4,6-Collidine, phenylsilane, and 2-nitrobenzenesulfonyl chloride were purchased from Alfa Aesar (Ward Hill, MA, USA). Acetonitrile (HPLC grade) was purchased from Fisher Scientific (Waltham, MA, USA). DIEA and morpholine were purchased from Tokyo Chemical Industry (Tokyo, Japan). All other reagents and solvents were purchased from Sigma-Aldrich (St. Louis, MO, USA). Empty cartridges, frits, and cap plugs were purchased from Applied Separations (Allentown, PA, USA). Micrococcal nuclease (M0247) was purchased from New England BioLabs (Ipswich, MA, USA). The G-spinTM total kit (14067) was purchased from iNtRON (Seongnam, Korea). Cysteine-containing MyrB and cysteine-containing peptide 13 were purchased from Anygen (Gwangju, Korea).
- Analytical HPLC was performed on a Waters HPLC system (Waters 2489 UV-Vis detector, Waters 1525 binary HPLC pump, Waters 2707 autosampler, and Water 5CH column oven) equipped with a C18 column (SunFire, C18, 4.6 Y 250 mm, 5 ⁇ m).
- the column oven temperature was set at 40 °C, and the binary mobile phases used were as follows: (A, water with 0.1% CF 3 COOH; B, CH 3 CN with 0.1% CF 3 COOH; flow rate, 1 mL/min), with 10% B in 0–5 min, a linear gradient to 100% B over 5–25 min, and 100% B in 25–30 min. Compounds were monitored at 220 nm and 254 nm.
- Preparative HPLC was performed on a Waters HPLC system (Waters prepLC system, Waters 2545 quaternary HPLC pump, Waters 2489 UV-Vis detector, Waters fraction collector III) using a C18 column (SunFire, C18, 19 ⁇ 150 mm, 5 ⁇ m). The flow rate was 14 mL/min. Preparative HPLC was performed under the same mobile phase conditions as the analytical HPLC, and sample elution was monitored by absorbance at 220 and 254 nm. The purity of each fraction was confirmed by the UV-Vis detector of the analytical HPLC. Fractions with a purity exceeding 97% were collected, lyophilized, and stored at -80°C.
- LC-MS was performed on an Agilent Technology infinity 1260 system (quaternary pump, autosampler, temperature controller, and Hewlett Packard Series 1100 detector) and a C18 column (Poroshell, 120 EC-C18, 4.6 ⁇ 50 mm, 2.7 ⁇ m).
- the column heating temperature was set at 50 °C.
- the binary mobile phases used were as follows: (A, water with 0.1% CF 3 COOH; B, CH 3 CN with 0.1% CF 3 COOH; flow rate, 0.8 mL/min), with a linear gradient of 5% B over 0–3 min, 3–8 min to 100% B, and 8–11 min to 100% B. Compounds were monitored at 220 nm and 254 nm.
- Rink amide resin 250 mg, 0.13 mmol, loading 0.52 mmol/g
- Fmoc-Ala-Wang resin LL 110 mg, 0.13 mmol, loading 1.14 mmol/g
- CH 2 Cl 2 2 mL
- Fmoc deprotection was performed using 20% (v/v) piperidine in DMF (2 mL) at room temperature for 5 min.
- the resin was washed with CH 2 Cl 2 (Y2), DMF (Y2), MeOH (Y1), DMF (Y2), and CH 2 Cl 2 (Y2).
- the desired amino acid (3.0 equiv), HATU (150 mg, 0.39 mmol, 3.0 equiv), and DIEA (140 mg, 0.3 mL, 1.0 mmol, 8.0 equiv) in DMF (2 mL) were added to the resin and coupled.
- the reaction was performed under microwave irradiation (75 °C, 400 W maximum power, 75%, ramp 2.5 min, hold 8.0 min, stirring level 3), and the resin was washed with DMF (Y1), CH 2 Cl 2 (Y2), DMF (Y2), MeOH (Y1), DMF (Y2), and CH 2 Cl 2 (Y2). The two steps were repeated until the desired sequence was obtained.
- the resin was treated with TFA:TIS:CH 2 Cl 2 (v/v/v) 2.5:2.5:95 and stirred at room temperature for 2 min to remove residual palladium.
- the resin was washed with CH 2 Cl 2 (Y2), DMF (Y2), MeOH (Y1), DMF (Y2), and CH 2 Cl 2 (Y2). This washing step was repeated three times.
- the resin was treated with TFA:TIS:CH 2 Cl 2 (v/v/v) 2:2:96 and stirred at room temperature for 2 min.
- the resin was washed with CH 2 Cl 2 (Y2), DMF (Y2), MeOH (Y1), DMF (Y2), and CH 2 Cl 2 (Y2). This deprotection step was repeated twice.
- the resin was treated with 10% (v/v) DIEA in DMF and stirred at room temperature for 10 min to neutralize the free amine.
- the resin was washed with CH 2 Cl 2 (Y2), DMF (Y2), MeOH (Y1), DMF (Y2), and CH 2 Cl 2 (Y2).
- macrocyclization was performed by adding PyBOP (340 mg, 0.65 mmol, 5.0 equiv), HOAt (90 mg, 0.65 mmol, 5.0 equiv), and DIEA (170 mg, 0.2 mL, 1.3 mmol, 10.0 equiv).
- the resin was soaked in DMF (2 mL) at room temperature for 2 h.
- the resin was washed with CH 2 Cl 2 (Y2), DMF (Y2), MeOH (Y1), DMF (Y2), and CH 2 Cl 2 (Y2).
- Fmoc deprotection was performed using 20% (v/v) piperidine in DMF (2 mL).
- Myristoylation was performed by adding myristic acid (90 mg, 0.39 mmol, 3.0 equiv), HATU (150 mg, 0.39 mmol, 3.0 equiv), and DIEA (130 mg, 0.18 mL, 1.0 mmol, 8.0 equiv) to DMF (2 mL).
- the mixture was stirred under microwave irradiation (75 °C, 400 W, 75% power, ramp 2.5 min, hold 8.0 min, stirring level 3).
- the resin was washed with CH 2 Cl 2 (Y2), DMF (Y2), MeOH (Y1), DMF (Y2), and CH 2 Cl 2 (Y2).
- Crude material was obtained by digestion with TFA:TIS:CH 2 Cl 2 (v/v/v) 95:2.5:2.5 at room temperature for 2 h.
- the TFA solution was removed by N2 gas flow, and the residue was dissolved in 1:1 (v/v) water/acetonitrile and filtered through a 0.45 ⁇ m PTFE syringe filter.
- the crude material was purified by preparative HPLC to obtain the desired product.
- Peptides 1 to 18 were prepared in the manufacturing examples in Table 2 below.
- Biotinylated MyrB was synthesized for immunogenicity experiments. Cysteine-containing MyrB was obtained according to the general peptide synthesis protocol described above. Cysteine-containing MyrB (2.8 mg, 0.5 ⁇ mol, 1.0 equiv) was dissolved in 5% DMSO/PBS buffer (1 mL). Biotin-maleimide (2.3 mg, 5 ⁇ mol, 10.0 equiv) was dissolved in 5% DMSO/PBS buffer (1 mL), and this solution was poured into the cysteine-containing MyrB solution. The mixture was stirred at room temperature for 3 h, and the desired product was identified by LC-MS. The crude product was then diluted with a 1:1 (v/v) water/acetonitrile solution and purified by preparative HPLC to obtain the desired product.
- Cysteine-containing peptide 13 (25 ⁇ mol) was obtained according to the general peptide synthesis protocol mentioned above. The formation of oxidative disulfide bonds of cysteine, or sulfenic, sulfinic, or sulfonic groups, should be considered.
- the crude material was obtained through specific digestion using TFA:TIS:1,2-ethanedithiol:thioanisole:NH 4 I:H 2 O (v/v/v/v/v) 82.5:5:3.5:2.5:1.5:5 at room temperature.
- the TFA solution was removed by a stream of N 2 gas for 2 h, and ethyl acetate was poured onto the oily residue.
- HepG2-NTCP was cultured at 37°C with 5% CO2 in DMEM containing 10% FBS and 100 U penicillin containing 0.1 mg/mL streptomycin. All maintained cells tested by PCR were mycoplasma negative. HepG2-NTCP were cultured in 12-well plates with the indicated cyclic peptides for 2 h, after which the cells were infected with HBV particles (2 ⁇ 106 virus copies per mL) and treated with the indicated cyclic peptides for an additional 3 h. After removing the virus-containing medium, the cells were cultured for an additional 16 h in the absence of the indicated cyclic peptides.
- intracellular HBV DNA was extracted using the G-spinTM Total Kit.
- the isolated intracellular HBV DNA was subjected to PCR using HBV DNA primer and probe sets (primer: forward: 5'-TCCTCTTCATCCTGCTGCTAT G-3', reverse: 5'- CGTGCTGGTAGTTGATGTTCCT, probe: 5'- TATTGTTCTTCTGGACTA).
- Cyclic peptide (1 ⁇ L, 1 mM DMSO stock) was added to each tube containing heparinized rat whole blood (49 ⁇ L) (20 ⁇ M in 2% DMSO, f/c). The solutions were incubated in a 37°C water bath for 0, 1, 3, 6, and 24 h. Water containing 2% SDS and 5 mM EDTA (50 ⁇ L) was then added to each tube, and the tubes were sonicated for 5 min. The solutions were diluted with acetonitrile containing 0.1% trifluoroacetic acid (200 ⁇ L), vortexed, and centrifuged at 5000 rpm for 10 min to precipitate cellular components. The clear supernatant was filtered through a 0.2 ⁇ m PTFE syringe filter (Whatman) and analyzed by LC-MS using selected ion mode (SIM) to quantify the intact peptide.
- SIM selected ion mode
- HepG2 Human hepatoma cells
- MRC-5 human lung cancer cells
- CellTiter 96 Aqueous Non-Radioactive Cell Proliferation Assay Reagent 20 containing a tetrazolium compound [MTS3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS] was added to each well, and the plates were incubated at 37°C for 4 hours to allow for metabolism.
- MTS3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS was added to each well, and the plates were incubated at 37°C for 4 hours to allow for metabolism.
- Human liver-chimeric uPA/SCID (PXB) mice were obtained from PhoenixBio Co., Ltd. (Higashi-Hiroshima, Japan). Three-week-old uPA/SCID mice received human hepatocytes ( 105 to 106 cells per mouse) via the spleen. Nine weeks after human hepatocyte transplantation, all mice had a turnover index exceeding 90%. At 17 weeks of age, the mice were transferred to the Animal Research Center and received a single intravenous injection of human HBV virions from HepG2.2.15 cells (1.3 Y106 copies per mouse, genotype D). After 6 weeks, persistent HBV infection of human hepatocytes was established in the chimeric livers.
- Animal experiments were performed in accordance with the guidelines of the Institutional Animal Care and Use Committee, and infections, serum sampling, and sacrifice were performed under ether anesthesia.
- the MyrB group and the peptide 13 group did not differ significantly from the negative control group (p-value > 0.05). Groups were compared using the Kruskal-Wallis statistic. Abbreviations: ⁇ -GT, gamma-glutamyl transferase; ALT, alanine transaminase; AST, aspartate transaminase; ALP, alkaline phosphatase; TG, triglyceride; T-CHO, total cholesterol; BUN, blood urea nitrogen; Ca, calcium; P, phosphorus; Mg, magnesium.
- HBV PreS1 MyrB-old Myr-GQNLSTSNPLGFFPDHQLDPAFRANTANPDWDFNPNKDTWPDANKVG-NH 2 1 Myr-GQNLSTSNPLGFFPDHQLDPAFRANS-OH 1st library 2 Myr-GQNLSTSNPLGFFPEHQLDPAFRANS-OH 3 Myr-GQNLSTSNPLGFFPDHQLDPA-OH 4 Myr-GQNLSTSNPLGFFPDHQLD-OH 5 Myr-GQNL S TSNPLGFFPDHQL D 6 Myr-GQNLSTSNPLGFFPD H* QLDPA-OH 7 Myr-GQNL S TSNPLGFFP D H* QLDPA-OH 8 Myr-GQNL K TSNPLGFFP D H* QLDPA-OH 9 Myr-GQNL Dpr SNPLGFFP D H* QLDPA-OH Myrcludex B (MyrB) Myr-GTNLSVPNPLGFFPDHQLDPAFGANS
- Macrocyclization occurs between two underlined, bolded amino acids.
- the desired compounds are formed by side-chain-tail macrocyclization.
- Dpr diaminopropionic acid
- H* N-methyl-histidine
- R* N-methyl-arginine.
- Lowercase p represents D-proline.
- the PreS1 sequence which mediates protein-protein interactions between the large surface protein of HBV and NTCP in hepatocytes, is already known. Based on this sequence, we aimed to design PreS1 derivatives with enhanced stability and antiviral activity through C-terminal truncation, macrocyclization, and side chain modification (see Table 2). Previously, a pharmacophore and an accessory domain were reported for PreS1. To improve synthetic cost and yield, the accessory domain was truncated to yield peptides 1 and 3. However, aspartimide formation was observed during the macrocyclization step. Macrolactonization between Ser5 and Asp15 of peptides 1 and 3 produced aspartimide compounds instead of macrocyclic peptides.
- Peptide 2 was designed by replacing aspartic acid with glutamic acid, which has one more carbon, but glutarimide was still observed. Therefore, it was thought that aspartimide formation occurred by the deprotonated amide attacking the activated carboxylic acid, and it was decided to remove the reactive site to solve the aspartimide problem.
- peptide 4 was obtained by removing two more amino acids compared to peptide 3 to eliminate the amide proton associated with aspartimide formation.
- Peptide 5 was obtained through C-terminal macrocyclization in the side chain.
- an N-methyl amino acid was adopted at position 16 to avoid aspartimide formation during on-resin cyclization.
- Peptide 6 was designed by substituting an N-methylated histidine at position 16, and a cyclized compound (peptide 7) was observed.
- peptides 5 and 7 faced low stability and low synthetic yields, respectively.
- Peptide 5 was observed to spontaneously decompose in aqueous media, and the macrolactonization conversion of peptide 6 was less than 5%. Therefore, macrolactamization was utilized instead of macrolactonization to improve stability and yield, and peptides 8 and 10 were designed by adopting a macrolactam ring.
- PreS1 derivatives from the first library were synthesized using the solid-phase peptide synthesis (SPPS) protocol.
- Wang resin was generally used for peptide synthesis, with 2-chlorotrityl resin used only for peptide 5, which had a macrolactonization at the C-terminus.
- Fmoc deprotection was performed with 20% (v/v) piperidine in DMF, and peptide coupling was performed at room temperature with the addition of HATU, the desired amino acid, and DIEA. Each linear sequence was extended through repeated Fmoc deprotection and peptide coupling. After obtaining the desired linear peptide, partial protecting groups were removed under each condition.
- the allyl protecting group was treated with Pd(PPh 3 ) 4 and PhSiH 3 , and the trityl protecting group was treated with a weak acidic cocktail (TFA:TIS:CH 2 Cl 2 2.5:2.5:95).
- a weak acidic cocktail TFA:TIS:CH 2 Cl 2 2.5:2.5:95.
- On-resin cyclization of peptides 8 and 9 was performed with the addition of PyBOP and HOBt, and >99% conversion was observed by LC-MS and HPLC. Macrolactonization of peptide 5 was performed under the same conditions, but low conversion was confirmed by LC-MS. Then, myristic acid and HATU were added to attach a myristoyl group to the N-terminus.
- the parent sequence was modified by C-terminal truncation and side chain cyclization (e.g., peptide 8) to improve the synthetic route and stability while maintaining HBV entry inhibition activity.
- C-terminal truncation and side chain cyclization e.g., peptide 8
- Myrcludex B MyrB
- MyrB was unveiled as a pioneering entry inhibitor whose sequence was optimized to exhibit potent HBV entry inhibition activity. It showed increased inhibitory activity compared to previously reported ones and is in ongoing phase 3 clinical trials.
- the established modification strategy in the first library including C-terminal truncation, cyclization, and backbone N-methylation of the MyrB sequence, was adopted.
- Four derivatives were designed based on amino acid substitutions and C-terminal modifications (see Figure 3).
- PreS1 derivatives from the second library were synthesized using the SPPS protocol.
- a representative overall synthetic scheme is illustrated in Scheme 2.
- the solid support resin was selected based on the C-terminal group: Wang resin for the carboxylic acid group and Rink amide MBHA resin for the amide group.
- Fmoc deprotection was performed with 20% (v/v) piperidine in DMF, and peptide coupling was performed at room temperature with the addition of HATU, the desired amino acid, and DIEA. Each linear sequence was extended through repeated Fmoc deprotection and peptide coupling.
- the allied groups were removed by adding Pd(PPh3)4 and PhSiH3 in CH2Cl2 solution, followed by three 2-minute treatments under mild acidic conditions (2.5% TFA solution) to wash away the residual palladium adduct.
- the resin was stirred in a 10% (v/v) DIEA solution in DMF to neutralize the reactive sites.
- On-resin cyclization was performed by adding PyBOP and HOAt, and >99% conversion was observed by LC-MS and HPLC.
- Myristic acid and HATU were then added to attach a myristoyl group to the N-terminus.
- IC 50 values of MyrB, peptides 12, and 13 were determined by the lowest concentration point, they were re-evaluated at five points in a lower range (0–2.5 nM) (see Fig. 4b).
- peptide 13 showed 89% of the intact peptide after 24 h, indicating that it was more stable than MyrB in blood.
- peptides 8 and 13 were compared, more peptide 13 remained after 24 h than peptide 8 (46% vs. 89% for peptides 8 and 13), indicating that peptide 13 is more stable than peptide 8 in blood.
- Peptide 13 showed improved inhibitory activity and whole blood stability compared to the linear peptide or peptide 8.
- the HBV entry inhibition activity of peptide 13 was evaluated in an in vivo assay system using a humanized mouse model (see Figure 6). Serum HBV DNA was bound in both groups, the control and peptide 13, after 1 week, but serial observations revealed different profiles. At week 4, serum HBV DNA levels in the control group did not change significantly compared to week 1, but serum HBV DNA levels in the peptide 13-treated group decreased by 3 log compared to week 1. In addition, intracellular cccDNA was significantly reduced by 8 log compared to untreated groups (see Figure 6b).
- the cyclized sequence was identified as an essential epitope for binding to NTCP. Although peptide 13 was more stable than the parent peptide MyrB, we investigated whether there was a protease that specifically recognized the sequence. Access by the protease from the N-terminus was blocked by N-acylation using a myristoyl group. The cyclized loop sequence was excluded from modification because it is a pharmacophore. Therefore, the C-terminus was modified considering a carboxypeptidase that recognizes a specific amino acid at the first or second position from the C-terminus.
- N-alkyl amidation of the C-terminus was expected to weaken the electrostatic interaction between the carboxylic acid and the peptidase binding pocket.
- reaction scheme 3 shows the synthesis method of peptide 15, 17, and 18 derivatives.
- peptides 14-18 were generally performed according to the SPPS protocol described above (Scheme 3). Only the order of the myristoylation and cyclization steps was reversed in Scheme 3.
- peptides 17 and 19 the fully protected linear peptides were cleaved from 2-chlorotrityl resin using a 20% HFIP/ CH2Cl2 solution. The residual cleaved solution was evaporated with a N2 gas flow, and N-alkyl amidation was performed without further purification after cleavage. While DMF was typically used as the solvent for amide coupling, reactions with diethylamine or morpholine at the C-terminus were performed in CH2Cl2 .
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Engineering & Computer Science (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Communicable Diseases (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Oncology (AREA)
- Food Science & Technology (AREA)
- Polymers & Plastics (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Mycology (AREA)
- Nutrition Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
본 발명에 따른 신규한 펩타이드는 B형 간염 바이러스의 숙주 침투를 매우 효과적으로 억제함으로써, B형 간염 바이러스 감염 질환의 예방, 개선 또는 치료를 위해 매우 효과적으로 사용될 수 있다.
Description
본 발명은 B형 간염 바이러스의 침투를 저해하는 신규한 PreS1 유도체 화합물에 관한 것이다.
B형 간염 바이러스(hepatitis B virus, HBV) 감염은 간세포성 간경변이나 암종과 같은 간 기능 장애의 위험 증가와 밀접한 관련이 있는 것으로 알려져 있다. 약 2억 5천만 명이 만성 HBV 감염을 앓고 있으며, 매년 약 100만 명이 만성 HBV 감염으로 인한 간세포 질환으로 사망하는 질환이다. 일반적으로 면역 조절제(예를 들어, 인터페론-α(IFN-α) 또는 페길화된 IFN-α(pegylated IFN-α)) 및 뉴클레오티드 유사체(예를 들어, 테노포비르 또는 엔테카비르)를 감염 환자에게 처방했지만 심각한 부작용을 일으키고, 치료를 하더라도 cccDNA(공유 폐쇄 원형 DNA) 및 B형 간염 바이러스 표면 항원(hepatitis B virus surface antigen, HBsAg)을 근절하는 데 제한적인 효능을 가진다는 것이 문제이다. 장기적인 치료에서 부작용 없이 지속적인 바이러스 억제를 달성하기 위해서는 대체 치료법의 개발이 시급한 실정인데, 최근 B형 간염 바이러스의 생활사 분석을 통해 진입 억제제, 중합효소 저해제, 캡시드 조립 억제제, 바이러스 분비억제제 등을 개발하여 다방면 약물 조합 치료를 시도하고 있다.
HBV 감염을 억제하는 첫 번째 관문이 바이러스 진입 단계를 차단하는 것인데, 진입 단계(entry step)를 타겟으로 하게 되면 바이러스 감염 및 바이러스 전파를 초기 단계에서 차단할 수 있다. 진입 억제제(entry inhibitor)는 L 단백질에서 영감을 받아 설계되었으며, 구조-활성 관계 연구를 통해 구조가 최적화되었다. C-말단을 최대 48개 아미노산까지 절단한 짧은 펩타이드는 전체 길이의 펩타이드보다 향상된 억제 활성을 나타냈다. 미리스토일 그룹(myristoyl group)이 제외되었을 때, 해당 펩타이드는 억제 활성뿐만 아니라 간에서의 축적도 차단되었다.
HBV의 표면 단백질인 PreS1(surface protein) 도메인 N 말단에서 유래된 47개의 아미노산으로 구성된 Myrcludex B(MyrB)는 B형 간염 바이러스(HBV)와 델타 간염 바이러스(HDV)에 대한 초기 진입 억제제로 잘 알려져 있는데, MyrB는 HBV의 부착을 경쟁적인 결합을 통해 동일한 부위에서 차단하며, 적은 농도의 단위인 피코몰 농도에서 체외 HBV 진입 억제 활성을 나타냈다. 원숭이, 개, 인간화 쥐 등을 포함한 다양한 동물 모델에서 HBV DNA의 감소와 간에서의 축적이 관찰되어 생체 내 약동학 및 생물학적 프로파일이 입증된 바 있다.
HBV/HDV 동시 감염 환자를 대상으로 MyrB의 3상 임상 시험이 진행 중이나 MyrB가 선형 펩타이드이기 때문에 생체내 가수분해 효소에 의해 빠르게 분해되는 점이 주된 단점이며, 낮은 대사 안정성을 가진다. 임상 결과에서 MyrB는 간에 우선적으로 축적됨에도 불구하고 환자의 경우 2시간 반감기를 보여 투여 간격을 연장하려면 혈액 순환에서 MyrB의 단백질 분해 안정성의 개선이 필수적으로 요구되는 실정이다.
이에, 본 발명자들은 HBV 진입 억제 활성을 유지하면서도 안정성을 향상시킬 수 있는 약물 디자인 전략을 예의 연구한 결과, 선형 펩타이드 MyrB와 비교하여 HBV 진입 억제 활성 및 전혈 안정성이 현저히 향상된 2세대 MyrB 유도체를 합성하여 본 발명에 이르렀다.
본 발명의 일 목적은 하기 화학식 1 또는 화학식 2 로 표시되는 선형 또는 고리형 펩타이드를 제공하는 것이다.
본 발명의 다른 목적은 하기 또는 화학식 2 로 표시되는 펩타이드 또는 이의 약제학적으로 허용되는 염을 유효성분으로 포함하는 간염 바이러스 감염 질환의 예방 또는 치료용 약학 조성물 및 식품 조성물을 제공하는 것이다.
[화학식 1]
[화학식 2]
상기 화학식 1 및 2에서,
m은 10 내지 14의 정수이고,
n은 1 내지 6의 정수이며,
o는 1 내지 3의 정수이고,
A는 O 또는 NH이며,
R1은 서열번호 1 또는 서열번호 2 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고,
R2는 서열번호 3 내지 8 중 어느 하나의 아미노산 서열을 가지는 펩타이드이며,
R3는 직접 결합이거나 서열번호 9 내지 15 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고,
R4는 하이드록시, -NR5R6 또는 모르폴리닐(morpholinyl)이며,
상기 R5 및 R6는 각각 독립적으로 수소 또는 C1 내지 C3 알킬이다.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당 업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명의 일 구현 예에서는 하기 화학식 1, 화학식 2 또는 화학식 3으로 표시되는 펩타이드를 제공한다:
[화학식 1]
[화학식 2]
상기 화학식 1 및 2에서,
m은 10 내지 14의 정수이고,
n은 1 내지 6의 정수이며,
o는 1 내지 3의 정수이고,
A는 O 또는 NH이며,
R1은 서열번호 1 또는 서열번호 2 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고,
R2는 서열번호 3 내지 8 중 어느 하나의 아미노산 서열을 가지는 펩타이드이며,
R3는 직접 결합이거나 서열번호 9 내지 15 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고,
R4는 하이드록시, -NR5R6 또는 모르폴리닐(morpholinyl)이며,
상기 R5 및 R6는 각각 독립적으로 수소 또는 C1 내지 C3 알킬이다.
본 발명의 상기 화학식 1로 표시되는 펩타이드는 본 명세서 내 표 1의 제조예에서 펩타이드 1 내지 4 및 6 중 어느 하나일 수 있으며, 본 발명의 상기 화학식 2로 표시되는 펩타이드는 본 명세서 내 표 1의 제조예에서 펩타이드 5, 7, 8 내지 18 중 어느 하나일 수 있다.
본 발명의 상기 화학식 1로 표시되는 펩타이드에서 m은 12의 정수이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 3 또는 4의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 9 내지 12 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 구체예에서 상기 화학식 1로 표시되는 펩타이드 중 펩타이드 1은 선형 펩타이드로서, 상기 화학식 1에서 m은 12의 정수이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 3의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 12의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구체예에서 상기 화학식 1로 표시되는 펩타이드 중 펩타이드 2는 선형 펩타이드로서, 상기 화학식 1에서 m은 12의 정수이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 4의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 12의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 1로 표시되는 펩타이드 중 펩타이드 3은 선형 펩타이드로서, 상기 화학식 1에서 m은 12의 정수이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 3의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 10의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 1로 표시되는 펩타이드 중 펩타이드 4는 선형 펩타이드로서, 상기 화학식 1에서 m은 12의 정수이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 3의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 9의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 1로 표시되는 펩타이드 중 펩타이드 6은 선형 펩타이드로서, 상기 화학식 1에서 m은 12의 정수이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 3의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 11의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 화학식 2로 표시되는 펩타이드에서 m은 10 내지 14의 정수이고, n은 1 내지 6의 정수이며, o는 1 내지 3의 정수이고, A는 O 또는 NH이며, R1은 서열번호 1 또는 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 3 내지 8 중 어느 하나의 아미노산 서열을 가지는 펩타이드이며, R3는 직접 결합이거나 서열번호 9 내지 15 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시, -NR5R6 또는 모르폴리닐(morpholinyl)이며, 상기 R5 및 R6는 각각 독립적으로 수소 또는 C1 내지 C3 알킬인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 화학식 2로 표시되는 펩타이드에서 상기 n과 o의 합은 2 내지 9일 수 있고, 구체적으로 2 내지 8인 것을 특징으로 할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 일 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 5는 고리형 펩타이드로서, 상기 화학식 1에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 O이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 5의 아미노산 서열을 가지는 펩타이드이며, R3는 직접 결합이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 7은 고리형 펩타이드로서, 상기 화학식 1에서 m은 12의 정수이고, n은 1이며, o는 1이고, A는 O이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 3의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 11의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 8은 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 7의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 11의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 9는 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 1이며, o는 1이고, A는 NH이며, R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 8의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 11의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 10은 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 11의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 11은 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 11의 아미노산 서열을 가지는 펩타이드이고, R4는 -NH2인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 12는 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 13의 아미노산 서열을 가지는 펩타이드이고, R4는 하이드록시인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 13은 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 13의 아미노산 서열을 가지는 펩타이드이고, R4는 -NH2인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 14는 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 직접 결합이고, R4는 -NH2인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 15는 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 14의 아미노산 서열을 가지는 펩타이드이고, R4는 -NH2인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 16은 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 15의 아미노산 서열을 가지는 펩타이드이고, R4는 -NH2인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2 표시되는 펩타이드 중 펩타이드 17은 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 14의 아미노산 서열을 가지는 펩타이드이고, R4는 - NR5R6이며, 상기 R5 및 R6는 각각 독립적으로 C2 알킬인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구체예에서 상기 화학식 2로 표시되는 펩타이드 중 펩타이드 18은 고리형 펩타이드로서, 상기 화학식 2에서 m은 12의 정수이고, n은 4이며, o는 1이고, A는 NH이며, R1은 서열번호 2의 아미노산 서열을 가지는 펩타이드이고, R2는 서열번호 6의 아미노산 서열을 가지는 펩타이드이며, R3는 서열번호 14의 아미노산 서열을 가지는 펩타이드이고, R4는 모르폴리닐(morpholinyl)인 펩타이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 펩타이드를 구성하는 아미노산의 서열번호 1 내지 18을 하기 표 1에 나타내었다.
| 서열 | 아미노산 시퀀스 |
| 서열번호 1 | GQNL |
| 서열번호 2 | GTNL |
| 서열번호 3 | STSNPLGFFPD |
| 서열번호 4 | STSNPLGFFPE |
| 서열번호 5 | STSNPLGFFPDHQLD |
| 서열번호 6 | KVPNPLGFFPD |
| 서열번호 7 | KTSNPLGFFPD |
| 서열번호 8 | DprTSNPLGFFPD |
| 서열번호 9 | HQLD |
| 서열번호 10 | HQLDPA |
| 서열번호 11 | H*QLDPA |
| 서열번호 12 | HQLDPAFRANS |
| 서열번호 13 | R*QLDPA |
| 서열번호 14 | R*QLDP |
| 서열번호 15 | R*QLDp |
| 여기서, 상기 H*는 N-메틸-히스티딘(N-methyl-histidine)이며, Dpr은 디아미노프로피온산(diaminopropionic acid)이고, R*는 N-메틸-아르기닌(N-methyl-arginine)임. 소문자 p는 D-프롤린 (D-proline)임. | |
본 발명의 다른 구현 예에서는 하기 화학식 1 또는 화학식 2 로 표시되는 펩타이드 또는 이의 약제학적으로 허용되는 염을 유효성분으로 포함하는 간염 바이러스 감염 질환의 예방 또는 치료용 약학 조성물을 제공한다:
[화학식 1]
[화학식 2]
본 발명의 상기 화학식에서 m, n, o, R1, R2, R3, R4 각각에 관한 내용, 서열번호은 상기에 기재된 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.
본 발명에서 상기 약제학적으로 허용 가능한 염은 산 또는 염기의 부가염을 포함할 수 있다. 예를 들면, 화합물은 유기산 또는 무기산의 부가염의 형태로 있을 수 있다. 염은 환자에 투여되었을 때에 환자에서 바람직한 효과를 갖는 것으로, 그들의 모화합물의 활성을 유지하는 임의의 염들을 포함하지만, 이에 특별히 한정되는 것은 아닐 수 있다. 이러한 염들은 무기염 및 유기염, 예컨대 아세트산, 질산, 아스파트산, 술폰산, 설퓨릭산, 말레산, 글루탐산, 포름산, 숙신산, 인산, 프탈산, 탄닌산, 타르타르산, 히드로브롬산, 프로피온산, 벤젠술폰산, 벤조산, 스테아르산, 락트산, 비카르본산, 비설퓨릭산, 비타르타르산, 옥살산, 부틸산, 칼슘 이데트, 카르보닉산, 클로로벤조산, 시트르산, 이데트산, 톨루엔술폰산, 푸마르산, 글루셉트산, 에실린산, 파모익산, 글루코닉산, 메틸질산, 말론산, 염산, 히드로요도익산, 히드록시나프톨산, 이세티온산, 락토비오닉산, 만델산, 점액산, 나프실릭산, 뮤코닉산, p-니트로메탄술폰산, 헥사믹산, 판토테닉산, 모노히드로겐인산, 디히드로겐인산, 살리실산, 술파민산, 술파닐린산, 메탄술폰산의 염 등을 포함할 수 있다. 염기의 부가염은 알칼리 금속 또는 알칼리 토금속의 염, 예컨대 암모늄, 리튬, 나트륨, 칼륨, 마그네슘, 칼슘 등의 염; 유기 염기를 갖는 염, 예컨대 벤자틴, N-메틸-D-글루카민, 하이드라바민 등의 염; 및 아미노산을 갖는 염, 예컨대 아르기닌, 리신 등을 포함할 수 있다. 또한, 이들 염들은 적정 염기 또는 산으로 처리함으로써 유리된 형태로 전환될 수 있다.
본 발명의 상기 화학식 1 또는 화학식 2로 표시되는 화합물은 간염 바이러스 감염 질환을 매우 효과적으로 예방, 개선 또는 치료할 수 있다. 본 발명의 상기 조성물은 생체 내 가수분해 효소로부터 분해를 억제함으로써 간염 바이러스 감염의 초기 단계에서 바이러스의 진입을 억제할 수 있기 때문에 간염 바이러스 감염 질환의 예방, 개선 또는 치료에 매우 효과적으로 사용될 수 있다.
본 발명의 상기 "간염 바이러스"는 간염을 일으키는 바이러스로, A형 간염 바이러스(Hepatitis A virus, HAV), B형 간염 바이러스(Hepatitis B virus, HBV), C형 간염 바이러스(Hepatitis C virus, HCV), D형 간염 바이러스(Hepatitis D virus, HDV), E형 간염 바이러스(Hepatitis E virus, HEV), G형 간염 바이러스(Hepatitis G virus, HGV) 등이 보고되어 있다.
본 발명의 상기 "B형 간염 바이러스(hepatitis B virus, HBV)"는 헤파드나비리대(Hepadnaviridae)과에 속하는 작은 외피 DNA 바이러스이다. 3.2kb의 이중 가닥 DNA와 바이러스 DNA 중합효소는 뉴클레오캡시드 단백질(nucleocapsid protein, HBcAg)로 둘러싸여 있고, 이 입자는 표면 단백질(surface protein, HBsAg)로 둘러싸여 있다. 외피 바이러스에 의한 침입은 일반적으로 바이러스 표면과 세포 표면의 세포 수용체 사이의 특정 상호 작용을 통해 매개되며, 이는 막 융합 또는 세포내이입을 유도한다. HBV는 각각 거친 결합(rough binding)과 단단한 결합(tight binding)과 관련된 두 단계를 통해 간세포에 침입하는 것으로 알려져 있다. 바이러스는 헤파란 황산염 프로테오글리칸(heparan sulfate proteoglycans, HSPG)에 의해 매개되는 거친 부착을 통해 간세포 표면에 부착되고, 이어서 나트륨 타우로콜레이트 공동수송 폴리펩타이드(sodium taurocholate cotransporting polypeptide, NTCP)에 단단히 결합하여 세포내이입 매개 내재화를 유도한다. NTCP는 간세포 표면에 특이적으로 발현되는 담즙산 수송체는 HBV가 단단히 결합하는 수용체로 확인되었으며, HBV 표면 단백질은 소형(S), 중간(M), 대형(L) 표면 단백질로 불리는 3개 단위로 구성된다. S 단백질은 HSPG와의 대략적인 상호작용에 관여하는 S 도메인을 포함하며, M 단백질에는 PreS2 및 S 도메인이 포함된다. L 단백질은 PreS1, PreS2 및 S 도메인으로 구성되며, L 단백질의 PreS1 도메인의 N 말단은 HBV와 NTCP의 긴밀한 결합을 매개한다.
본 발명의 상기 간염 바이러스는 A형 간염 바이러스(hepatitis A virus, HAV), B형 간염 바이러스 (Hepatitis B virus, HBV), C형 간염 바이러스 (Hepatitis C virus, HCV), D형 간염 바이러스 (Hepatitis D virus, HDV), E형 간염 바이러스 (Hepatitis E virus, HEV), G형 간염 바이러스 (Hepatitis G virus, HGV), 앱스타인바 바이러스(Epstein-barr virus) 및 거대세포 바이러스 (Cytomegalovirus, CMV)로 이루어진 군에서 선택된 적어도 하나일 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 간염 바이러스 감염 질환이란 간염 바이러스의 감염을 직간접적인 병인으로 하는 모든 질환 및 합병증을 포함할 수 있고, 구체적으로 간염, 간경변증 (liver cirrhosis) 또는 간암 (hepatocellular carcinoma)일 수 있으나, 간염 바이러스의 감염을 직간접적인 병인으로 하는 질환에 해당하는 한 이에 제한되는 것은 아니다.
본 발명의 상기 "예방"이란, 본 발명의 상기 조성물을 이용하여 간염 바이러스의 감염에 의해 발생되는 증상을 차단하거나, 그 증상을 억제 또는 지연시키는 행위라면 제한없이 포함될 수 있다.
본 발명의 상기 "개선"이란, 본 발명의 상기 조성물을 이용하여 간염 바이러스의 감염에 의해 발생되는 증상이 호전되거나 이롭게 되는 모든 행위라면 제한없이 포함할 수 있다.
본 발명의 상기 "치료"란, 본 발명의 상기 조성물을 이용하여 간염 바이러스의 감염에 의해 발생되는 증상이 호전되거나 이롭게 되는 행위라면 제한없이 포함될 수 있다.
본 발명의 상기 조성물들은 약학 조성물 또는 식품 조성물로 구현될 수 있다.
본 발명의 상기 약학 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다.
본 발명에 있어서 상기 약학 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사 용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학 조성물은 약학적으로 허용 가능한 담체를 포함할 수 있다. 상기 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있고, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다.
본 발명의 상기 약학 조성물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서(Elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형화 할 수 있다.
본 발명의 상기 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명의 상기 약학 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. 본 발명에서 상기 "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입 기술을 포함한다.
본 발명의 상기 약학 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약무 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1일 0.0001 내지 50 mg/kg 또는 0.001 내지 50 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 약학 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형화될 수 있다.
본 발명의 상기 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다.
본 발명의 화합물이 유효성분으로 식품 조성물에 포함될 때 그 양은 전체 중량의 0.1 내지 50%의 비율로 첨가할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 상기 식품 조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품 조성물을 포함하는 것 외에 특별한 제한점은 없으며, 통상의 음료와 같이 다양한 향미제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 구체적으로, 천연 탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제(타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제(사카린, 아스파르탐 등) 등일 수 있다.
본 발명의 상기 식품 조성물은 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산 음료에 사용되는 탄산화제 등이 더 포함될 수 있다.
본 발명의 상기 식품 조성물에 포함되는 성분들은 독립적으로 또는 조합하여 사용될 수 있다. 상기 첨가제의 비율은 본 발명의 핵심적인 요소에 해당하지 아니하지만, 본 발명의 식품 조성물 100 중량부 당 0.1 내지 약 50 중량부의 범위에서 선택될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 또 다른 구현 예에 따르면, 투여가 필요한 대상체에게 하기 화학식 1 또는 화학식 2 로 표시되는 펩타이드 또는 이의 약제학적으로 허용되는 염을 유효 성분으로 포함하는 조성물을 유효한 양으로 투여하는 단계를 포함하는 간염 바이러스 감염 질환을 예방, 개선 또는 치료하는 방법을 제공한다:
[화학식 1]
[화학식 2]
본 발명의 상기 화학식에서 m, n, o, R1, R2, R3, R4 각각에 관한 내용, 서열번호, 바이러스 감염 질환 등에 관한 내용은 상기에 기재된 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.
본 발명에서 상기 "투여"는 임의의 적절한 방법으로 대상체에 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 상기 투여가 필요한 "대상체"는 포유동물 및 비-포유동물을 모두 포함할 수 있다. 여기서, 상기 포유동물의 예로는 인간, 비-인간 영장류, 예컨대 침팬지, 다른 유인원 또는 원숭이 종; 축산 동물, 예컨대 소, 말, 양, 염소, 돼지; 사육 동물, 예컨대 토끼, 개 또는 고양이; 실험 동물, 예를 들어 설치류, 예컨대 랫드, 마우스 또는 기니아 피그 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 또한, 본 발명에서 상기 비-포유동물의 예로는 조류 또는 어류 등을 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 조성물에서 유효 성분으로 포함된 펩타이드는 간염 바이러스 감염 질환 치료 효율을 높이기 위하여, 담체와 결합된 형태로 이용할 수 있다. 이때, 상기 담체는 생체에 적합하며 본 발명에서 목적하는 효과를 거둘 수 있는 것이라면 제한 없이 모두 사용할 수 있다. 예를 들어 혈청 알부민, 펩타이드, 면역 글로불린, 헤모시아닌 및 다당체 등에서 선택될 수 있으나, 이에 한정되는 것은 아니다.
본 발명에서 상기와 같이 투여되는 조성물의 제제는 특별히 제한하지 않으며, 고체 형태의 제제, 액체 형태의 제제 또는 흡인용 에어로졸 제제로 투여될 수 있으며, 사용하기 바로 전에 경구 또는 비경구 투여용 액체 형태 제제로 전환되도록 의도되는 고체 형태 제제로 투여될 수 있고, 예를 들면, 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 투여될 수 있으나, 이에 제한되는 것은 아니다.
또한, 본 발명에서 상기 투여 시 본 발명의 조성물과 함께 보조제(adjuvant)를 더 첨가할 수 있으며, 상기 보조제는 약물적인 혹은 면역학적인 물질로 당업계에 알려진 것이라면 제한 없이 모두 사용할 수 있다. 예를 들면, 안정화제로서 당류나 아미노산류, 또한 보조제로서 광물유, 식물유, 백반, 인산알루미늄, 벤토나이트, 실리카, 무라밀디펩타이드(muramyl dipeptide) 유도체, 사이모신, 인터류킨 등을 이용할 수 있다.
또한, 본 발명에서 상기 투여 시 본 발명의 조성물과 함께 약학적으로 허용 가능한 담체를 추가로 투여할 수 있다. 여기서, 상기 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 조성물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서 (elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.
본 발명에 따른 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 비강 내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.
본 발명에서, "약학적으로 유효한 양"은 바람직한 생물학적 결과를 제공하기 위한 작용제의 충분한 양을 지칭한다. 상기 결과는 질환의 징후, 증상 또는 원인의 감소 및/또는 완화, 또는 생물계의 임의의 다른 바람직한 변화일 수 있다. 예를 들어, 예방 또는 치료 용도를 위한 "유효량"은 질환에서 임상적으로 유의한 감소를 제공하는데 요구되는, 본 발명에 개시된 조성물의 양이다. 임의의 개별적인 경우에서 적절한 "효과적인" 양은 일상적인 실험을 사용하여 당업자에 의해 결정될 수 있다. 따라서, 표현 "유효량"은 일반적으로 활성 물질이 치료 효과를 갖는 양을 지칭한다. 본 발명의 경우에, 활성 물질은 상기 화학식 1 또는 화학식 2 로 표시되는 펩타이드 또는 이의 약제학적으로 허용되는 염이자 간염 바이러스 감염 질환의 예방, 개선 또는 치료제이다.
본 발명의 조성물에서 사용된 유효 성분의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1 일 0.0001 내지 100 mg/kg 또는 0.001 내지 100 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.
본 발명의 조성물은 단독으로, 또는 수술, 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.
본 발명의 또 다른 구현 예에서는 약물의 안정성을 향상시키는 방법을 제공한다.
본 발명에서 상기 방법은 안정화 목적의 약물을 수득하는 단계; 및 약물에 포함된 아미노산 서열 중 적어도 둘 이상의 아미노산에 고리형 아마이드를 형성시켜 거대 고리화하는 단계를 포함할 수 있다.
본 발명에서 상기 고리형 아마이드는 락탐화(lactamization) 또는 락톤화(lactonization)를 통해 고리화된 고리형 아마이드 일 수 있고, 구체적으로는 락탐화(lactamization)를 통해 고리화된 고리형 아마이드일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 고리형 아마이드는 고리화에 참가하는 아미노산의 인접한 아미노산 잔기에서의 N-메틸화(methylation), C-말단 변형(C-term modification) 또는 이들의 조합을 포함하는 것을 특징으로 한다.
본 발명에서 상기 고리형 아마이드 내의 락탐화(lactamization) 또는 락톤화(lactonization) 고리는 5개 내지 9개의 고리원자로 구성될 수 있고, 구체적으로는 6개 내지 8개의 고리원자로 구성될 수 있으며, 가장 구체적으로는 7개의 고리원자로 구성될 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 락탐화(lactamization) 또는 락톤화(lactonization)의 고리원자라 함은 선형의 펩타이드(예를 들어 상기 화학식 2의 R2)에 대한 락탐 또는 락톤 고리화에 참여하는 탄소 또는 헤테로 원자를 의미하는 것으로, 락탐화 또는 락톤화 고리원자의 수에서 고리화 대상인 펩타이드(예를 들어 상기 화학식 2의 R2)를 구성하는 원자는 제외된 것이다.
본 발명에서 안정화 목적의 대상이 되는 약물은 바이러스 진입 억제제, cccDNA를 타깃으로 하는 약물, 뉴클레오캡시드(nucleocapsid) 억제제, 폴리머라제(polymerase) 억제제, HBsAg 억제제 및 면역 억제제로 이루어진 군에서 선택된 적어도 하나일 수 있고, 구체적으로 바이러스 진입 억제제일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 바이러스 진입 억제제는 미르클루덱스-B (Myrcludex B, MyrB), 싸이클로스포린 A(Cyclosporin A) 및 에제티미브(Ezetimibe)로 이루어진 군에서 선택된 적어도 하나일 수 있고, 구체적으로는 미르클루덱스-B(MyrB) 약물일 수 있으나, 이에 제한되는 것은 아니다.
본 발명에서 상기 "Myrcludex B(MyrB)" 약물은 NTCP 수용체를 비가역적으로 억제해서 B형간염 바이러스가 간세포로 침입하는 것을 차단하는 약물에 해당하며, HBV의 표면 단백질인 PreS1(surface protein) 도메인 N 말단에서 유래된 47개의 아미노산으로 구성된 Myrcludex B는 B형 간염 바이러스(HBV)와 델타 간염 바이러스(HDV)에 대한 초기 진입 억제제로 잘 알려져 있으나, 선형 펩타이드이기 때문에 생체내 가수분해 효소에 의해 빠르게 분해되는 문제가 있다.
본 발명의 상기 방법은 상기 약물의 안정성 향상을 위한 약물 디자인 전략으로 거대 고리화 방법을 발굴하였으며, 상기 거대 고리화는 락탐화 또는 락톤화를 통해 수행될 수 있고, 고리형 아마이드는 고리화에 참가하는 아미노산의 인접한 아미노산의 N-메틸화(methylation), C-말단 변형(C-term modification) 또는 이들의 조합을 포함함으로써 해당 약물의 체내 가수분해 효소에 의한 분해를 현저히 감소시키면서 간염 바이러스의 침입을 억제하는 효과를 극대화할 수 있다.
본 발명에 따른 신규한 펩타이드는 B형 간염 바이러스의 숙주 침투를 매우 효과적으로 억제함으로써, B형 간염 바이러스 감염 질환의 예방, 개선 또는 치료에 매우 효과적으로 사용될 수 있다.
도 1은 본 발명의 일 실시예에 따른 PreS1 유도체(MyrB-old 및 펩타이드 6 내지 펩타이드 9)에 대해 시험관 내(in vitro) HBV 진입 억제 활성을 확인한 결과를 나타낸 도이다.
도 2는 본 발명의 일 실시예에 따른 전혈 안정성을 확인하기 위해 펩타이드 6 내지 펩타이드 9에 대해 최대 24시간까지 모니터링한 결과를 나타낸 도이다.
도 3은 본 발명의 일 실시예에 따른 (a) PreS/2-48Myr(MyrB-old) 및 Myrcludex B(MyrB)의 시퀀스와 (b) PreS1 유도체(펩타이드 10 내지 펩타이드 13)의 두 번째 라이브러리(2nd library)를 디자인한 것으로 기본 서열은 MyrB의 서열에 따라 수정한 결과를 나타낸 도이다.
도 4는 발명의 일 실시예에 따른 (a) 대조군 (MyrB-old, 펩타이드 8 및 MyrB) 및 PreS1 유도체 (펩타이드 10 내지 펩타이드 13)에 대해 시험관 내(in vitro) HBV 진입 억제 활성을 확인한 결과와 (b) 펩타이드 12 및 13의 더 낮은 범위(0-2.5 nM)에서의 HBV 진입 억제 활성을 확인한 결과를 나타낸 도이다.
도 5는 본 발명의 일 실시예에 따른 MyrB 및 펩타이드 13에 대한 래트 전혈 안정성을 확인한 결과를 나타낸 도이다.
도 6은 본 발명의 일 실시예에 따른 펩타이드 13의 생체 내(in vivo) HBV 진입 억제 효능의 평가를 위해 인간화 마우스 모델을 사용하여 펩타이드 13을 1 mg/kg씩 피하 주사를 통해 투여하고, (a) 혈청 HBV DNA, (b) 세포내 cccDNA, (c) HBsAg 및 (d) HBeAg를 확인한 결과를 나타낸 도이다.
도 7은 본 발명의 일 실시예에 따른 펩타이드 13를 정맥내 주사(intravenous injection)한 마우스 생체 내(in vivo)에서 생체내 약동학 연구 (in vivo pharmacokinetic study, PK study)가 수행된 결과를 나타낸 도이다.
도 8은 본 발명의 일 실시예에 따른 보조제(adjuvant)를 병용하지 않은 경우 펩타이드 13(DL-5-99)의 면역독성 평가를 위해 (a) 보조제 없이 MyrB 또는 펩타이드 13에 의해 유도된 면역 반응 분석을 도식화하고, (b) 피하 주사 일정(subcutaneous injection schedule)에 따라 3일마다 마우스의 체중을 측정하고, (c) 유동 세포 계측법(flow cytometry)을 통해 면역반응을 분석한 결과를 나타낸 것으로, Kruskal-Wallis 통계를 사용하여 그룹간 비교한 도이다.
도 9는 본 발명의 일 실시예에 따른 보조제(adjuvant) 병용투여 시 펩타이드 13(DL-5-99)의 면역독성 평가를 위해 (a) MyrB 또는 펩타이드 13과 보조제에 의해 유도된 면역 반응 분석을 도식화하고, (b) 피하 주사 일정(subcutaneous injection schedule)에 따라 3일마다 마우스의 체중을 측정하고, (c) 유동 세포 계측법(flow cytometry)을 통해 면역반응을 분석한 결과를 나타낸 것으로, Kruskal-Wallis 통계를 사용하여 그룹간 비교한 도이다.
도 10은 본 발명의 일 실시예에 따른 펩타이드 13(DL-5-99)의 항원성 평가(Antigenicity evaluation)를 위해 MyrB 또는 펩타이드 13에 의해 유도된 항체의 분석 결과를 나타낸 도이다.
도 11은 본 발명의 일 실시예에 따른 펩타이드 13 유도체(펩타이드 14 내지 펩타이드 18)의 세 번째 라이브러리(3rd library)를 디자인한 결과를 나타낸 도이다.
도 12는 본 발명의 일 실시예에 따른 MyrB, 펩타이드 13(DL-5-99) 또는 다양한 유도체 화합물의 시험관 내(in vitro) 진입 억제 활성을 비교한 도이다.
[규칙 제91조에 의한 정정 30.07.2025]
도 13은 본 발명의 일 실시예에 따른 MyrB, 펩타이드 13(DL-5-99) 또는 유도체 화합물 펩타이드 18 (DL-7143)의 시험관 내(in vitro) 진입 억제 활성을 비교한 도이다. 도 14및 도 15는 본 발명의 일 실시예에 따른 HPLC 크로마토그램 결과를 나타낸 도이다.
도 13은 본 발명의 일 실시예에 따른 MyrB, 펩타이드 13(DL-5-99) 또는 유도체 화합물 펩타이드 18 (DL-7143)의 시험관 내(in vitro) 진입 억제 활성을 비교한 도이다. 도 14및 도 15는 본 발명의 일 실시예에 따른 HPLC 크로마토그램 결과를 나타낸 도이다.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예
[준비예] 재료 및 기기의 준비
재료의 준비
시약과 용매는 추가로 정제하지 않고 사용하였으며, 링크 아미드 MBHA 수지(Rink amide MBHA resin), 2-클로로트리틸 수지(2- chlorotrityl resin), Fmoc-D-Pro-OH, Fmoc-Lys(Alloc)-OH 및 PyBOP는 Novabiochem(Darmstadt, Germany)에서 구입하였다. HOAt 및 Fmoc-Asp(OAll)은 Advanced ChemTech(미국 켄터키주 루이빌)에서 구입하였다. HATU 및 아미노산은 Chem-Impex International, Inc.(Wood Dale, IL, USA)에서 구입하였다. TFA 및 DMF(> 99.9%, 펩타이드 합성 등급)는 Acros Organics(Fair Lawn, NJ, USA)에서 구입하였으며, 2,4,6-콜리딘(2,4,6-Collidine), 페닐실란(phenylsilane), 2-니트로벤젠설포닐 클로라이드(2-nitrobenzenesulfonyl chloride)는 Alfa Aesar(Ward Hill, MA, USA)에서 구입하였다. 아세토니트릴(HPLC 등급)은 Fisher Scientific(Waltham, MA, USA)에서 구입하였다. DIEA와 모르폴린은 Tokyo Chemical Industry(Tokyo, Japan)에서 구입했으며, 그 외 다른 시약과 용매는 Sigma-Aldrich(미국 미주리주 세인트루이스)에서 구입하였다. 빈 카트리지, 프릿 및 캡 플러그는 Applied Separations(미국 펜실베니아주 Allentown)에서 구입하였으며 Micrococcal nuclease (M0247)는 New England BioLabs (Ipswich, MA, USA)에서 구입하였다. G-spinTM 토탈 키트(14067)는 iNtRON(한국 성남)에서 구입하였으며, 시스테인 함유 MyrB와 시스테인 함유 펩타이드 13은 Anygen(Gwangju, Korea)에서 구입하였다.
기기의 준비
분석 HPLC는 C18 컬럼(SunFire, C18, 4.6 Υ 250mm, 5μm)이 있는 Waters HPLC 시스템(Waters 2489 UV-가시광선 검출기, Waters 1525 바이너리 HPLC 펌프, Waters 2707 자동 샘플러 및 Water 5CH 컬럼 오븐)에서 수행되었다. 컬럼 오븐 온도는 40℃로 설정되었고, 이원 이동상은 다음과 같이 사용되었다:(A, 0.1% CF3COOH가 포함된 물, B, 0.1% CF3COOH가 포함된 CH3CN, 유속, 1mL/분), 10% B를 사용하여 0~5분, 5~25분 동안 100% B로 선형 구배, 100% B를 사용하여 25-30분. 화합물은 220 nm 및 254 nm에서 모니터링하였다.
분취 HPLC는 C18 컬럼(SunFire, C18, 19 x 150mm, 5μm)을 사용하여 Waters HPLC 시스템(Waters prepLC 시스템, Waters 2545 4차 HPLC 펌프, Waters 2489 UV-가시광선 검출기, Waters 분획 수집기 III)에서 수행되었다. 14mL/분의 유속. 분취용 HPLC는 분석용 HPLC와 동일한 이동상 조건에서 수행되었으며, 시료 용출은 흡광도로 220 및 254 nm에서 모니터링되었다. 각 분획의 순도는 분석용 HPLC의 UV-가시선 검출기로 확인되었다. 순도가 97%를 초과하는 분획을 수집하고 동결건조한 후 -80℃에서 보관하였다.
LC-MS는 Agilent Technology infinity 1260 시스템(Quaternary 펌프, 자동 샘플러, 온도 컨트롤러 및 Hewlett Packard 시리즈 1100 검출기) 및 C18 컬럼(Poroshell, 120 EC-C18, 4.6 x 50mm, 2.7μm). 컬럼 가열 온도는 50℃로 설정되었다. 이원 이동상은 다음과 같이 사용되었다: (A, 0.1% CF3COOH가 포함된 물; B, 0.1% CF3COOH가 포함된 CH3CN, 유속, 0.8mL/분), 5% B를 사용하여 0~3분, 3~8분 100% B로 선형 구배, 100% B를 사용하여 8-11분. 화합물은 220 nm 및 254 nm에서 모니터링하였다.
[제조예] 후보물질인 펩타이드 1 내지 18 합성
2.1. 고리형 펩타이드의 일반적인 합성
링크 아미드 수지(Rink amide resin, 250mg, 0.13mmol, 로딩 0.52mmol/g) 또는 Fmoc-Ala-Wang 수지 LL(110mg, 0.13mmol, 로딩 1.14mmol/g)을 CH2Cl2(2mL)에 실온에서 20분간 팽윤시켰다. Fmoc 탈보호(deprotection)는 DMF(2 mL) 중 20%(v/v) 피페리딘을 사용하여 실온에서 5분 동안 수행되었다. 수지를 CH2Cl2(Υ2), DMF(Υ2), MeOH(Υ1), DMF(Υ2) 및 CH2Cl2(Υ2)로 세척하였다. DMF(2 mL) 중 원하는 아미노산(3.0 당량), HATU(150 mg, 0.39 mmol, 3.0 당량) 및 DIEA(140 mg, 0.3 mL, 1.0 mmol, 8.0 당량)를 수지에 첨가하고 커플링시켰다. 반응은 마이크로파 조사(75℃, 400W 최대 전력, 75%, 램프 2.5분, 유지 8.0분, 교반 레벨 3) 하에 수행되었고, 수지를 DMF(Υ1), CH2Cl2(Υ2), DMF(Υ2), MeOH(Υ1), DMF(Υ2) 및 CH2Cl2(Υ2)로 세척하였다. 원하는 순서가 얻어질 때까지 두 단계를 반복하였다. 선형 펩타이드 합성 후 고리화 부위의 알릴기(allyl group)나 산불안정기(acid-labile group)가 제거되었다. CH2Cl2(2mL)에 Pd(PPh3)4(15mg, 0.013mmol, 0.1당량) 및 PhSiH3(340mg, 0.34mL, 3.1mmol, 24.0당량)을 첨가하여 알릴 탈보호(Allyl deprotection)를 실온에서 3시간 동안 수행하였다. 수지를 CH2Cl2(Υ2), DMF(Υ2), MeOH(Υ1), DMF(Υ2) 및 CH2Cl2(Υ2)로 세척하였다. 그런 다음, 수지를 TFA:TIS:CH2Cl2(v/v/v) 2.5:2.5:95로 처리하고 실온에서 2분간 교반하여 잔류 팔라듐을 제거하였다. 수지를 CH2Cl2(Υ2), DMF(Υ2), MeOH(Υ1), DMF(Υ2) 및 CH2Cl2(Υ2)로 세척하였다. 이 세척 단계를 3회 반복했다. 산에 불안정한 보호 그룹(acid-labile protecting group)의 경우, 수지를 TFA:TIS:CH2Cl2(v/v/v) 2:2:96으로 처리하고 실온에서 2분 동안 교반했다. 수지를 CH2Cl2(Υ2), DMF(Υ2), MeOH(Υ1), DMF(Υ2) 및 CH2Cl2(Υ2)로 세척하였다. 이 탈보호 단계를 2회 반복했다. 보호기를 제거한 후, 수지를 DMF 중 10%(v/v) DIEA로 처리하고 실온에서 10분 동안 교반하여 유리 아민을 중화시켰다. 수지를 CH2Cl2(Υ2), DMF(Υ2), MeOH(Υ1), DMF(Υ2) 및 CH2Cl2(Υ2)로 세척하였다. 그런 다음, PyBOP(340mg, 0.65mmol, 5.0당량), HOAt(90mg, 0.65mmol, 5.0당량) 및 DIEA(170mg, 0.2mL, 1.3mmol, 10.0당량)를 첨가하여 거대고리화를 수행했다. DMF(2mL)에 실온에서 2시간 동안 담가두었다. 수지를 CH2Cl2(Υ2), DMF(Υ2), MeOH(Υ1), DMF(Υ2) 및 CH2Cl2(Υ2)로 세척하였다. 거대고리화 후, DMF(2mL) 중 20%(v/v) 피페리딘을 사용하여 Fmoc 탈보호를 수행했다. DMF에 미리스트산(90mg, 0.39mmol, 3.0당량), HATU(150mg, 0.39mmol, 3.0당량) 및 DIEA(130mg, 0.18mL, 1.0mmol, 8.0당량)를 첨가하여 미리스토일화를 수행했다. (2mL). 혼합물을 마이크로파 조사(75℃, 400W, 75% 전력, 램프 2.5분, 유지 8.0분, 교반 레벨 3) 하에 교반하였다. 수지를 CH2Cl2(Υ2), DMF(Υ2), MeOH(Υ1), DMF(Υ2) 및 CH2Cl2(Υ2)로 세척하였다. TFA:TIS:CH2Cl2(v/v/v) 95:2.5:2.5로 실온에서 2시간 동안 분해하여 조 물질을 얻었다. N2 가스 흐름에 의해 TFA 용액을 제거하고, 잔류물을 1:1(v/v) 물/아세토니트릴에 용해시킨 후 0.45μm PTFE 주사기 필터로 여과했다. 조 물질을 분취용 HPLC로 정제하여 원하는 생성물을 얻었다. 순도가 97% 이상인 분획을 수집하여 동결건조한 후 -80℃에 보관하였다. 펩타이드 17 및 18의 경우, 펩타이드(1.0 당량)를 DIEA(20.0 당량)와 함께 DMF에 용해시켜 잔류 TFA를 제거했다. 원하는 아민(3.0 당량) 및 HATU(3.0 당량)를 용액에 첨가하고, 혼합물을 실온에서 3시간 동안 교반하여 C-말단 변형을 촉진했다. 이어서, 조 물질(crude)을 분취용 HPLC로 정제하였다.
(a) 펩타이드 합성 중 아스파르트이미드 형성 메커니즘
(b) 아스파르트이미드 형성 억제를 위한 변형된 측쇄 보호를 갖는 아스파르트산
하기 표 2의 제조예에서 펩타이드 1 내지 18를 제조하였다.
| 제조예 | 화합물 |
| 펩타이드 1 | |
| 펩타이드 2 | |
| 펩타이드 3 | |
| 펩타이드 4 | |
| 펩타이드 5 | |
| 펩타이드 6 | |
| 펩타이드 7 | |
| 펩타이드 8 | |
| 펩타이드 9 | |
| 펩타이드 10 | |
| 펩타이드 11 | |
| 펩타이드 12 | |
| 펩타이드 13 | |
| 펩타이드 14 | |
| 펩타이드 15 | |
| 펩타이드 16 | |
| 펩타이드 17 | |
| 펩타이드 18 | |
| PreS1(MyrB-old) | |
| MyrB |
[제조방법 1] 펩타이드 5의 합성
[제조방법 2] 비오티닐화된 MyrB의 합성
면역원성 실험을 위하여 바이오티닐화된 MyrB를 합성하였다. 시스테인 함유 MyrB는 위에서 언급한 일반적인 펩타이드 합성 프로토콜에 따라 획득되었다. 그런 다음, 시스테인 함유 MyrB(2.8mg, 0.5μmol, 1.0당량)를 5% DMSO/PBS 완충 용액(1mL)에 용해시켰다. 비오틴-말레이미드(2.3mg, 5μmol, 10.0당량)를 5% DMSO/PBS 완충액(1mL)에 용해시키고, 이 용액을 시스테인 함유 MyrB 용액에 부었다. 혼합물을 실온에서 3시간 동안 교반하고, 원하는 생성물을 LC-MS로 확인하였다. 이어서, 조 물질(crude)을 1:1(v/v) 물/아세토니트릴 용액으로 희석하고 분취용 HPLC로 정제하여 원하는 생성물을 얻었다.
[제조방법 3] 비오티닐화 펩타이드 13의 합성
상기에서 언급한 일반적인 펩타이드 합성 프로토콜에 따라 시스테인 함유 펩타이드 13(25μmol)을 얻었다. 시스테인의 산화-이황화 결합, 또는 설펜(sulfenic), 설핀(sulfinic), 또는 설폰(sulfonic)의 형성을 고려해야 한다. 실온에서 TFA:TIS:1,2-에탄디티올(1,2-ethanedithiol): 티오아니솔(thioanisole): NH4I:H2O (v/v/v/v/v) 82.5:5:3.5:2.5:1.5:5를 사용하여 특정 분해를 통해 조 물질을 얻었다. 2시간 N2 가스 흐름에 의해 TFA 용액을 제거하고, 에틸 아세테이트를 유성 잔류물에 부었다. 나타난 침전물을 모아 5% DMSO/PBS 용액에 용해시켰다. 그런 다음, 비오틴-말레이미드 용액(100 mM DMSO 스톡, 12 μmol, 120 μL, 0.5 당량)을 반응 혼합물에 첨가하고 용액을 실온에서 1.5시간 동안 교반했다. 조 물질을 1:1(v/v) 물/아세토니트릴 용액으로 희석하고 분취용 HPLC로 정제하여 원하는 생성물을 얻었다. 순도가 97% 이상인 분획을 수집하여 동결건조한 후 -80℃에 보관했다.
[실험 방법]
[실험 방법 1]
시험관 내 HBV 진입 억제 분석(
In vitro
HBV entry inhibition assay)
HepG2-NTCP는 10% FBS가 포함된 DMEM 및 스트렙토마이신 0.1mg/mL이 포함된 100U 페니실린에서 5% CO2로 37℃에서 배양되었다. PCR로 테스트한 모든 유지 세포(maintained cell)는 마이코플라스마 음성이었다. HepG2-NTCP를 표시된 고리형 펩타이드가 포함된 12웰 플레이트에서 2시간 동안 배양한 후 세포를 HBV 입자(mL당 2 x 106개의 바이러스 카피)로 감염시키고 표시된 고리형 펩타이드로 추가 3시간 동안 처리했다. 바이러스 함유 배지를 제거한 후, 표시된 고리형 펩타이드가 없는 상태에서 세포를 추가로 16시간 동안 배양했다.
세포를 지정된 고리형 펩타이드(indicated cyclic peptides)로 처리한 후, 세포내 HBV DNA였던 HBV DNA를 추출하고, 정제하고 정량적 PCR로 정량화하였다. 세포 내 HBV DNA를 분리하기 위해 세포를 용해 완충액(50mM Tris-HCl, pH 7.5, 1mM EDTA, 1% NP40)을 사용하여 얼음 위에서 10분간 용해시켰다. 15,000 x g에서 원심분리하여 세포 파편과 핵을 제거한 후 상층액을 마이크로코칼 뉴클레아제(0.25 U/μL)로 37℃에서 1시간 동안 처리했다. 이어서, EGTA를 최종 농도 10 mM로 첨가하여 마이크로코칼 뉴클레아제를 불활성화시켰다. 그 후 G-spinTM 토털 키트를 사용하여 세포 내 HBV DNA를 추출했다. 분리된 세포내 HBV DNA를 HBV DNA 프라이머 및 프로브 세트를 사용하여 PCR을 실시하였다(프라이머: 정방향: 5'-TCCTCTTCATCCTGCTGCTAT G-3', 역방향: 5'- CGTGCTGGTAGTTGATGTTCCT, 프로브: 5'- TATTGTTCTTCTGGACTA).
[실험 방법 2]
쥐 전혈 안정성(Rat whole blood stability) 분석
헤파린 처리된 쥐 전혈(49μL)(f/c. 2% DMSO 중 20μM)이 들어 있는 각 튜브에 고리형 펩타이드(1μL, 1mM DMSO 스톡)를 첨가했다. 용액을 37℃ 수조에서 0, 1, 3, 6 및 24시간 동안 배양했다. 그런 다음 2% SDS와 5mM EDTA(50μL)가 포함된 물을 각 튜브에 첨가하고 튜브를 5분간 초음파 처리했다. 용액을 0.1% 트리플루오로아세트산이 함유된 아세토니트릴(200 μL)로 희석하고 와류시킨 후 5000 rpm에서 10분간 원심분리하여 세포 성분을 침전시켰다. 투명한 상층액을 0.2 μm PTFE 주사기 필터(whatman)로 여과하고 LC-MS에서 선택 이온 모드(SIM)를 사용하여 분석하여 온전한 펩타이드를 정량화하였다.
[실험 방법 3]
MTS 분석
인간 간암세포(HepG2)와 인간 폐세포(MRC-5)는 한국세포주은행에서 구입하였다. 이들 모두는 5% CO2, 37℃, 10% FBS가 포함된 DMEM 배지에서 배양하였다. MTS 세포 생존율은 고리형 펩타이드가 세포 성장에 미치는 영향을 확인하기 위해 측정되었다. 2 x 104 HepG2 및 1.3 x 104 MRC-5를 포함하는 배지의 분취량(100 μL)을 96웰 플레이트의 각 웰에 분배하였다. 세포를 37℃ 공기 중 5% CO2의 가습된 분위기에서 성장시키고 24시간 동안 부착되도록 하였다. 세포 밀도가 약 70% 컨플루언시(confluency)에 도달하면 배지를 배지 내 고리형 펩타이드 스톡의 연속 희석액으로 교체하고 24시간 동안 배양하였다. 테트라졸륨 화합물[MTS3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS]을 함유한 CellTiter 96 수성 비방사성 세포 증식 분석 시약 20을 각 웰에 추가하고, 플레이트를 37℃에서 4시간 동안 배양하여 대사시켰다. 생존 세포의 MTS-포르마잔 생성물은 마이크로플레이트 판독기를 사용하여 490nm에서 측정되었으며, 처리되지 않은 세포와 비교하여 세포 생존율(%)을 백분율로 측정하였다. 세포 생존율의 백분율 = A/Acontrol X 100, 여기서 A는 테스트 웰의 흡광도이고 Acontrol은 고리형 펩타이드로 처리되지 않은 세포가 포함된 웰의 평균 흡광도이다.
[실험 방법 4]
생체 내 HBV 진입 억제 분석(
In vivo
HBV entry inhibition assay)
인간 간-키메라 uPA/SCID(PXB) 마우스는 PhoenixBio Co., Ltd.(일본 히가시-히로시마 소재)에서 수득하였다. 3주령 uPA/SCID 마우스는 비장을 통해 인간 간세포(마우스당 105 내지 106개 세포)를 이식받았고, 인간 간세포 이식 후 9주가 되었을 때, 모든 생쥐의 교체 지수는 90%를 초과했다. 17주령에 쥐를 동물 연구 센터로 옮기고 HepG2.2.15 세포(마우스당 1.3 Υ 106 카피, 유전자형 D)로부터 인간 HBV 비리온을 단일 정맥 주사했다. 6주 후, 인간 간세포의 지속적인 HBV 감염이 키메라 간에서 확립되었다. 22주령에 마우스는 고리형 펩타이드(kg당 1mg, n = 3) 또는 비히클(n = 3)로 매일 피하 치료를 시작했고, 혈청 HBV DNA를 측정하기 위해 매주 안와동에서 혈청 샘플을 수집하였다. 동물 실험은 동물 실험 위원회의 지침에 따라 수행되었으며, 감염, 혈청 샘플 추출 및 희생은 에테르 마취 하에 수행되었다.
[실험 방법 5]
HPLC 크로마토그램(HPLC chromatogram)
[규칙 제91조에 의한 정정 30.07.2025]
-HPLC 크로마토그램 결과를 도 14에 나타내었다.
-HPLC 크로마토그램 결과를 도 14에 나타내었다.
[규칙 제91조에 의한 정정 30.07.2025]
-HPLC 크로마토그램 결과를 도 15에 나타내었다.
-HPLC 크로마토그램 결과를 도 15에 나타내었다.
[실험 방법 6]
ESI-MS 데이터
| 펩타이드 | 시퀀스 | Calc. m/z, [M+2H]2+ | Obs. m/z, [M+2H]2+ |
| 1 | Myr-GQNLSTSNPLGFFPDHQLDPAFRANS-OH | 1520.8 | 1521.0 |
| 2 | Myr-GQNLSTSNPLGFFPEHQLDPAFRANS-OH | 1518.8 | 1519.1 |
| 3 | Myr-GQNLSTSNPLGFFPDHQLDPA-OH | 1233.2 | 1233.3 |
| 4 | Myr-GQNLSTSNPLGFFPDHQLD-OH | 1149.1 | 1149.6 |
| 5 | Myr-GQNLSTSNPLGFFPDHQLD | 1140.1 | 1140.0 |
| 6 | Myr-GQNLSTSNPLGFFPDH*QLDPA-OH | 1240.2 | 1240.7 |
| 7 | Myr-GQNLSTSNPLGFFPDH*QLDPA-OH | 1231.2 | 1231.4 |
| 8 | Myr-GQNLKTSNPLGFFPDH*QLDPA-OH | 1251.7 | 1251.6 |
| 9 | Myr-GQNLDprSNPLGFFPDH*QLDPA-OH | 1230.7 | 1231.1 |
| 10 | Myr-GTNLKVPNPLGFFPDH*QLDPA-OH | 1242.2 | 1242.2 |
| 11 | Myr-GTNLKVPNPLGFFPDH*QLDPA-NH2 | 1241.7 | 1241.8 |
| 12 | Myr-GTNLKVPNPLGFFPDR*QLDPA-OH | 1251.7 | 1251.8 |
| 13 | Myr-GTNLKVPNPLGFFPDR*QLDPA-NH2 | 1251.2 | 1251.2 |
| 14 | Myr-GTNLKVPNPLGFFPD-NH2 | 904.0 | 903.8 |
| 15 | Myr-GTNLKVPNPLGFFPDR*QLDP-NH2 | 1215.7 | 1215.7 |
| 16 | Myr-GTNLKVPNPLGFFPDR*QLDp-NH2 | 1215.7 | 1215.7 |
| 17 | Myr-GTNLKVPNPLGFFPDR*QLDP-NEt2 | 1243.7 | 1243.6 |
| 18 | Myr-GTNLKVPNPLGFFPDR*QLDP-R (morpholinyl) | 1250.7 | 1251.0 |
| 두 개의 굵은 글자체의 아미노산 잔기 사이의 거대고리화에 의해 원하는 생성물을 얻었다. a측쇄-꼬리 고리화에 의해 원하는 화합물이 생성됨. H*, N-메틸화 히스티딘; Dpr, 디아미노프로피온산; R*, N-메틸-아르기닌. 소문자 p는 D-proline임. | |||
| 보조제 X(Without adjuvant) | |||
| Negative control (n = 5) |
MyrB, 2 mg/kg (n = 5) |
Peptide 13, 2 mg/kg (n = 5) |
|
| γ-GT (U/L) | 1.00 | 1.00 | 1.00 |
| ALT (U/L) | 20 ± 3 | 22 ± 2 | 20 ± 1 |
| AST (U/L) | 60 ± 10 | 58 ± 13 | 62 ± 12 |
| ALP (U/L) | 540 ± 80 | 600 ± 50 | 600 ± 40 |
| Glucose (mg/dL) | 340 ± 30 | 360 ± 20 | 360 ± 40 |
| TG (mg/dL) | 114 ± 6 | 113 ± 5 | 100 ± 6 |
| T-CHO (mg/dL) | 86 ± 8 | 86 ± 3 | 89 ± 7 |
| BUN (mg/dL) | 18 ± 2 | 21 ± 2 | 19 ± 1 |
| Creatinine (mg/dL) | 0.18 ± 0.01 | 0.18 ± 0.05 | 0.16 ± 0.01 |
| Total protein (gdL) | 5.4 ± 0.2 | 5.5 ± 0.2 | 5.2 ± 0.2 |
| Albumin (g/dL) | 2.9 ± 0.2 | 3.0 ± 0.1 | 2.7 ± 0.1 |
| Total bilirubin (mg/dL) | 0.44 ± 0.08 | 0.36 ± 0.05 | 0.42 ± 0.04 |
| Ca (mg/dL) | 12.0 ± 0.3 | 12.1 ± 0.3 | 12.2 ± 0.2 |
| P (mg/dL) | 7.3 ± 1.1 | 6.7 ± 0.6 | 6.2 ± 0.6 |
| Mg (mg/dL) | 2.9 ± 0.3 | 2.7 ± 0.2 | 2.6 ± 0.1 |
| 보조제 O(With adjuvant) | |||
| Negative control (n = 5) |
MyrB, 2 mg/kg (n = 5) |
Peptide 13, 2 mg/kg (n = 5) |
|
| γ-GT (U/L) | 1.00 | 1.00 | 1.00 |
| ALT (U/L) | 20 ± 3 | 21 ± 4 | 19 ± 1 |
| AST (U/L) | 66 ± 12 | 103 ± 27 | 58 ± 7 |
| ALP (U/L) | 370 ± 50 | 270 ± 80 | 380 ± 40 |
| Glucose (mg/dL) | 340 ± 30 | 340 ± 60 | 330 ± 10 |
| TG (mg/dL) | 120 ± 30 | 120 ± 10 | 110 ± 10 |
| T-CHO (mg/dL) | 91 ± 3 | 88 ± 6 | 86 ± 2 |
| BUN (mg/dL) | 21 ± 3 | 18 ± 2 | 23 ± 3 |
| Creatinine (mg/dL) | 0.23 ± 0.02 | 0.25 ± 0.02 | 0.33 ± 0.06 |
| Total protein (gdL) | 5.4 ± 0.3 | 5.3 ± 0.1 | 5.3 ± 0.1 |
| Albumin (g/dL) | 2.8 ± 0.2 | 2.4 ± 0.2 | 2.7 ± 0.3 |
| Total bilirubin (mg/dL) | 0.32 ± 0.07 | 0.34 ± 0.15 | 0.30 ± 0.00 |
| Ca (mg/dL) | 12.5 ± 0.3 | 12.1 ± 0.3 | 12.2 ± 0.5 |
| P (mg/dL) | 7.0 ± 0.4 | 8.0 ± 1.5 | 7.6 ± 0.3 |
| Mg (mg/dL) | 2.5 ± 0.2 | 2.7 ± 0.1 | 2.6 ± 0.3 |
| 데이터는 평균 ± 표준 편차로 표현되었음. MyrB 그룹과 펩타이드 13 그룹은 음성 대조군과 비교하여 유의하지 않았음(p-값 > 0.05). Kruskal-Wallis 통계를 사용하여 그룹을 비교함. 약어: γ-GT, 감마-글루타밀 전이효소; ALT, 알라닌 트랜스아미나제; AST, 아스파르테이트 트랜스아미나제; ALP, 알칼리성 포스파타제; TG, 트리글리세리드; T-CHO, 총 콜레스테롤; BUN, 혈액 요소 질소; Ca, 칼슘; P, 인; Mg, 마그네슘. | |||
[실험결과]
[실시예 1]
첫 번째 라이브러리: 수정 전략(modification strategies) 최적화
| Entry | 시퀀스 | Generation |
| HBV PreS1(MyrB-old) | Myr-GQNLSTSNPLGFFPDHQLDPAFRANTANPDWDFNPNKDTWPDANKVG-NH2 | |
| 1 | Myr-GQNLSTSNPLGFFPDHQLDPAFRANS-OH | 1st library |
| 2 | Myr-GQNLSTSNPLGFFPEHQLDPAFRANS-OH | |
| 3 | Myr-GQNLSTSNPLGFFPDHQLDPA-OH | |
| 4 | Myr-GQNLSTSNPLGFFPDHQLD-OH | |
| 5 | Myr-GQNLSTSNPLGFFPDHQLD | |
| 6 | Myr-GQNLSTSNPLGFFPDH*QLDPA-OH | |
| 7 | Myr-GQNLSTSNPLGFFPD H*QLDPA-OH | |
| 8 | Myr-GQNLKTSNPLGFFPD H*QLDPA-OH | |
| 9 | Myr-GQNLDprSNPLGFFPD H*QLDPA-OH | |
|
Myrcludex B
(MyrB) |
Myr-GTNLSVPNPLGFFPDHQLDPAFGANSNNPDWDFNPNKDHWPEANKVG-NH2 | |
| 10 | Myr-GTNLKVPNPLGFFPD H*QLDPA-OH | 2nd library |
| 11 | Myr-GTNLKVPNPLGFFPD H*QLDPA-NH2 | |
| 12 | Myr-GTNLKVPNPLGFFPD R*QLDPA-OH | |
| 13 | Myr-GTNLKVPNPLGFFPD R*QLDPA-NH2 | |
| 14 | Myr-GTNLKVPNPLGFFPD-NH2 | 3rd library |
| 15 | Myr-GTNLKVPNPLGFFPD R*QLDP-NH2 | |
| 16 | Myr-GTNLKVPNPLGFFPD R*QLDp-NH2 | |
| 17 | Myr-GTNLKVPNPLGFFPD R*QLDP-NEt2 | |
| 18 | Myr-GTNLKVPNPLGFFPD R*QLDP-R (morpholinyl) | |
| 거대고리 펩타이드는 측쇄 대 측쇄 거대고리화에 의해 얻어짐. 두 개의 밑줄친 굵은 글자체의 아미노산 사이에서 거대고리화를 수행함. a측쇄-꼬리 거대고리화에 의해 원하는 화합물이 생성됨. Dpr, 디아미노프로피온산; H*, N-메틸-히스티딘; R*, N-메틸-아르기닌. 소문자 p는 D-proline임 | ||
간세포에서 HBV의 큰 표면 단백질과 NTCP 사이의 단백질-단백질 상호 작용을 매개하는 PreS1 서열이 이미 알려져 있다. 이 서열을 기반으로 본 발명자들은 C 말단 절단, 거대고리화 및 측쇄를 통해 안정성과 항바이러스 활성을 향상시키는 PreS1 유도체를 설계하고자 하였다(표 2 참조). 이전에 PreS1에 대해 약물단(pharmacophore)과 액세서리 도메인이 보고되었으며, 합성 비용과 수율을 개선하기 위해 액세서리 도메인을 잘라서 펩타이드 1과 3을 제공했다. 그러나 거대고리화 단계에서 아스파르트이미드 (aspartimide) 형성이 관찰되었다. 펩타이드 1과 3의 Ser5와 Asp15 사이의 거대락톤화는 거대고리형 펩타이드 대신 아스파르트이미드 화합물을 생성했다. 펩타이드 2는 아스파르트산을 탄소가 1개 더 많은 글루타민산으로 대체하여 설계했지만 여전히 글루타르이미드(glutarimide)가 관찰되었다. 이에, 아스파르트이미드 형성이 양성자 제거된 아미드가 활성화된 카르복실산으로 공격함으로써 발생한다고 생각되었고, 아스파르트이미드 문제를 해결하기 위해 반응 부위를 제거하기로 결정하였다.
먼저, 아스파르트이미드 형성과 관련된 아미드 양성자를 배제하기 위해 펩타이드 3에 비해 두 개의 아미노산을 더 제거하여 펩타이드 4를 얻었다. 측쇄에서 C 말단 거대고리화를 통해 펩타이드 5를 얻었다. 둘째, N-메틸 아미노산은 수지 상의 고리화 동안 아스파르트이미드 형성을 피하기 위해 위치 16에 채택되었다. 펩타이드 6은 16번 위치에 N-메틸화 히스티딘이 치환되어 디자인되었으며, 고리화된 화합물(펩타이드 7)이 관찰되었다. 그러나 펩타이드 5와 7은 각각 낮은 안정성과 낮은 합성 수율에 직면하였다. 펩타이드 5는 수성 매질에서 자발적으로 분해됨이 관찰되었으며, 펩타이드 6의 거대락톤화 전환은 5% 미만이다. 따라서, 안정성과 수율을 향상시키기 위해 마크로락톤화 대신 마크로락탐화가 활용되었고, 펩타이드 8과 10은 마크로락탐 고리를 채택하여 디자인되었다.
첫 번째 라이브러리의 PreS1 유도체는 SPPS(고체상 펩타이드 합성) 프로토콜을 사용하여 합성되었다. 펩타이드 합성에는 일반적으로 Wang 레진을 사용하였고, 2-클로로트리틸 레진은 C-말단에 측쇄로 거대락톤화가 형성된 펩타이드 5에만 사용하였다. Fmoc 탈보호(Fmoc deprotection)는 DMF 중의 20%(v/v) 피페리딘으로 수행하였고, 실온에서 HATU, 원하는 아미노산 및 DIEA를 첨가하여 펩타이드 커플링을 수행하였다. 각각의 선형 서열은 Fmoc 탈보호 및 펩타이드 커플링의 반복을 통해 연장되었다. 원하는 선형 펩타이드를 얻은 후 각 조건별로 부분 보호기를 제거하였다. 알릴 보호기 그룹(allyl protecting group)에는 Pd(PPh3)4 및 PhSiH3를 첨가하고, 트리틸 보호기 그룹(trityl protecting group)에는 약산성 칵테일(TFA:TIS:CH2Cl2 2.5:2.5:95)을 처리하였다. PyBOP 및 HOBt를 첨가하여 펩타이드 8 및 9에 대한 수지 상의 고리화를 수행하였고, LC-MS 및 HPLC에 의해 >99% 전환이 관찰되었다. 펩타이드 5에 대해서도 동일한 조건으로 마크로락톤화를 진행하였지만, LC-MS를 통해 낮은 전환율을 확인하였다. 그런 다음, 미리스트산(myristic acid)과 HATU를 첨가하여 미리스토일기(myristoyl group)를 N-말단에 부착시켰다. 원하는 생성물은 TFA:TIS:CH2Cl2 95:2.5:2.5(v/v/v)에 의해 절단되었다. 아래 반응식 1은 레진상 거대 락톤화(macrolactonization) 또는 거대 락탐화(macrolactamization)를 이용한 펩타이드 7, 8 및 9의 합성 방법을 나타낸다.
PreS1 유도체(MyrB-old 및 펩타이드 6-9)에 대해 시험관 내 HBV 진입 억제 활성이 확인되었다(도 1 참조). 펩타이드 6-9는 MyrB-old와 비교하여 비슷한 HBV 진입 억제 활성을 보여주었다. 펩타이드 8은 HBV 진입 억제에서 최고의 효능을 보여주었다(IC50 = 6.5 nM). 전혈 안정성은 펩타이드 6-9에 대해 시점(0, 3, 6, 24시간)에서 최대 24시간까지 모니터링하였다(도 2 참조). 예상한 대로 선형 펩타이드와 에스테르 결합을 포함하는 거대고리 펩타이드(펩타이드 6 및 7)는 아미드 결합을 채택한 거대고리 펩타이드(펩타이드 8 및 9)보다 혈액에서 더 빨리 분해되었다. 그들은 24시간 배양 후 온전한 펩타이드의 > 95%를 나타냈는데, 이는 반감기(t1/2) > 24시간을 의미한다.
[실시예 2]
두 번째 라이브러리: 억제 활성 최적화
첫 번째 라이브러리에서는 HBV 진입 억제 활성을 유지하면서 합성 경로와 안정성을 향상시키기 위해 C 말단 절단(C-terminal truncation) 및 측쇄를 측쇄 고리화(side chain cyclization, 예를 들어, 펩타이드 8)하여 모 서열(parent sequence)을 수정했다. 최근 Myrcludex B(MyrB)가 강력한 HBV 진입 억제 활성을 나타내도록 서열이 최적화된 선구적인 진입 억제제로 공개된 바 있다. 이전에 보고된 것보다 증가된 억제 활성을 보였으며 임상 3상 시험이 진행 중이다. 여기에서는 MyrB 서열에 대해 C 말단 절단, 고리화 및 백본 N-메틸화와 같은 첫 번째 라이브러리에서 확립된 변형 전략이 채택되었다. 아미노산 치환 및 C 말단 변형에 따라 4개의 유도체가 설계되었다(도 3 참조).
펩타이드 13의 합성은 두 번째 라이브러리의 유도체를 대표하는 것으로 상기 반응식 2로 표시된다.
두 번째 라이브러리의 PreS1 파생물은 SPPS 프로토콜을 사용하여 합성하였다. 대표적인 전체 합성 계획은 상기 반응식 2에 설명하였다. 고체 지지체 수지는 C-말단 그룹에 따라 선택되었다: 카르복실산 그룹의 경우 Wang 수지, 아미드 그룹의 경우 링크 아미드 MBHA 수지. Fmoc 탈보호는 DMF 중의 20%(v/v) 피페리딘으로 수행하였고, 실온에서 HATU, 원하는 아미노산 및 DIEA를 첨가하여 펩타이드 커플링을 수행하였다. 각각의 선형 서열은 Fmoc 탈보호 및 펩타이드 커플링의 반복을 통해 연장되었다. 원하는 선형 펩타이드를 얻은 후 CH2Cl2 용액에 Pd(PPh3)4 및 PhSiH3를 첨가하여 동맹 그룹을 제거한 다음 약한 산성 조건(2.5% TFA 용액)을 2분간 3회 처리하여 잔류 팔라듐 부가물을 세척하였다. 수지를 DMF 용액 중 10%(v/v) DIEA 하에서 교반하여 반응 부위를 중화시켰다. PyBOP 및 HOAt를 첨가하여 수지 상의 고리화를 수행하였고, LC-MS 및 HPLC에 의해 > 99% 전환이 관찰되었다. 그런 다음, 미리스트산(myristic acid)과 HATU를 첨가하여 미리스토일기를 N-말단에 부착시켰다. 원하는 생성물은 고체 지지 수지로부터 링크 아미드 수지의 경우 TFA:TIS:CH2Cl2 95:2.5:2.5(v/v/v) 또는 고체의 Wang 수지의 경우 TFA:TIS:H2O 95:2.5:2.5(v/v/v)에 의해 절단되었다.
시험 관내 HBV 진입 억제 활성은 대조군 (MyrB-old, 펩타이드 8 및 MyrB) 및 PreS1 유도체 (펩타이드 10-13)에 대해 확인되었다 (도 4a 참조). MyrB는 MyrB-old 또는 펩타이드 8보다 HBV 진입 억제에서 더 낮은 IC50 값을 나타냈는데, 이는 새로 확립된 서열이 이전 서열보다 더 강력하다는 것을 의미하는 것이다. 펩타이드 10-13은 MyrB와 비교하여 비슷한 HBV 진입 억제 활성을 보여주었다. MeArg16 (16번째 위치 N-methyl arginine) 함유 유도체(펩타이드 11 및 13)는 MeHis16 (16번째 위치 N-methyl histidine) 함유 유도체(펩타이드 10 및 12)보다 약간 향상된 억제 활성을 나타냈다. MyrB, 펩타이드 12 및 13의 IC50 값은 가장 낮은 농도 지점에 의해 결정되었기 때문에 더 낮은 범위(0-2.5 nM)의 5개 지점으로 재평가하였다(도 4b 참조). 펩타이드 12 및 13의 IC50 값은 여전히 MyrB와 유사했으며, 펩타이드 13은 HBV 진입 억제에서 가장 큰 효능을 나타냈으며(IC50 = 0.7 ± 0.1 nM), 이는 MyrB(IC50 = 1.6 ± 0.1 nM)보다 2배 더 낮은 IC50 값이다.
거대고리 PreS1 유도체의 향상된 안정성을 입증하기 위해 혈액 안정성을 평가하고자 하였다. 쥐 전혈을 사용하여 MyrB-old, MyrB, 펩타이드 8 및 펩타이드 13에 대해 혈액의 안정성을 시점(0, 3, 6 및 24시간)에서 최대 24시간까지 모니터링하였다(도 5 참조). 예상대로 선형 펩타이드(MyrB-old 및 MyrB)는 혈액에서 매우 빠르게 분해되어 각각 3시간 및 6시간 미만의 반감기를 나타냈으며, 대조적으로 거대고리 유도체(펩타이드 8 및 13)는 상응하는 선형 펩타이드보다 더 긴 반감기를 나타내는 것을 확인할 수 있었다. 펩타이드 8의 반감기는 약 24시간으로 MyrB-old(t1/2 = ca. 5시간)보다 5배 더 길었으며, 펩타이드 13은 24시간 후에 89%의 온전한 펩타이드를 나타냈는데, 이는 혈액 내에서 MyrB보다 더 안정적이라는 것을 의미한다. 펩타이드 8과 13을 비교한 경우, 24시간 후에 펩타이드 13이 펩타이드 8보다 더 많이 남아 있었다(펩타이드 8과 13의 경우 46% 대 89%). 이는 펩타이드 13이 혈액에서 펩타이드 8보다 더 안정적이라는 것을 나타낸다. 펩타이드 13은 선형 펩타이드나 펩타이드 8보다 향상된 억제 활성과 전혈 안정성을 나타내었다.
인간화 마우스 모델을 사용하여 생체내 검정 시스템에서 펩타이드 13의 HBV 진입 억제 활성을 평가하였다(도 6 참조). 혈청 HBV DNA는 두 그룹, 대조군과 펩타이드 13 모두에서 1주 후에 결합되었으나, 연속 관찰에서는 서로 다른 프로필이 나타났다. 4주차에는 대조군의 혈청 HBV DNA 수치가 1주차와 비교하여 유의한 변화를 보이지 않았으나, 펩타이드 13을 투여한 1주차에 비해 혈청 HBV DNA 수치는 3log 감소하였다. 또한, 세포내 cccDNA는 약물 처리하지 않은 경우보다 8log로 현저하게 감소했다(도 6b 참조). 혈청 HBV DNA와 세포내 cccDNA의 감소는 HBV DNA를 생산하는 감염된 간세포의 수가 감소했음을 나타내는 것으로, 이는 숙주 세포에 대한 바이러스 전염이 펩타이드 13에 의해 예방되고 감염된 바이러스는 면역 체계에 의해 제거된다는 것을 시사한다. 그러나 HBV 표면 항원(HBsAg) 또는 e 항원(HBeAg)은 4주 후에도 변화가 나타나지 않았다(도 6c 및 도 6d 참조). 이는 HBsAg, HBeAg 또는 HBxAg와 같은 방출된 바이러스 성분의 수준에 영향을 미치지 않은 MyrB에 대한 이전 연구 결과와 일치하였다.
펩타이드 13의 경우, 정맥내 주사한 마우스에서 생체내 약동학(PK) 연구가 수행되었다(도 7 참조). 펩타이드 13은 1.9시간의 반감기와 낮은 부피 분포로 뒷받침되는 빠른 제거율을 나타내었다. 고리형 펩타이드 유도체는 선형 펩타이드에 비해 반감기가 길지만, 주 1회 투여 횟수를 목표로 하기에는 부족할 수 있기 때문에, 생체 내 안정성을 향상시키기 위해 PreS1 유도체의 추가 변형이 필요하였다.
| 파라미터 | MyrB | 펩타이드 13(DL-5-99) | ||
| IV, 1 mpk | SC, 10 mpk | IV, 1 mpk | SC, 10 mpk | |
| Tmax(h) | - | 4.00 | - | 4.67 |
| Cmax (ng/mL) | - | 16249.43 | - | 690.13 |
| AUClast (mgh/mL) | 671.20 | 93215.44 | 1864.41 | 6412.39 |
| AUC00 (mgh/mL) | 694.08 | 93227.86 | 1908.76 | 6814.60 |
| CL (mL/min/kg) | 24.73 | - | 9.16 | - |
| Vss (L/kg) | 1.67 | - | 1.77 | - |
| Vd (L/kg) | 2.76 | - | 4.33 | - |
| T1/2 (h) | 1.30 | 1.61 | 5.43 | 5.26 |
| MRT00 (h) | 0.92 | 5.17 | 2.41 | 8.03 |
| %F | - | N.D | - | 35.7 |
[실시예 3]
세 번째 라이브러리: 안정성 최적화
펩타이드 13의 서열에 기초하여, 고리화된 서열은 NTCP에 결합하기 위한 필수 에피토프(epitope)로 확인되었다. 비록 펩타이드 13이 모 펩타이드 MyrB보다 더 안정적이었지만, 그 서열을 특별히 인식하는 프로테아제가 있는지 조사하였다. N-말단으로부터의 프로테아제의 접근은 미리스토일 그룹을 이용한 N-아실화에 의해 차단되었다. 고리화된 루프의 서열은 약물단(pharmacophore)이기 때문에 변형에서 제외하였다. 따라서 C 말단에서 첫번째 아미노산 또는 두 번째 위치의 특정 아미노산을 인식하는 카르복시 펩티다아제를 고려하여 C 말단을 변형하였다. 연구 과정에서 펩타이드 13(Pro-Ala)의 C-말단의 두 아미노산을 분해하는 특정 카르복시 펩티다아제를 발견하였고, 상기 카르복시 펩티다아제에 의한 분해를 피하기 위해 세 번째 라이브러리에서 5개의 추가 유도체(펩타이드 14-18)를 설계하였다(도 11 참조). 일반적으로 서열은 펩타이드 13을 기반으로 하며 C 말단은 절단, D-아미노산 치환 또는 N-알킬화와 같이 변형되었다. 길이의 변화와 C 말단의 D형 아미노산 삽입으로 인해 펩타이드 14-16을 생성하였다. 카르복시 펩티다아제가 펩타이드를 인식하면 카복실산은 결합 포켓에서 두 개의 H-결합을 형성한다. C-말단의 N-알킬 아미드화는 카복실산과 펩타이드 분해효소 결합 포켓 사이의 정전기적 상호 작용을 약화시킬 것으로 예상하였다. 해당 유도체의 시험관 내 HBV 진입 억제 활성 평가를 수행하였고, 3번째 라이브러리 펩타이드 중 펩타이드 18번은 HBV 진입 억제에서 가장 좋은 효능을 나타내었다 (IC50 = 2.07 ± 0.11 nM). 동일 실험에서 대조군으로 사용된 MyrB는 IC50 = 1.43 ± 0.12 nM, 펩타이드 13번은 IC50 = 0.61 ± 0.14 nM 값을 나타내었다.
하기 반응식 3은 펩타이드 15, 17, 18번 유도체의 합성 방법을 나타낸다.
펩타이드 14-18의 합성은 일반적으로 위에서 언급한 SPPS 프로토콜에 따라 수행되었다(반응식 3). 미리스토일화 단계와 고리화 단계의 순서만 반응식 3에서 서로 바꾸었다. 펩타이드 17과 19의 경우 완전히 보호된 선형 펩타이드가 20% HFIP/CH2Cl2 용액에 의해 2-클로로트리틸 수지에서 절단되었다. 잔여 절단 용액을 N2 가스 흐름에 의해 증발시키고, 절단 후 추가 정제 없이 N-알킬 아미드화를 수행하였다. 아미드 커플링에서는 일반적으로 DMF를 용매로 사용하였지만, C 말단의 디에틸아민이나 모르폴린과의 반응은 CH2Cl2에서 진행되었다. N2 가스 흐름으로 용매를 제거한 후, 95% TFA 칵테일을 혼합물에 첨가하여 측쇄에서 보호기를 제거했다. 그런 다음, 잔류 TFA를 N2 가스로 제거하고 조 물질을 1:1 ACN/H2O 용액에 용해시키고 여과하고 분취용 RP-HPLC로 정제했다. 순도는 분석용 HPLC로 확인하였으며, 순도 97% 이상의 분획만을 모아 순수한 생성물을 얻었다.
본 연구에서는, 길이, 고리화 및 N-메틸 아미노산과 같은 주사슬 (backbone) 수정을 통해 새로운 MyrB 유도체를 설계하고 수지상의 거대고리화를 통해 합성하였다. 모든 유도체들은 MyrB와 유사한 HBV 진입 억제 활성을 나타냈으며, 그 중에서도 펩타이드 13은 시험관 내 분석에서 가장 낮은 IC50 값(0.7 ± 0.1 nM)을 나타냈고, 생체 내 인간화 마우스 모델에서도 혈청 HBV DNA 및 cccDNA(공유 폐쇄 원형 DNA)가 현저히 감소한 것을 확인하였다. 펩타이드 13의 개선된 안정성은 전혈 안정성 및 생체내 PK 연구에서도 관찰되었기에 약물 디자인 전략을 사용하면 향상된 억제 활성과 안정성을 달성하는 유망한 진입 억제제를 추가로 개발할 수 있을 것으로 기대된다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.
서열번호 1: GQNL
서열번호 2: GTNL
서열번호 3: STSNPLGFFP D
서열번호 4: STSNPLGFFP E
서열번호 5: STSNPLGFFP DHQLD
서열번호 6: KVPNPLGFFP D
서열번호 7: KTSNPLGFFP D
서열번호 8: DprTSNPLGFFP D
서열번호 9: HQLD
서열번호 10: HQLDPA
서열번호 11: H*QLDPA
서열번호 12: HQLDPAFRAN S
서열번호 13: R*QLDPA
서열번호 14: R*QLDP
서열번호 15: R*QLDp
Claims (17)
- 하기 화학식 1 또는 화학식 2 로 표시되는 선형 또는 고리형 펩타이드:[화학식 1][화학식 2]상기 화학식 1 및 2에서,m은 10 내지 14의 정수이고,n은 1 내지 6의 정수이며,o는 1 내지 3의 정수이고,A는 O 또는 NH이며,R1은 서열번호 1 또는 서열번호 2 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고,R2는 서열번호 3 내지 8 중 어느 하나의 아미노산 서열을 가지는 펩타이드이며,R3는 직접 결합이거나 서열번호 9 내지 15 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고,R4는 하이드록시, -NR5R6 또는 모르폴리닐(morpholinyl)이며,상기 R5 및 R6는 각각 독립적으로 수소 또는 C1 내지 C3 알킬이다.
- 제 1항에 있어서,상기 n과 o의 합은 2 내지 8인 것을 특징으로 하는 펩타이드.
- 제 1항에 있어서,상기 화학식 1로 표시되는 선형 펩타이드는R1은 서열번호 1의 아미노산 서열을 가지는 펩타이드이고,R2는 서열번호 3 또는 4의 아미노산 서열을 가지는 펩타이드이며,R3는 서열번호 9 내지 12 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고,R4는 하이드록시인, 펩타이드.
- 제 1항에 있어서,상기 화학식 2로 표시되는 고리형 펩타이드는R1은 서열번호 1 또는 2의 아미노산 서열을 가지는 펩타이드이고,R2는 서열번호 3, 5, 6 내지 8 중 어느 하나의 아미노산 서열을 가지는 펩타이드이며,R3는 직접 결합이거나 서열번호 11, 13 내지 15 중 어느 하나의 아미노산 서열을 가지는 펩타이드이고,R4는 하이드록시, -NR5R6 또는 모르폴리닐(morpholinyl)이며,상기 R5 및 R6는 각각 독립적으로 수소 또는 C1 내지 C3 알킬인, 펩타이드.
- 제 1항 내지 제 4항의 펩타이드 또는 이의 약제학적으로 허용되는 염을 유효성분으로 포함하는 간염 바이러스 감염 질환의 예방 또는 치료용 약학 조성물.
- 제 5항에 있어서,상기 간염 바이러스는 A형 간염 바이러스(hepatitis A virus, HAV), B형 간염 바이러스 (Hepatitis B virus, HBV), C형 간염 바이러스 (Hepatitis C virus, HCV), D형 간염 바이러스 (Hepatitis D virus, HDV), E형 간염 바이러스 (Hepatitis E virus, HEV), G형 간염 바이러스 (Hepatitis G virus, HGV), 앱스타인바 바이러스(Epstein-barr virus) 및 거대세포 바이러스 (Cytomegalovirus, CMV)로 이루어진 군에서 선택된 적어도 하나인, 약학 조성물.
- 제 1항에 있어서,상기 조성물은 생체 내 가수분해 효소로부터 분해가 억제되는 것을 특징으로 하는, 약학 조성물.
- 제 1항 내지 제 4항의 펩타이드 또는 이의 약제학적으로 허용되는 염을 유효성분으로 포함하는 간염 바이러스 감염 질환의 예방 또는 개선용 식품 조성물.
- 제 8항에 있어서,상기 간염 바이러스는 A형 간염 바이러스(hepatitis A virus, HAV), B형 간염 바이러스 (Hepatitis B virus, HBV), C형 간염 바이러스 (Hepatitis C virus, HCV), D형 간염 바이러스 (Hepatitis D virus, HDV), E형 간염 바이러스 (Hepatitis E virus, HEV), G형 간염 바이러스 (Hepatitis G virus, HGV), 앱스타인바 바이러스(Epstein-barr virus) 및 거대세포 바이러스 (Cytomegalovirus, CMV)로 이루어진 군에서 선택된 적어도 하나인, 식품 조성물.
- 안정화 목적의 약물을 수득하는 단계; 및약물에 포함된 아미노산 서열 중 적어도 둘 이상의 아미노산에 고리형 아마이드를 형성시켜 거대 고리화하는 단계를 포함하는, 약물의 안정성을 향상시키는 방법.
- 제 10항에 있어서,상기 고리형 아마이드는 락탐화(lactamization) 또는 락톤화(lactonization)를 통해 고리화되는 것을 특징으로 하는 것인, 방법.
- 제 10항에 있어서,상기 고리형 아마이드는 고리화에 참가하는 아미노산의 인접한 아미노산 잔기에서의 N-메틸화(methylation), C-말단 변형(C-term modification) 또는 이들의 조합을 포함하는 것을 특징으로 하는, 방법.
- 제 10항에 있어서,상기 고리형 아마이드는 약물의 특정 아미노산 서열 중 라이신(Lys, K) 또는 세린(Ser, S)과 아스파르트산(Asp, D) 간의 락탐화(lactamization) 또는 락톤화(lactonization)를 통해 고리를 형성하는 것을 특징으로 하는, 방법.
- 제 10항에 있어서,상기 고리형 아마이드 내의 락탐화(lactamization) 또는 락톤화(lactonization) 고리는 5개 내지 9개의 고리원자로 구성되는 것을 특징으로 하는, 방법.
- 제 10항에 있어서,상기 약물은 바이러스 진입 억제제, cccDNA를 타깃으로 하는 약물, 뉴클레오캡시드(nucleocapsid) 억제제, 폴리머라제(polymerase) 억제제, HBsAg 억제제 및 면역 억제제로 이루어진 군에서 선택된 적어도 하나인, 방법.
- 제 15항에 있어서,상기 약물은 바이러스 진입 억제제인, 방법.
- 제 16항에 있어서,상기 바이러스 진입 억제제는 미르클루덱스-B (Myrcludex B, MyrB), 싸이클로스포린 A(Cyclosporin A) 및 에제티미브(Ezetimibe)로 이루어진 군에서 선택된 적어도 하나인, 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2024-0089068 | 2024-07-05 | ||
| KR1020240089068A KR20260007648A (ko) | 2024-07-05 | 2024-07-05 | B형 간염 바이러스의 숙주 침투를 저해하는 신규한 PreS1 유도체 화합물 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2026010353A1 true WO2026010353A1 (ko) | 2026-01-08 |
Family
ID=98318863
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2025/009408 Pending WO2026010353A1 (ko) | 2024-07-05 | 2025-07-02 | B형 간염 바이러스의 숙주 침투를 저해하는 신규한 pres1 유도체 화합물 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR20260007648A (ko) |
| WO (1) | WO2026010353A1 (ko) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20100136960A (ko) * | 2008-01-25 | 2010-12-29 | 루프레히트-칼스-유니페어지테트 하이델베르크 | B형 간염 바이러스(HBV)의 소수성 변형된 preS-유래 펩티드 및 이의 HBV 및 HDV 침입 억제제로서의 용도 |
| US7892754B2 (en) * | 2001-07-27 | 2011-02-22 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Hepatitis B virus pre-S1 derived synthetic polypeptides and uses thereof |
| JP2015120657A (ja) * | 2013-12-24 | 2015-07-02 | 国立研究開発法人国立循環器病研究センター | ペプチド及びヒト肝細胞選択的薬物送達複合体 |
| EP3181146A1 (en) * | 2015-12-16 | 2017-06-21 | Ruprecht-Karls-Universität Heidelberg | Cyclic ntcp-targeting peptides and their uses as entry inhibitors |
-
2024
- 2024-07-05 KR KR1020240089068A patent/KR20260007648A/ko active Pending
-
2025
- 2025-07-02 WO PCT/KR2025/009408 patent/WO2026010353A1/ko active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7892754B2 (en) * | 2001-07-27 | 2011-02-22 | Institut National De La Sante Et De La Recherche Medicale (Inserm) | Hepatitis B virus pre-S1 derived synthetic polypeptides and uses thereof |
| KR20100136960A (ko) * | 2008-01-25 | 2010-12-29 | 루프레히트-칼스-유니페어지테트 하이델베르크 | B형 간염 바이러스(HBV)의 소수성 변형된 preS-유래 펩티드 및 이의 HBV 및 HDV 침입 억제제로서의 용도 |
| JP2015120657A (ja) * | 2013-12-24 | 2015-07-02 | 国立研究開発法人国立循環器病研究センター | ペプチド及びヒト肝細胞選択的薬物送達複合体 |
| EP3181146A1 (en) * | 2015-12-16 | 2017-06-21 | Ruprecht-Karls-Universität Heidelberg | Cyclic ntcp-targeting peptides and their uses as entry inhibitors |
Non-Patent Citations (1)
| Title |
|---|
| PASSIOURA TOBY, WATASHI KOICHI, FUKANO KENTO, SHIMURA SATOMI, SASO WAKANA, MORISHITA RYO, OGASAWARA YUKI, TANAKA YASUHITO, MIZOKAM: "De Novo Macrocyclic Peptide Inhibitors of Hepatitis B Virus Cellular Entry", CELL CHEMICAL BIOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 25, no. 7, 1 July 2018 (2018-07-01), AMSTERDAM, NL , pages 906 - 915.e5, XP055817455, ISSN: 2451-9456, DOI: 10.1016/j.chembiol.2018.04.011 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20260007648A (ko) | 2026-01-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7705146B2 (en) | Hepatitis C inhibitor peptide analogs | |
| AU2003202347B2 (en) | Tripeptides having a hydroxyproline ether of a substituted quinoline for the inhibition of NS3 (Hepatitis C) | |
| CZ298749B6 (cs) | Inhibitory serinových proteáz a farmaceutické prostředky s jejich obsahem | |
| HUP0104548A2 (hu) | Hepatitis C inhibitor peptidek, eljárás előállításukra, azokat tartalmazó gyógyszerkészítmények és alkalmazásuk | |
| CN1902216A (zh) | 丙肝病毒ns3蛋白酶的去肽化抑制剂 | |
| WO2004092161A1 (en) | Inhibitors of serine proteases, particularly hcv ns3-ns4a protease | |
| CN1138335A (zh) | 具有生长激素释放特性的化合物 | |
| KR20060073610A (ko) | 세린 프로테아제, 특히 hcv ns3-ns4a 프로테아제의억제제 | |
| WO2000009543A2 (en) | Hepatitis c inhibitor tri-peptides | |
| KR20120010278A (ko) | 세린 프로테아제, 특히 hcv ns3-ns4a 프로테아제의 억제제 | |
| HK1041007A1 (zh) | 截尾海兔肽15衍生物 | |
| WO2019066586A1 (ko) | 글루카곤 유사 펩타이드-2(glp-2) 유도체의 지속형 결합체 | |
| WO2017003267A1 (ko) | 항바이러스 활성 효능을 가지는 펩티드 및 이를 포함하는 조성물 | |
| WO2026010353A1 (ko) | B형 간염 바이러스의 숙주 침투를 저해하는 신규한 pres1 유도체 화합물 | |
| WO2020222559A1 (ko) | 신규한 올리고펩티드 및 이를 유효성분으로 포함하는 암의 예방 또는 치료용 약학적 조성물 | |
| WO2009148280A2 (ko) | 바이러스 억제제로서 유용한 디아릴 헤파토노이드계 화합물 | |
| WO2023090686A1 (en) | Pentapeptide and use thereof | |
| WO2024136573A1 (ko) | 신규한 glp-1, gip, 및 글루카곤 수용체 모두에 활성을 갖는 삼중 활성체 및 이를 포함하는 비만의 예방 또는 치료용 약학적 조성물 | |
| EP1756156B1 (en) | Selective vpac2 receptor peptide agonists | |
| WO2021107519A1 (en) | Biotin moiety-conjugated polypeptide and pharmaceutical composition for oral administration comprising the same | |
| WO2015026170A1 (ko) | 세포괴사 저해제로서의 인돌 화합물 | |
| WO2026089505A1 (ko) | 인테그린 과발현 암의 예방 또는 치료를 위한 복합 약물접합체 | |
| WO2019035672A1 (ko) | 아실화 옥신토모듈린 펩타이드 유사체 | |
| WO2025259064A1 (ko) | Glp-1, gip, 및 글루카곤 수용체 모두에 활성을 갖는 삼중 활성체 및 이를 포함하는 심혈관계 질환 예방 또는 치료용 약학적 조성물 | |
| WO2019132610A1 (ko) | Baf57 재조합 융합 단백질 및 이의 용도 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 25833598 Country of ref document: EP Kind code of ref document: A1 |