WO2024167289A1 - 검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법 - Google Patents

검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법 Download PDF

Info

Publication number
WO2024167289A1
WO2024167289A1 PCT/KR2024/001759 KR2024001759W WO2024167289A1 WO 2024167289 A1 WO2024167289 A1 WO 2024167289A1 KR 2024001759 W KR2024001759 W KR 2024001759W WO 2024167289 A1 WO2024167289 A1 WO 2024167289A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
target
template region
target oligonucleotide
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2024/001759
Other languages
English (en)
French (fr)
Inventor
고오성
이효빈
한성현
김소영
박유람
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Seegene Inc
Original Assignee
Seegene Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Seegene Inc filed Critical Seegene Inc
Priority to KR1020257021307A priority Critical patent/KR20250120312A/ko
Publication of WO2024167289A1 publication Critical patent/WO2024167289A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6818Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6848Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00Reactions demanding special reaction conditions
    • C12Q2527/101Temperature
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2565/00Nucleic acid analysis characterised by mode or means of detection
    • C12Q2565/10Detection mode being characterised by the assay principle
    • C12Q2565/101Interaction between at least two labels

Definitions

  • the present invention relates to a method for detecting a target oligonucleotide using a detection oligonucleotide.
  • Nucleic acid amplification technology is a technology mainly used in the fields of molecular biology and biotechnology, and is a method that can detect and analyze small amounts of target nucleic acids present in a sample.
  • the PCR (Polymerase Chain Reaction) technology is most commonly used for nucleic acid amplification, which repeats a series of processes in which double-stranded DNA is denatured into single-stranded DNA, a primer is annealed to it, and the annealed primer is extended by a polymerase.
  • Real-time PCR using fluorescent substances is a method of detecting an increase in fluorescence intensity due to nucleic acid amplification during the PCR process.
  • Real-time PCR has the advantage of enabling multiplex detection by using different fluorescent dyes for each target, but has the disadvantage of requiring expensive equipment for precise temperature control and taking a long time to detect.
  • an isothermal amplification method has been developed that does not require expensive real-time PCR equipment and can detect target nucleic acids in a shorter time than PCR.
  • the isothermal amplification method is a technology that can be applied to point-of-care testing (POCT) systems, and is a technology that allows amplification reactions to be performed at a constant temperature without the temperature change process required for DNA denaturation, primer annealing, and polymerase extension.
  • POCT point-of-care testing
  • isothermal amplification methods include rolling circle amplification (RCA), M. M. Ali, F. Li, Z. Zhang, K. Zhang, D.-K. Kang, J. A. Ankrum, X. C. Le and W. Zhao, Chem. Soc. Rev. , 2014, 43, 3324-3341.), LAMP (loop-mediated isothermal amplification, Y. Mori, H. Kanda and T. Notomi, J. Infect. Chemother., 2013, 19, 404-411), RPA (recombinase polymerase amplification, J. Li, J. Macdonald and F.
  • RCA rolling circle amplification
  • M. M. Ali F. Li, Z. Zhang, K. Zhang, D.-K. Kang, J. A. Ankrum, X. C. Le and W. Zhao, Chem. Soc. Rev. , 2014, 43, 3324-3341.
  • LAMP loop-mediated isothermal amplification, Y. Mori
  • This isothermal amplification technique enables amplification of target nucleic acids in a shorter period of time because it does not require temperature control.
  • isothermal amplification techniques have the advantage of showing very high amplification efficiency because they can prevent DNA loss and damage due to temperature changes.
  • LAMP techniques have been considered as techniques with high potential for use as on-site diagnostic techniques because they achieve amplification efficiency of target nucleic acids of up to 109 times within a short reaction time of about 1 hour.
  • LAMP techniques have the disadvantage of having complex primer designs and using many types of primers, which causes nonspecific amplification reactions due to random hybridization between primers, and the background signals that result from this are also rapidly amplified.
  • EXPAR technology is a technology that exponentially amplifies relatively short single-stranded target nucleic acids using DNA polymerase and nicking enzyme under isothermal reaction conditions.
  • EXPAR has high amplification efficiency and a short reaction time of about 30 minutes, so it is used for various biomolecule analyses including target nucleic acid analysis, and has been used effectively in microRNA analysis, etc.
  • EXPAR has a major problem in that the amplification reaction proceeds even in the absence of target nucleic acids, so-called nonspecific amplification reaction.
  • the cause of this nonspecific amplification reaction of EXPAR has not been clearly identified, but it is thought to occur due to the formation of secondary structures of EXPAR templates and their reaction with enzymes under isothermal reaction conditions (E. Tan et al., Biochemistry, 2008, 47, 9987-9999). Due to this nonspecific amplification reaction, the specificity and reproducibility of EXPAR are low, and multi-target analysis is also difficult.
  • the present inventors have made extensive efforts to develop a new isothermal nucleic acid amplification technique capable of improving the performance degradation of target nucleic acid detection due to nonspecific amplification reaction, and as a result, have confirmed that the performance of target nucleic acid detection can be improved by implementing a template including a nicking enzyme recognition region capable of simultaneously providing amplification and detection of a signal in a single isothermal reaction.
  • Another object of the present invention is to provide a kit for detecting a target oligonucleotide.
  • a method for detecting a target oligonucleotide comprising the following steps:
  • the above detection oligonucleotide comprises a first template region, a nicking enzyme recognition region and a second template region in the 3' to 5' direction,
  • the first template region and the second template region independently have a hybridization nucleotide sequence substantially complementary to the target oligonucleotide
  • the above detection oligonucleotide is labeled with an interactive dual label comprising a reporter molecule and a quencher molecule capable of quenching a signal from the reporter molecule,
  • the target oligonucleotide hybridizes to the first template region of the detector oligonucleotide
  • step (b) a step of incubating the resultant of step (a) with a nicking enzyme and a strand displacement nucleic acid polymerase under isothermal conditions;
  • the target oligonucleotide hybridized to the first template region is extended by the strand-displacing nucleic acid polymerase to generate an extended strand complementary to the detection oligonucleotide, the extended strand is cleaved by the nicking enzyme at the nicking enzyme recognition region, and the cleaved strand is extended from its 3'-end by the strand-displacing nucleic acid polymerase to release the target oligonucleotide;
  • Hybridization of the target oligonucleotide with the detector oligonucleotide or generation of the extended strand results in a signal change from the interactive dual label, thereby providing a detectable signal indicating the presence of the target oligonucleotide.
  • the reporter molecule and the quencher molecule of the interactive dual label are positioned in the first template region of the detector oligonucleotide, and hybridization of the target oligonucleotide and the detector oligonucleotide can induce a signal change from the interactive dual label to provide a detectable signal.
  • the reporter molecule and the quencher molecule of the interactive dual label are positioned in the second template region of the detector oligonucleotide, and the generation of an extended strand of the target oligonucleotide can induce a signal change from the interactive dual label to provide a detectable signal.
  • one of the reporter molecule and the quencher molecule of the interactive dual label is located in the first template region and the other is located in the second template region, and hybridization of the target oligonucleotide with the detector oligonucleotide or generation of the extended strand can induce a signal change from the interactive dual label to provide a detectable signal.
  • the quencher molecule prior to hybridization of the target oligonucleotide with the detector oligonucleotide or generation of the extended strand, quencher molecule quenches a signal from the reporter molecule, whereas hybridization of the target oligonucleotide or generation of the extended strand dissociates the reporter molecule and the quencher molecule from each other to provide a detectable signal from the reporter molecule.
  • the target oligonucleotide may comprise a nucleic acid sequence derived from or generated by a pathogen of interest or a complementary nucleic acid sequence thereof.
  • the strand displacement nucleic acid polymerase can be any one selected from the group consisting of Bst large fragment polymerase, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), ⁇ 29 phage, MS-2 phage, Z-Taq, KOD, Klenow fragment, GspSSD, GspF, OmniAmp polymerase, SD polymerase, and combinations thereof.
  • the nicking enzyme can be any one selected from the group consisting of Nb.BbvCI, Nt.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsI, Nt.BsmAI, Nt.BspQI, Nb.BsrDI, Nt.BstNBI, Nb.BssSI, Nt.Alw and combinations thereof.
  • a kit for detecting a target oligonucleotide comprising:
  • the above detection oligonucleotide comprises a first template region, a nicking enzyme recognition region and a second template region in the 3' to 5' direction,
  • the first template region and the second template region independently have a hybridization nucleotide sequence substantially complementary to the target oligonucleotide
  • the above detection oligonucleotide is labeled with an interactive dual label comprising a reporter molecule and a quencher molecule capable of quenching a signal from the reporter molecule;
  • the reporter molecule and the quencher molecule of the interactive dual label are positioned in the first template region of the detector oligonucleotide, and hybridization of the target oligonucleotide and the detector oligonucleotide can induce a signal change from the interactive dual label to provide a detectable signal.
  • the reporter molecule and the quencher molecule of the interactive dual label are positioned in the second template region of the detector oligonucleotide, and the generation of an extended strand of the target oligonucleotide can induce a signal change from the interactive dual label to provide a detectable signal.
  • one of the reporter molecule and the quencher molecule of the interactive dual label is located in the first template region and the other is located in the second template region, and hybridization of the target oligonucleotide with the detector oligonucleotide or generation of the extended strand can induce a signal change from the interactive dual label to provide a detectable signal.
  • the target oligonucleotide may comprise a nucleic acid sequence derived or produced in the presence of a pathogen of interest or a complementary nucleic acid sequence thereof.
  • the strand displacement nucleic acid polymerase can be any one selected from the group consisting of Bst large fragment polymerase, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), ⁇ 29 phage, MS-2 phage, Z-Taq, KOD, Klenow fragment, GspSSD, GspF, OmniAmp polymerase, SD polymerase, and combinations thereof.
  • the nicking enzyme can be any one selected from the group consisting of Nb.BbvCI, Nt.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsI, Nt.BsmAI, Nt.BspQI, Nb.BsrDI, Nt.BstNBI, Nb.BssSI, Nt.Alw and combinations thereof.
  • the present invention can clearly distinguish between a signal detected due to amplification of a target oligonucleotide and a signal detected due to non-specific amplification of a non-target nucleic acid, thereby exhibiting more accuracy and higher sensitivity.
  • the present invention implements a detection system in which amplification and signal generation of a target oligonucleotide are performed in a single isothermal amplification reaction, thereby enabling detection of a target oligonucleotide more quickly and with excellent efficiency.
  • the present invention can contribute to significantly improving EXPAR technology in which target oligonucleotides are exponentially amplified by the action of a nicking enzyme and a nucleic acid polymerase after a hybridization reaction of the target oligonucleotides.
  • Figure 1 is a schematic diagram of the mold of EXPAR technology.
  • Figure 2 is a schematic diagram of the isothermal amplification reaction process of EXPAR technology.
  • Figure 3 is a schematic diagram of the detection reaction using a mold and CTO of the conventional EXPAR technology.
  • Figure 4 is a schematic diagram of a detection oligonucleotide according to one embodiment of the present invention.
  • Figure 5 is an amplification curve obtained in an experiment at different target oligonucleotide concentrations in Example 1.
  • Figure 6 is an amplification curve obtained in the specificity analysis experiment of Example 1.
  • Figure 7 is an amplification curve obtained in an experiment at different target oligonucleotide concentrations in Example 2.
  • the greatest feature of the present invention is that, when detecting a target nucleic acid through an isothermal amplification method, a detection system in which amplification and signal generation are simultaneously performed in a single reaction is used to detect the target nucleic acid quickly and with high efficiency.
  • the conventional EXPAR system had a problem in that the detection accuracy of the target nucleic acid was poor due to low specificity in which signals due to nonspecific amplification and signals due to specific amplification were not distinguished.
  • the detection method of the present invention solves this problem by improving sensitivity and specificity by designing a detection oligonucleotide composed of a template region - a nicking enzyme recognition region - a template region and labeled with a reporter molecule and a quencher molecule.
  • One aspect of the present invention provides a method for detecting a target oligonucleotide comprising the following steps:
  • the above detection oligonucleotide comprises a first template region, a nicking enzyme recognition region and a second template region in the 3' to 5' direction,
  • the first template region and the second template region independently have a hybridization nucleotide sequence substantially complementary to the target oligonucleotide
  • the above detection oligonucleotide is labeled with an interactive dual label comprising a reporter molecule and a quencher molecule capable of quenching a signal from the reporter molecule,
  • the target oligonucleotide hybridizes to the first template region of the detector oligonucleotide
  • step (b) a step of incubating the resultant of step (a) with a nicking enzyme and a strand displacement nucleic acid polymerase under isothermal conditions;
  • the target oligonucleotide hybridized to the first template region is extended by the strand-displacing nucleic acid polymerase to generate an extended strand complementary to the detection oligonucleotide, the extended strand is cleaved by the nicking enzyme at the nicking enzyme recognition region, and the cleaved strand is extended from its 3'-end by the strand-displacing nucleic acid polymerase to release the target oligonucleotide;
  • Hybridization of the target oligonucleotide with the detector oligonucleotide or generation of the extended strand results in a signal change from the interactive dual label, thereby providing a detectable signal indicating the presence of the target oligonucleotide.
  • a target oligonucleotide is reacted with a detector oligonucleotide comprising a first template region, a nicking enzyme recognition region, and a second template region in a 3' to 5' order.
  • target oligonucleotide as used herein means a region of a nucleic acid that is to be detected or quantified, and may be used interchangeably with target nucleic acid, target nucleic acid sequence, or target region.
  • a target oligonucleotide comprises a copy of a nucleic acid sequence that is present in a sample or generated by another reaction such as a particular template. That is, the target oligonucleotide comprises a sequence that is initially present in the collected sample as well as a sequence that is newly generated in a particular reaction.
  • the target oligonucleotide may comprise single or double-stranded deoxyribonucleotide or ribonucleotide polymers, and may include, but are not limited to, coding or non-coding sequences of genes, sense and antisense sequences, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polynucleotides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers, fragments, genetic constructs, vectors and modified polynucleotides.
  • the target oligonucleotide as a starting material is double-stranded, it is preferable to make the two strands into a single-stranded or partially single-stranded form.
  • the target oligonucleotide comprises any naturally occurring prokaryotic, eukaryotic (e.g., protozoa and parasites, fungi, yeasts, higher plants, lower and higher animals including mammals and humans), virus (e.g., herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, polio virus, etc.), or viroid nucleic acid.
  • eukaryotic e.g., protozoa and parasites, fungi, yeasts, higher plants, lower and higher animals including mammals and humans
  • virus e.g., herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, polio virus, etc.
  • viroid nucleic acid e.g., herpes virus, HIV, influenza virus, Epstein-Barr virus, hepatitis virus, polio virus, etc.
  • viroid nucleic acid e.g., herpes virus, HIV, influenza virus,
  • the target oligonucleotide should not be construed as being limited to sequences known at the time of the designation or sequences available from the time of the designation, but instead should be construed as including sequences that are available or may become known at any time now or in the future. That is, the target oligonucleotide may or may not be known at the time of practicing the method of the present invention. In the case of an unknown nucleic acid sequence, its sequence may be determined by one of the conventional sequencing methods prior to practicing the method of the present invention.
  • the target oligonucleotide may comprise a nucleic acid sequence of a pathogen of interest in the biological sample, a portion thereof, or a nucleotide sequence complementary thereto, or a nucleic acid sequence derived from or generated by the pathogen of interest, or a nucleic acid sequence complementary thereto.
  • the target oligonucleotide may comprise a nucleotide mutation.
  • nucleotide variation means any single or multiple nucleotide substitutions, deletions or insertions in a DNA sequence at a specific position in a contiguous DNA segment having a similar sequence. Such contiguous DNA segments include any other portion of a gene or a chromosome. Such nucleotide variations may be mutations or polymorphic allele variations.
  • the nucleotide variations detected in the present invention include single nucleotide polymorphisms (SNPs), mutations, deletions, insertions, substitutions and translocations.
  • nucleotide variations include various variations in the human genome (e.g., variations in the methylenetetrahydrofolate reductase (MTHFR) gene), variations associated with drug resistance in pathogens, and tumorigenic variations.
  • MTHFR methylenetetrahydrofolate reductase
  • nucleotide variation includes any variation at a specific position of a nucleic acid sequence. That is, the term “nucleotide variation” includes the wild type and any mutant form thereof at a specific position of a nucleic acid sequence.
  • sample means a cell, tissue or fluid from a biological source, or any other medium that can be beneficially evaluated according to the present invention.
  • the samples include viruses, bacteria, tissues, cells, blood, serum, plasma, lymph, milk, urine, feces, eye fluid, saliva, semen, brain extracts, cerebrospinal fluid, appendix, spleen and tonsil tissue extracts, amniotic fluid, ascites, and non-biological samples (e.g., food and water).
  • the samples also include natural-occurring and synthetic nucleic acid molecules isolated from a biological source.
  • the sample is a cervical swab sample or a liquid based cytology sample.
  • detector oligonucleotide as used herein collectively refers to an oligonucleotide that reacts with a target oligonucleotide to amplify the target oligonucleotide and is involved in the generation of a detected signal.
  • the detector oligonucleotide includes an oligonucleotide that is involved in the actual signal generation. For example, hybridization or non-hybridization of the target oligonucleotide and the detector oligonucleotide determines the signal generation.
  • the detection oligonucleotide comprises a first template region, a nicking enzyme recognition region, and a second template region in a 3' to 5' order.
  • EXPAR exposure isothermal amplification reaction
  • EXPAR exposure isothermal amplification reaction
  • the detection oligonucleotide comprises a base sequence that is complementary to the target oligonucleotide, such as the template of FIG. 1, at both the 3' and 5' ends, and may include a nicking enzyme recognition region therebetween.
  • the first template region and the second template region can independently have a hybridization nucleotide sequence substantially complementary to the target oligonucleotide.
  • hybridization means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur when the complementarity between the two nucleic acid strands is complete or when some mismatched bases exist. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.
  • the first template region and the second template region can comprise substantially the same nucleic acid sequence. In another embodiment, the first template region and the second template region can comprise different nucleic acid sequences, and a base sequence complementary to the second template region can hybridize to the first template region. In one embodiment, the second template region can comprise a nucleic acid sequence longer than the first template region and can further comprise a nicking enzyme recognition sequence at the end. In one embodiment, the binding affinity of the first template region and the target oligonucleotide can be higher than the binding affinity of the second template region and the target oligonucleotide.
  • isothermal amplification can be performed in which the target oligonucleotide hybridizes to the first template region by a mechanism as shown in FIG. 2, and a fragment identical to the target oligonucleotide is then generated in the second template region through a reaction. This is described in more detail in step (b) below.
  • the detection oligonucleotide comprises an interactive dual label comprising a reporter molecule and a quencher molecule.
  • both the reporter molecule and the quencher molecule of the interactive dual label can be located in the first template region of the detector oligonucleotide.
  • both the reporter molecule and the quencher molecule of the interactive dual label can be located in the second template region of the detector oligonucleotide.
  • the first template region of the detector oligonucleotide can have one of the interactive dual labels comprising the reporter molecule and the quencher molecule
  • the second template region can have the other of the interactive dual labels.
  • the reporter molecule can be located in the first template region and the quencher molecule can be located in the second template region, or the quencher molecule can be located in the first template region and the reporter molecule can be located in the second template region.
  • An example of the detector oligonucleotide is illustrated in FIG. 4.
  • the FRET (fluorescence resonance energy transfer) fluorescent labeling system includes a fluorescent reporter molecule (donor molecule) and a quencher molecule (acceptor molecule).
  • the energy donor is fluorescent, but the energy acceptor can be fluorescent or non-fluorescent.
  • the energy donor is non-fluorescent, such as a chromophore, and the energy acceptor is fluorescent.
  • the energy donor is luminescent, such as bioluminescent, chemiluminescent, or electrochemiluminescent, and the acceptor is fluorescent.
  • Interactive labeling systems include dual labels based on "contact-mediated quenching" (Salvatore et al., Nucleic Acids Research, 2002 (30) no.21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956).
  • the interactive labeling system includes any labeling system that induces a signal change by the interaction between at least two molecules (e.g., dyes).
  • Reporter molecules and quencher molecules useful in the present invention may include any molecules known in the art. Examples include: Cy2TM (506), YO-PROTM-1 (509), YOYOTM-1 (509), Calcein (517), FITC (518), FluorXTM (519), AlexaTM (520), Rhodamine 110 (520), Oregon GreenTM 500 (522), Oregon GreenTM 488 (524), RiboGreenTM (525) ), Rhodamine GreenTM (527), Rhodamine 123 (529), Magnesium GreenTM (531), Calcium GreenTM (533), TO-PROTM-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), 8 (568), BODIPY564/570 (570), Cy3TM (570), AlexaTM 546 (570), TRITC (572), Magnesium OrangeTM (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium
  • Suitable fluorescent molecules and suitable reporter-quencher pairs are described in various references, including: Pesce et al., editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White et al., Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); U.S. Patent Nos. 3,99
  • non-fluorescent quencher molecules e.g., black quenchers or dark quenchers
  • black quenchers or dark quenchers capable of quenching fluorescence of a broad wavelength or a specific wavelength
  • the reporter comprises the donor of FRET and the quencher comprises the other partner (acceptor) of FRET.
  • fluorescein dye is used as a reporter and rhodamine dye is used as a quencher.
  • the detector oligonucleotide including the interactive dual label exists in a single-stranded state, the strand can form a hairpin or random coil structure to induce quenching between the interactive dual labels.
  • the detector oligonucleotide hybridizes with the target oligonucleotide or an extension reaction occurs due to the hybridization thereof, the quenching is reduced.
  • a detector oligonucleotide having a structure comprising a first template region, a nicking enzyme recognition region, and a second template region in a 3' to 5' order, and comprising a reporter molecule and a quencher molecule of an interactive dual label in the first template region and/or the second template region can hybridize with a target oligonucleotide, and the target oligonucleotide can hybridize to the first template region of the detector oligonucleotide.
  • This step is a step of incubating the result of the above step (a) with a nicking enzyme and a strand displacement nucleic acid polymerase.
  • a nicking enzyme and a strand displacement nucleic acid polymerase For example, an isothermal amplification reaction can be performed by incubating a hybrid of the first template region of the detection oligonucleotide and the target oligonucleotide with a nicking enzyme and a strand displacement nucleic acid polymerase.
  • strand displacement nucleic acid polymerase refers to a nucleic acid polymerase that displaces a strand bound to an upstream region of a template strand during a nucleic acid polymerization reaction by pushing the strand away from the template strand.
  • the strand displacement nucleic acid polymerase may be any one selected from the group consisting of Bst large fragment polymerase, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), ⁇ 29 phage, MS-2 phage, Z-Taq, KOD, Klenow fragment, GspSSD, GspF, OmniAmp polymerase, SD polymerase, and combinations thereof, but is not limited thereto, and any nucleic acid polymerase having polymerization activity and displacement activity may be used.
  • nicking enzyme refers to an endonuclease that recognizes a complete or partial double-stranded nucleotide sequence and cleaves only one strand at a specific position with respect to the recognition region.
  • the recognition region varies depending on the nicking enzyme. For example, Nt.BstNBI can recognize the 5'-GAGTCNNNNN-3' sequence and cleave between the fourth N and the fifth N in the 5' to 3' direction.
  • the nicking enzyme may be any one selected from the group consisting of Nb.BbvCI, Nt.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsI, Nt.BsmAI, Nt.BspQI, Nb.BsrDI, Nt.BstNBI, Nb.BssSI, Nt.Alw and combinations thereof, but is not limited thereto, and any enzyme having cleavage activity may be used.
  • the template illustrated in FIG. 2 is a structure in which the interactive dual label is omitted in the detection oligonucleotide according to one embodiment of the present invention.
  • the target oligonucleotide can be hybridized to the first template region of the detection oligonucleotide.
  • the target oligonucleotide hybridized to the first template region generates an extension strand including an extension sequence complementary to the detection oligonucleotide by a nucleic acid polymerase.
  • the extension strand extended using the second template region as a template, including the nicking enzyme recognition region consequently includes the same nucleic acid sequence as the target oligonucleotide at a position corresponding to the second template region.
  • the extended strand can be induced to be cleaved by a nicking enzyme at the nicking enzyme recognition region.
  • the 3' end of the extended strand is extended by a strand-displacing nucleic acid polymerase, thereby releasing a cleavage product.
  • the cleavage product contains a sequence substantially identical to the target oligonucleotide.
  • the target oligonucleotide hybridizes to the first template region of the detection oligonucleotide, exponential amplification of the target oligonucleotide, which is a cleavage product by the strand-displacing nucleic acid polymerase and the nicking enzyme, can be realized.
  • This step detects a signal indicating the presence of the target oligonucleotide.
  • the signal can be provided from the detection oligonucleotide described above.
  • the present inventors designed an isothermal amplification reaction that generates a signal indicating the presence of a target oligonucleotide by combining the template oligonucleotide described in FIG. 1 and a capturing and templating oligonucleotide (CTO; see U.S. Patent No. 8,809,239).
  • CTO capturing and templating oligonucleotide
  • this is a method in which a target oligonucleotide exponentially amplified by the template of FIG. 1 is hybridized to the 3' capturing portion of the CTO to generate a signal.
  • the CTO includes a capturing portion including a nucleotide sequence complementary to the target oligonucleotide in the 3' to 5' direction and a templating portion including a nucleotide sequence non-complementary to the target oligonucleotide.
  • the CTO includes an interactive dual label consisting of a quencher molecule and a fluorescent reporter molecule in the templating portion.
  • the target oligonucleotide When a target oligonucleotide is present, the target oligonucleotide is annealed to the capturing portion of the CTO and extended on the templating portion of the CTO to form an extended duplex (dimer CTO) with the CTO.
  • the formation of the extended duplex provides a signal, and the signal generated dependently on the presence of the target oligonucleotide can be detected by measuring the signal at the extended duplex-forming temperature.
  • the method using the above CTO can be classified into a process in which a target oligonucleotide hybridized to the CTO is extended to form an extended strand, and then the extended strand is detected.
  • the method using the above CTO is characterized in that the formation of the extended strand is detected using a duplex between the extended strand and the CTO.
  • the EXPAR technology using CTO improved the sensitivity and specificity for target oligonucleotide detection to an equivalent level or higher compared to the conventional fluorescence generation method using intercalating dyes.
  • the inventors of the present invention have made efforts to improve the detection efficiency of EXPAR technology by using a method of generating a signal using interactive dual labels, while being able to more quickly and clearly distinguish it from a signal resulting from non-specific amplification.
  • the inventors of the present invention have developed a detection oligonucleotide capable of simultaneously implementing EXPAR amplification and signal detection.
  • a detection oligonucleotide according to one embodiment is as shown in FIG. 4.
  • Hybridization of the target oligonucleotide with the detector oligonucleotide or an extended strand thereof causes a change in a signal from the interactive dual label to provide a detectable signal, and detection of the signal indicates the presence of the target oligonucleotide.
  • the interactive dual label is located on the detector oligonucleotide itself, which implements exponential amplification of the target oligonucleotide
  • the isothermal amplification reaction of step (b) can generate a signal indicating the presence of the target oligonucleotide simultaneously with the amplification of the target oligonucleotide.
  • the signal generation mechanism may vary to some extent, but all of the above-detected signal generation mechanisms are based on hybridization of the first template region of the detecting oligonucleotide and the target oligonucleotide.
  • the reporter molecule and the quencher molecule of the interactive dual label are located in the first template region of the detector oligonucleotide, and hybridization of the target oligonucleotide and the detector oligonucleotide can induce a change in a signal from the interactive dual label to provide a detectable signal (see the third and fourth structures in FIG. 4).
  • hybridization of the target oligonucleotide and the detector oligonucleotide in step (a) can generate a signal indicating the presence of the target oligonucleotide
  • the target oligonucleotide exponentially generated through the isothermal amplification reaction in step (b) can generate a signal indicating the presence of the target oligonucleotide through step (a).
  • the reporter molecule and the quencher molecule of the interactive dual label are located in the second template region of the detector oligonucleotide, and the generation of an extended strand of the target oligonucleotide can induce a change in a signal from the interactive dual label to provide a detectable signal (see the first structure in FIG. 4).
  • the isothermal amplification reaction of step (b) caused by hybridization of the target oligonucleotide and the detector oligonucleotide of step (a) generates a signal indicating the presence of the target oligonucleotide simultaneously with the amplification of the target oligonucleotide, wherein the target oligonucleotide generated exponentially can hybridize to the detector oligonucleotide through step (a) and generate a signal indicating the presence of the target oligonucleotide through step (b).
  • the first template region of the detector oligonucleotide has one of the interactive dual labels comprising a reporter molecule and a quencher molecule
  • the second template region has the other of the interactive dual labels
  • hybridization of the target oligonucleotide and the detector oligonucleotide and generation of an extended strand thereof can induce a change in a signal from the interactive dual labels to provide a detectable signal (see the second structure in FIG. 4).
  • each of the first template region and the second template region of the detection oligonucleotide may include both a reporter molecule and a quencher molecule.
  • a signal indicating the presence of the target is provided not only in the hybridization of the target oligonucleotide and the detection oligonucleotide, but also in the amplification reaction after hybridization, so that a stronger signal intensity can be exhibited.
  • the quencher molecule quenches a signal from the reporter molecule before the target oligonucleotide hybridizes to the detector oligonucleotide or an extension strand thereof is generated.
  • Hybridization of the target oligonucleotide or generation of an extension strand thereof dissociates the reporter molecule and the quencher molecule from each other, so that a detectable signal can be provided from the reporter molecule.
  • a signal can be provided dependently on the formation of a duplex formed by hybridization of the detector oligonucleotide and the target oligonucleotide and/or extension of the hybridized target oligonucleotide, which occurs dependently on the presence of the target oligonucleotide.
  • a kit for detecting a target oligonucleotide comprising:
  • a detector oligonucleotide wherein the detector oligonucleotide comprises a first template region, a nicking enzyme recognition region and a second template region in a 3' to 5' order, wherein the first template region and the second template region independently have a hybridizing nucleotide sequence substantially complementary to a target oligonucleotide, and wherein the detector oligonucleotide comprises an interactive dual label comprising a reporter molecule and a quencher molecule;
  • kit according to one embodiment of the present invention is manufactured to carry out the method for detecting the target oligonucleotide of embodiment I, common contents therebetween are omitted to avoid excessive duplication that would complicate the present specification.
  • contents regarding the detection oligonucleotide, strand displacement nucleic acid polymerase, and nicking enzyme applied to the kit are as described above in the method for detecting the target oligonucleotide.
  • the kit can include instructions describing the method of aspect I.
  • the instructions can be recorded on a suitable recording medium.
  • the instructions can be printed on a substrate such as paper and plastic.
  • the instructions can be present as an electronic storage data file present on a suitable computer readable recording medium such as a CD-ROM and a diskette.
  • the kit does not include actual instructions, but means are provided for obtaining the instructions from a remote source, such as via the Internet.
  • An example of such an embodiment is a kit that includes a web address from which the instructions can be viewed and/or a web address from which the instructions can be downloaded.
  • Example 1 Comparison of target detection using intercalating dyes and CTO
  • X'rX' (SEQ ID NO: 1) as amplification oligonucleotide, 0.75 ⁇ L Nt.BstNBI (NEB, R0607L), 0.3 ⁇ L Bst 2.0 WarmStart DNA polymerase (NEB, M0538L), 0.3 mM deoxynucleotide (dNTP) solution mix (NEB, N0447L), 2 mM magnesium sulfate (MgSO 4 ) solution (NEB, B1003S), Quant-iT PicoGreen dsDNA reagent as an intercalating dye (Invitrogen, P7581), 5X buffer (40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO 4 , 10 mM (NH 4 ) 2 SO 4 , 0.5 mM A final 20 ⁇ L target detection reagent (i) was prepared, including DTT.
  • X'rX' (SEQ ID NO: 1) as an amplification oligonucleotide, 1.25 pmole of CTO (Capturing and Templating Oligonucleotides, SEQ ID NO: 2), 0.75 ⁇ L Nt.BstNBI (NEB, R0607L), 0.3 ⁇ L Bst 2.0 WarmStart DNA polymerase (NEB, M0538L), 0.3 mM deoxynucleotide (dNTP) solution mix (NEB, N0447L), 2 mM magnesium sulfate (MgSO 4 ) solution (NEB, B1003S), 5X buffer (40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO 4 , 10 mM (NH 4 ) 2 SO 4 , 0.5 mM DTT) was used.
  • a final 20 ⁇ L target detection reagent (i) as an amplification oligonucleotide,
  • the CTO comprises, in the 3' to 5' direction, (i) a capturing portion comprising a nucleotide sequence complementary to a target oligonucleotide and (ii) a templating portion comprising a nucleotide sequence non-complementary to the target oligonucleotide.
  • the CTO is labeled with a quencher molecule (BHQ-1) at the 5'-end and a fluorescent reporter molecule (Cal Fluor Orange 560) at the templating portion.
  • the template and CTO are blocked with a carbon spacer at the 3'-end to prevent extension.
  • the target oligonucleotide When a target oligonucleotide is present, the target oligonucleotide is annealed to the capturing portion of the CTO and extended on the templating portion of the CTO to form an extended duplex (dimer CTO) with the CTO.
  • the formation of the extended duplex provides a signal, and an amplification curve can be obtained by measuring the signal at the extended duplex-forming temperature.
  • the sequence and length of the extended duplex for the target oligonucleotide were designed to form the duplex at 55°C to provide a signal.
  • Each of the 20 ⁇ L of target detection reagents (i) and (ii) prepared above was mixed with 5 ⁇ L of target oligonucleotide (SEQ ID NO: 4) at four different concentrations (Concentration 1: 2 ⁇ 10 9 copies/ ⁇ L, Concentration 2: 2 ⁇ 10 7 copies/ ⁇ L, Concentration 3: 2 ⁇ 10 5 copies/ ⁇ L, Concentration 4: 2 ⁇ 10 3 copies/ ⁇ L) to prepare a reaction mixture in a final volume of 25 ⁇ L.
  • the tube containing the above reaction mixture was placed in a real-time thermocycler (CFX96, Bio-Rad) and reacted at 55°C, and the signal detection was measured every 17 seconds.
  • the Ct value was calculated by Auto calculated single threshold, and all experiments were repeated twice.
  • a negative control reaction was also performed under the same conditions as above using a reaction mixture containing 5 ⁇ L of distilled water instead of the target oligonucleotide (SEQ ID NO: 4).
  • the signal detection results are shown in Fig. 5 and Table 2.
  • a reaction mixture was prepared in a final volume of 25 ⁇ L by mixing 5 ⁇ L of 80 ng/ ⁇ L human genomic DNA (hgDNA) with 20 ⁇ L of the target detection reagents (i) and (ii) prepared above.
  • the tube containing the above reaction mixture was placed in a real-time thermocycler (CFX96, Bio-Rad) and reacted at 55°C, and the signal detection was measured every 17 seconds.
  • the Ct value was calculated by Auto calculated single threshold, and all experiments were repeated twice.
  • a negative control reaction was also performed under the same conditions as above using a reaction mixture containing 5 ⁇ L of distilled water instead of the hgDNA.
  • the signal detection results are shown in Fig. 6 and Table 3.
  • Non-target nucleic acid hgDNA Voice control group Average Ct Target detection reagent (i) 14.41 26.03 Target detection reagent (ii) 21.20 21.14
  • the conventional method using intercalating dye shows a clear difference in the average Ct value of the signal for hgDNA, which is not the detection target, from the average Ct value of the signal due to the non-specific reaction in the negative control group, and thus the specificity is somewhat low.
  • the method using CTO shows a superior specificity for the target oligonucleotide compared to the intercalating dye method, as the average Ct values of the signal for hgDNA and the signal for the negative control group are almost the same.
  • target detection reagent (iii) As a control, a final 20 ⁇ L of target detection reagent (iii) was prepared with the same composition as target detection reagent (ii) in Example 1, except that 5X buffer (40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO 4 , 10 mM (NH 4 ) 2 SO 4 , 1.2 mM EGTA) was used.
  • 5X buffer 40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO 4 , 10 mM (NH 4 ) 2 SO 4 , 1.2 mM EGTA
  • a detection oligonucleotide for which amplification and detection can be implemented in a single reaction for target oligonucleotide detection 1.25 pmole of RQ-X'rX' (SEQ ID NO: 3), 0.75 ⁇ L Nt.BstNBI (NEB, R0607L), 0.3 ⁇ L Bst 2.0 WarmStart DNA polymerase (NEB, M0538L), 0.3 mM deoxynucleotide (dNTP) solution mix (NEB, N0447L), 2 mM magnesium sulfate (MgSO 4 ) solution (NEB, B1003S), 5X buffer (40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO 4 , 10 mM (NH 4 ) 2 SO 4 , 1.2 mM EGTA) was included in a final 20 ⁇ L of target detection reagent. (iv) was manufactured.
  • a reaction mixture was prepared by mixing 5 ⁇ L of target oligonucleotide (SEQ ID NO: 4) at three concentrations (Concentration 1: 2 ⁇ 10 10 copies/ ⁇ L, Concentration 2: 2 ⁇ 10 8 copies/ ⁇ L, Concentration 3: 2 ⁇ 10 6 copies/ ⁇ L) with 20 ⁇ L of target detection reagent (iii) and (iv) to prepare a final volume of 25 ⁇ L.
  • SEQ ID NO: 4 target oligonucleotide
  • the tube containing the above reaction mixture was placed in a real-time thermocycler (CFX96, Bio-Rad) and reacted at 55°C, and the signal detection was measured every 17 seconds.
  • the Ct value was calculated by Auto calculated single threshold, and all experiments were repeated twice.
  • a negative control reaction was also performed under the same conditions as above using a reaction mixture containing 5 ⁇ L of distilled water instead of the target oligonucleotide (SEQ ID NO: 4).
  • the signal detection results are shown in Fig. 7, Table 4, and Table 5.
  • Target detection reagent 61.27 30.42 5.90 Target detection reagent (iv) 72.78 33.85 9.58
  • the detection method using the detection oligonucleotide according to one embodiment of the present invention has a much shorter TAT (turn around time) than the CTO-using method, and has excellent sensitivity at all concentrations.
  • the method according to one embodiment of the present invention implements a rapid and accurate isothermal amplification method, as the Ct% is high at all tested concentrations, which is clearly distinguished from non-specific reactions.
  • Example 1 it was confirmed in Example 1 that the above CTO utilization method is superior in both detection specificity and sensitivity compared to the conventional intercalating dye method. Therefore, it can be inferred that the detection oligonucleotide of the present invention simultaneously implements amplification and signal detection in a single isothermal amplification reaction, thereby detecting the target nucleic acid sequence in a more accurate and rapid manner than the conventional technology.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법에 관한 것이다. 본 발명의 방법은 등온 증폭방법으로서 매우 정확하고 신속하면서도, 높은 민감도로 타겟 올리고뉴클레오타이드를 검출할 수 있다.

Description

검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법
본 발명은 검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법에 관한 것이다.
핵산 증폭 기술은 분자생물학 및 생명공학 분야에서 주로 사용되는 기술로 샘플 내에 존재하는 소량의 타겟 핵산을 검출하고 분석할 수 있는 방법이다. 핵산 증폭을 위해 PCR(Polymerase chain reaction) 기술이 가장 흔히 사용되며, 이는 이중 가닥 DNA를 단일 가닥 DNA로 변성시킨 후, 여기에 프라이머를 어닐링시키고, 어닐링된 프라이머를 중합효소에 의해 연장시키는 일련의 과정을 반복한다.
형광물질을 이용한 실시간 PCR 방법은 PCR 과정 중에 핵산 증폭에 따른 형광 세기의 증가를 검출하는 방법이다. 실시간 PCR 방법은 타겟마다 상이한 형광 염료를 사용함으로써 멀티플렉스 검출이 가능한 장점이 있으나, 미세한 온도 조절을 위한 고가의 장비를 필요로 하고, 검출까지 시간이 많이 소요되는 단점이 있다.
PCR 방법의 대안으로서, 고가의 실시간 PCR 장비가 필요 없으며 PCR에 비해 더 빠른 시간 내에 타겟 핵산을 검출할 수 있는 등온 증폭법(Isothermal amplification method)이 개발되었다. 등온 증폭법은 현장진단(point-of-care testing, POCT) 시스템에 적용할 수 있는 기술로, DNA 변성 (denaturation), 프라이머의 접합 (annealing), 중합효소의 신장 (extension)에 필요한 온도 변화 과정 없이 일정한 온도에서 증폭 반응의 수행이 가능한 기술이다.
등온 증폭법의 예로는 RCA(rolling circle amplification, M. M. Ali, F. Li, Z. Zhang, K. Zhang, D.-K. Kang, J. A. Ankrum, X. C. Le and W. Zhao, Chem. Soc. Rev., 2014, 43, 3324-3341.), LAMP(loop-mediated isothermal amplification, Y. Mori, H. Kanda and T. Notomi, J. Infect. Chemother., 2013, 19, 404-411), RPA(recombinase polymerase amplification, J. Li, J. Macdonald and F. von Stetten, Analyst, 2018, 144, 31-67), NASBA(nucleic acid sequence based amplification, A. Borst, J. Verhoef, E. Boel and A. C. Fluit, Clin. Lab., 2002, 48, 487-492), SDA(strand displacement amplification, B. J. Toley, I. Covelli, Y. Belousov, S. Ramachandran, E. Kline, N. Scarr, N. Vermeulen, W. Mahoney, B. R. Lutz and P. Yager, Analyst, 2015, 140, 7540-7549), HDA(helicase dependent amplification, M. Vincent, Y. Xu and H. Kong, EMBO Rep., 2004, 5, 795-800), TMA(transcription-mediated amplification, L. Comanor, Am. J. Gastroenterol., 2001, 96, 2968-2972), EXPAR(exponential amplification reaction, J. V. Ness et al., Proc . Natl. Acad. Sci. USA, 2003, 100(8), 4504 - 4509) 등이 있다.
이러한 등온 증폭 기술은 온도 조절이 필요하지 않기 때문에 보다 빠른 시간 내에 타겟 핵산의 증폭을 가능하게 한다. 또한, 등온 증폭 기술은 온도 변화에 따른 DNA 손실 및 손상을 예방할 수 있어 매우 높은 증폭 효율을 보인다는 장점이 있다. 이들 등온 증폭 기술 중에서도, LAMP 기술은 약 1시간의 짧은 반응 시간 내에 최대 109배의 표적 핵산의 증폭 효율을 구현함으로써, 현장 진단 기술로서의 높은 활용 가능성을 보유한 기술로 간주되어 왔다. 하지만, LAMP 기술은 프라이머 디자인이 복잡하며, 많은 종류의 프라이머를 사용하기 때문에 프라이머 간 무작위적 혼성화에 따라 비특이적 증폭 반응이 발생하고, 이에 따른 배경 시그널 또한 빠르게 증폭된다는 단점이 있다.
한편, EXPAR 기술은 등온의 반응 조건 하에서 DNA 중합효소와 니킹 효소를 이용하여 다소 짧은 단일 가닥의 타겟 핵산을 기하급수적으로 증폭하는 기술이다. EXPAR는 증폭 효율이 좋고 반응 시간이 30분 정도로 짧아 타겟 핵산 분석을 비롯한 다양한 생체분자 분석에 활용되고 있으며, 특히 microRNA 분석 등에 효과적으로 사용되었다. 그러나 EXPAR는 타겟 핵산이 없는 경우에도 증폭 반응이 진행되는, 이른바 비특이적 증폭 반응이 일어나는 큰 문제점을 가지고 있다. 이러한 EXPAR의 비특이적 증폭 반응의 원인은 명확히 밝혀지지는 않았으나, 등온 반응 조건 상에서 EXPAR 주형의 2차 구조 형성 및 이와 효소와의 반응으로 인해 일어나는 것으로 여겨지고 있다(E. Tan et al., Biochemistry, 2008, 47, 9987 - 9999). 이러한 비특이적 증폭 반응으로 인해 EXPAR의 특이도 및 재현성이 떨어지며, 다중 타겟 분석도 어렵다.
이에, 비특이적 증폭 반응으로 인한 타겟 핵산 검출의 성능 저하를 개선할 수 있는 새로운 등온 핵산 증폭 기술을 개발하고자 예의 노력한 결과, EXPAR 주형의 민감도를 향상시킴으로써 특이적 증폭에 의해 검출되는 시그널과 비특이적 증폭에 의해 검출되는 시그널을 명확히 구별할 수 있다는 것을 확인하고 본 발명을 완성하였다.
본 명세서 전체에 걸쳐 다수의 인용문헌 및 특허 문헌이 참조되고 그 인용이 표시되어 있다. 인용된 문헌 및 특허의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 비특이적 증폭 반응으로 인한 타겟 핵산 검출의 성능 저하를 개선할 수 있는 새로운 등온 핵산 증폭 기술을 개발하고자 예의 노력한 결과, 단일의 등온 반응에서 시그널의 증폭 및 검출을 동시에 제공할 수 있는 니킹 효소 인식 영역을 포함하는 주형을 구현함으로써, 타겟 핵산의 검출 성능을 개선시킬 수 있다는 것을 확인하였다.
따라서, 본 발명의 목적은 타겟 올리고뉴클레오타이드를 검출하는 방법을 제공하는 것이다.
본 발명의 다른 목적은 타겟 올리고뉴클레오타이드를 검출하기 위한 키트를 제공하는 것이다.
본 발명의 다른 목적 및 이점은 첨부한 청구범위 및 도면과 함께 하기의 상세한 설명에 의해 보다 명확해질 것이다.
본 발명의 일 양태에 따르면, 다음의 단계를 포함하는 타겟 올리고뉴클레오타이드를 검출하는 방법을 제공한다:
(a) 상기 타겟 올리고뉴클레오타이드를 검출 올리고뉴클레오타이드와 혼성화하는 단계로서;
상기 검출 올리고뉴클레오타이드는 3'에서 5' 방향으로 제1 주형 영역, 니킹 효소(nicking enzyme) 인식 영역 및 제2 주형 영역을 포함하고,
상기 제1 주형 영역 및 제2 주형 영역은 서로 독립적으로, 상기 타겟 올리고뉴클레오타이드와 실질적으로 상보적인 혼성화 뉴클레오타이드 서열을 가지며,
상기 검출 올리고뉴클레오타이드는 리포터 분자 및 상기 리포터 분자로부터의 시그널을 퀀칭할 수 있는 퀀처 분자를 포함하는 상호작용적 이중 표지로 표지되어 있고,
상기 타겟 올리고뉴클레오타이드는 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 혼성화되며;
(b) 등온 조건 하에서, 상기 단계 (a)의 결과물을 니킹 효소 및 가닥 치환(strand displacement) 핵산 중합효소와 인큐베이팅하는 단계로서;
상기 제1 주형 영역에 혼성화된 타겟 올리고뉴클레오타이드는 상기 가닥 치환 핵산 중합효소에 의해 연장되어 상기 검출 올리고뉴클레오타이드에 상보적인 연장 가닥을 생성하고, 상기 연장 가닥은 상기 니킹 효소에 의해 상기 니킹 효소 인식 영역에서 절단되며, 상기 절단된 가닥은 상기 가닥 치환 핵산 중합효소에 의해 그의 3'-말단으로부터 연장되어 상기 타겟 올리고뉴클레오타이드를 방출하며; 및
(c) 상기 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 검출하는 단계로서;
상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 초래하여 상기 타겟 올리고뉴클레오타이드의 존재를 나타내는 검출 가능한 시그널을 제공한다.
일 구현예에서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화는 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다.
일 구현예에서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 상기 검출 올리고뉴클레오타이드의 제2 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드의 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다.
일 구현예에서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자 중 하나는 제1 주형 영역에 위치하고 다른 하나는 제2 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다.
일 구현예에서, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성 전에는 상기 퀀처 분자는 상기 리포터 분자로부터의 시그널을 퀀칭하는 반면, 상기 타겟 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 리포터 분자와 상기 퀀처 분자를 서로 분리시켜 상기 리포터 분자로부터 검출 가능한 시그널을 제공할 수 있다.
일 구현예에서, 상기 타겟 올리고뉴클레오타이드는 관심 병원체로부터 유래된 또는 생성된 핵산 서열 또는 이의 상보적인 핵산 서열을 포함할 수 있다.
일 구현예에서, 상기 가닥 치환 핵산 중합효소는 Bst 큰 단편 중합효소, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), Φ29 파아지, MS-2 파아지, Z-Taq, KOD, 클레나우 단편, GspSSD, GspF, OmniAmp 중합효소, SD 중합효소 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나일 수 있다.
일 구현예에서, 상기 니킹 효소는 Nb.BbvCⅠ, Nt.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsⅠ, Nt.BsmAI, Nt.BspQI, Nb.BsrDI, Nt.BstNBⅠ, Nb.BssSI, Nt.Alw 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나일 수 있다.
본 발명의 다른 양태에 따르면, 다음을 포함하는 타겟 올리고뉴클레오타이드를 검출하기 위한 키트를 제공한다:
(a) 검출 올리고뉴클레오타이드;
상기 검출 올리고뉴클레오타이드는 3'에서 5' 방향으로 제1 주형 영역, 니킹 효소(nicking enzyme) 인식 영역 및 제2 주형 영역을 포함하고,
상기 제1 주형 영역 및 제2 주형 영역은 서로 독립적으로, 상기 타겟 올리고뉴클레오타이드와 실질적으로 상보적인 혼성화 뉴클레오타이드 서열을 가지며,
상기 검출 올리고뉴클레오타이드는 리포터 분자 및 상기 리포터 분자로부터의 시그널을 퀀칭할 수 있는 퀀처 분자를 포함하는 상호작용적 이중 표지로 표지되어 있고;
(b) 가닥 치환 핵산 중합효소;
(c) 니킹 효소; 및
(d) dNTPs.
일 구현예에서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화는 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다.
일 구현예에서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 상기 검출 올리고뉴클레오타이드의 제2 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드의 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다.
일 구현예에서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자 중 하나는 제1 주형 영역에 위치하고 다른 하나는 제2 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다.
일 구현예에서, 상기 타겟 올리고뉴클레오타이드는 관심 병원체의 존재하에 유래된 또는 생성된 핵산 서열 또는 이의 상보적인 핵산 서열을 포함할 수 있다.
일 구현예에서, 상기 가닥 치환 핵산 중합효소는 Bst 큰 단편 중합효소, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), Φ29 파아지, MS-2 파아지, Z-Taq, KOD, 클레나우 단편, GspSSD, GspF, OmniAmp 중합효소, SD 중합효소 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나일 수 있다.
일 구현예에서, 상기 니킹 효소는 Nb.BbvCⅠ, Nt.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsⅠ, Nt.BsmAI, Nt.BspQI, Nb.BsrDI, Nt.BstNBⅠ, Nb.BssSI, Nt.Alw 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나일 수 있다.
본 발명의 특징 및 장점은 하기와 같이 요약될 것이다:
(a) 본 발명은 타겟 올리고뉴클레오타이드의 증폭으로 인해 검출된 시그널과 비타겟 핵산의 비특이적 증폭으로 인해 검출된 시그널을 명확히 구별할 수 있어, 보다 정확하고, 높은 민감도를 나타낼 수 있다.
(b) 특히, 본 발명은 타겟 올리고뉴클레오타이드의 증폭 및 시그널 발생이 단일 등온 증폭 반응에서 진행되는 검출 시스템을 구현하는 바, 보다 신속하게 타겟 올리고뉴클레오타이드를 우수한 효율로 검출할 수 있다.
(c) 본 발명은 온도 조절 등을 위한 장비를 필요로 하지 않으므로, 현장 분자진단이 필요한 대형 병원, 수탁 검사 기관, 연구소 등에서 유용하게 적용될 수 있다.
(d) 본 발명은 타겟 올리고뉴클레오타이드의 혼성화 반응 후, 니킹 효소와 핵산 중합효소의 작용으로 인해 타겟 올리고뉴클레오타이드가 지수함수적으로 증폭되는 EXPAR 기술을 현저히 개선하는데 기여할 수 있다.
도 1은 EXPAR 기술의 주형을 도식화한 것이다.
도 2는 EXPAR 기술의 등온 증폭 반응 과정을 도식화한 것이다.
도 3은 종래 EXPAR 기술의 주형과 CTO를 이용한 검출 반응을 도식화한 것이다.
도 4는 본 발명의 일 구현예에 따른 검출 올리고뉴클레오타이드를 도식화한 것이다.
도 5는 실시예 1의 타겟 올리고뉴클레오타이드 농도별 실험에서 수득된 증폭 곡선이다.
도 6은 실시예 1의 특이도 분석 실험에서 수득된 증폭 곡선이다.
도 7은 실시예 2의 타겟 올리고뉴클레오타이드 농도별 실험에서 수득된 증폭 곡선이다.
본 발명의 가장 큰 특징은 등온 증폭법을 통해 타겟 핵산을 검출할 때, 증폭 및 시그널 발생이 단일 반응에서 동시에 진행되는 검출 시스템을 이용하여 높은 효율로 신속하게 타겟 핵산을 검출하는 것이다. 종래 EXPAR 시스템은 비특이적 증폭으로 인한 시그널과 특이적 증폭으로 인한 시그널이 구별되지 않는 낮은 특이도로 인해 타겟 핵산의 검출 정확도가 좋지 않은 문제가 있었다.
이에 반해, 본 발명의 검출 방법은 주형 영역 - 니킹 효소 인식 영역 - 주형 영역으로 구성되고 리포터 분자와 퀀처 분자가 표지된 검출 올리고뉴클레오타이드를 디자인함으로써, 민감도 및 특이도를 향상시켜 이와 같은 문제를 해결하였다.
I. 타겟 올리고뉴클레오타이드를 검출하는 방법
본 발명의 일 양태는, 다음의 단계를 포함하는 타겟 올리고뉴클레오타이드를 검출하는 방법을 제공한다:
(a) 상기 타겟 올리고뉴클레오타이드를 검출 올리고뉴클레오타이드와 혼성화하는 단계로서;
상기 검출 올리고뉴클레오타이드는 3'에서 5' 방향으로 제1 주형 영역, 니킹 효소(nicking enzyme) 인식 영역 및 제2 주형 영역을 포함하고,
상기 제1 주형 영역 및 제2 주형 영역은 서로 독립적으로, 상기 타겟 올리고뉴클레오타이드와 실질적으로 상보적인 혼성화 뉴클레오타이드 서열을 가지며,
상기 검출 올리고뉴클레오타이드는 리포터 분자 및 상기 리포터 분자로부터의 시그널을 퀀칭할 수 있는 퀀처 분자를 포함하는 상호작용적 이중 표지로 표지되어 있고,
상기 타겟 올리고뉴클레오타이드는 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 혼성화되며;
(b) 등온 조건 하에서, 상기 단계 (a)의 결과물을 니킹 효소 및 가닥 치환(strand displacement) 핵산 중합효소와 인큐베이팅하는 단계로서;
상기 제1 주형 영역에 혼성화된 타겟 올리고뉴클레오타이드는 상기 가닥 치환 핵산 중합효소에 의해 연장되어 상기 검출 올리고뉴클레오타이드에 상보적인 연장 가닥을 생성하고, 상기 연장 가닥은 상기 니킹 효소에 의해 상기 니킹 효소 인식 영역에서 절단되며, 상기 절단된 가닥은 상기 가닥 치환 핵산 중합효소에 의해 그의 3'-말단으로부터 연장되어 상기 타겟 올리고뉴클레오타이드를 방출하며; 및
(c) 상기 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 검출하는 단계로서;
상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 초래하여 상기 타겟 올리고뉴클레오타이드의 존재를 나타내는 검출 가능한 시그널을 제공한다.
단계 (a): 검출 올리고뉴클레오타이드와 타겟 올리고뉴클레오타이드의 혼성화
본 단계는, 3'to 5' 순서로 제1 주형 영역, 니킹 효소(nicking enzyme) 인식 영역 및 제2 주형 영역을 포함하는 검출 올리고뉴클레오타이드와 타겟 올리고뉴클레오타이드를 반응시킨다.
본원에서 사용되는 용어 "타겟 올리고뉴클레오타이드"는 검출 또는 정량하고자 하는 핵산의 영역을 의미하며, 타겟 핵산, 타겟 핵산 서열, 또는 타겟 영역과 상호교환적으로 사용될 수 있다. 예를 들어, 타겟 올리고뉴클레오타이드는 샘플에 존재하거나 특정 주형 등에 의한 기타 반응에 의해 생성된 핵산 서열의 카피를 포함한다. 즉, 상기 타겟 올리고뉴클레오타이드는 특정 반응에서 새롭게 생성된 서열뿐만 아니라 채취된 샘플 내에 초기에 존재하는 서열을 포함한다.
상기 타겟 올리고뉴클레오타이드는 단일 또는 이중-가닥 데옥시리보뉴클레오타이드 또는 리보뉴클레오타이드 중합체를 포함할 수 있으며, 비제한적인 예로서, 유전자의 코딩 또는 비-코딩 서열, 센스 및 안티센스 서열, 엑손, 인트론, 게놈 DNA, cDNA, 프리-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, 리보자임, 재조합 폴리뉴클레오타이드, 단리 및 정제된 자연 발생 DNA 또는 RNA 서열, 합성 RNA 및 DNA 서열, 핵산 프로브, 프라이머, 단편, 유전자 구조물, 벡터 및 변형된 폴리뉴클레오타이드를 포함할 수 있다. 출발 물질로서 상기 타겟 올리고뉴클레오타이드가 이중 가닥인 경우, 상기 두 가닥을 단일 가닥 또는 부분적 단일 가닥 형태로 만드는 것이 바람직하다.
상기 타겟 올리고뉴클레오타이드는 임의의 자연발생 원핵세포, 진핵세포(예를 들어, 원생동물 및 기생동물, 균류, 효모, 고등 식물, 하등 및 포유동물 및 인간을 포함하는 고등 동물), 바이러스(예를 들어, 헤르페스 바이러스, HIV, 인플루엔자 바이러스, 엡스타인-바 바이러스, 간염 바이러스, 폴리오 바이러스 등), 또는 비로이드 핵산을 포함한다. 또한, 상기 타겟 올리고뉴클레오타이드는 재조합에 의해 또는 화학적으로 생산되거나 생산될 수 있는 임의의 핵산 분자일 수 있다. 따라서, 상기 타겟 올리고뉴클레오타이드는 자연에서 발견되거나 발견되지 않을 수 있다.
상기 타겟 올리고뉴클레오타이드는 지정된 시점에 알려진 서열 또는 지정된 시점 이후로 이용가능한 서열로 제한하는 것으로 해석되지 않아야 하며, 대신에 현재 또는 미래의 어느 시점에 이용가능하거나 알려질 수 있는 서열을 포함하는 것으로 해석되어야 한다. 즉, 상기 타겟 올리고뉴클레오타이드는 본 발명의 방법을 실시하는 시점에 알려지거나 알려지지 않을 수 있다. 미지의 핵산 서열의 경우, 그의 서열은 본 발명의 방법을 실시하기 전에 종래의 시퀀싱 방법 중 하나에 의해 결정될 수 있다.
예를 들어, 상기 타겟 올리고뉴클레오타이드는 생물학적 샘플 내의 관심 병원체의 핵산 서열, 이의 일부 서열 또는 이와 상보적인 뉴클레오타이드 서열을 포함하거나 또는 관심 병원체로부터 유래된 또는 생성된 핵산 서열 또는 이의 상보적인 핵산 서열을 포함할 수 있다.
일 구현예에서, 상기 타겟 올리고뉴클레오타이드는 뉴클레오타이드 변이를 포함할 수 있다.
본원에서 사용되는 용어 "뉴클레오타이드 변이"는 서열이 유사한 연속의 DNA 세그먼트 중 특정 위치의 DNA 서열에서의 임의의 단일 또는 복수의 뉴클레오타이드 치환, 결실 또는 삽입을 의미한다. 이러한 연속적 DNA 세그먼트들은 하나의 유전자 또는 하나의 염색체의 임의의 다른 부위를 포함한다. 이러한 뉴클레오타이드 변이는 돌연변이(mutant) 또는 다형성 대립유전자 변이(polymorphic allele variations)일 수 있다. 예를 들어, 본 발명에서 검출되는 뉴클레오타이드 변이는 단일 뉴클레오타이드 다형성(single nucleotide polymorphism; SNP), 돌연변이(mutation), 결실, 삽입, 치환 및 전좌를 포함한다. 뉴클레오타이드 변이의 예는, 인간 게놈 내의 다양한 변이(예컨대, 메틸렌사수소 엽산 환원효소(methylenetetrahydrofolate reductase; MTHFR) 유전자의 변이), 병원체의 약제 내성과 관련된 변이 및 종양 형성-유발 변이를 포함한다. 본원에 사용된 용어 "뉴클레오타이드 변이"는 핵산 서열의 특정 위치에서의 임의의 변이를 포함한다. 즉, 용어 "뉴클레오타이드 변이"는 핵산 서열의 특정 위치에서의 야생형 및 그의 임의의 돌연변이형을 포함한다.
본원에 사용된 바와 같이, 용어 "샘플"은 생물학적 공급원으로부터의 세포, 조직 또는 유체, 또는 본 발명에 따라 유익하게 평가될 수 있는 어떠한 다른 미디엄(medium)을 의미한다. 상기 샘플은 바이러스, 세균, 조직, 세포, 혈액, 혈청, 혈장, 림프, 우유, 소변, 분변, 안구액, 타액, 정액, 뇌 추출물, 척수액, 충수, 비장 및 편도 조직 추출물, 양수, 복수 및 비-생물학적 시료(예컨대, 식품 및 물)를 포함한다. 또한, 상기 샘플은 생물학적 공급원으로부터 단리된 자연(natural-occurring)의 핵산 분자 및 합성한 핵산 분자를 포함한다. 특정 구현예에서, 상기 샘플은 자궁경부 스왑(cervical swab) 샘플 또는 액상 세포검사(liquid based cytology) 샘플이다.
본원에서 사용되는 용어 "검출 올리고뉴클레오타이드"는 타겟 올리고뉴클레오타이드와 반응하여 타겟 올리고뉴클레오타이드를 증폭시키는 역할을 하면서도 검출되는 시그널의 발생에 관여하는 올리고뉴클레오타이드를 총칭한다. 본 발명의 일 구현예에 따르면, 상기 검출 올리고뉴클레오타이드는 실제 시그널 발생에 관여하는 올리고뉴클레오타이드를 포함한다. 예를 들어, 타겟 올리고뉴클레오타이드와 검출 올리고뉴클레오타이드의 혼성화 또는 비-혼성화가 시그널 발생을 결정한다.
본 개시내용에 따르면, 상기 검출 올리고뉴클레오타이드는 3'to 5' 순서로 제1 주형 영역, 니킹 효소 인식 영역 및 제2 주형 영역을 포함한다.
EXPAR 기술은 도 1에 나타난 바와 같은 주형(template)을 이용하는 것이 알려져 있다. 본원에서 사용되는 용어 "EXPAR (exponential isothermal amplification reaction)"는 짧은 길이의 핵산을 핵산 중합효소와 니킹 효소(nicking enzyme)를 이용하여 증폭시키는 분자생물학적 기술로서, 올리고뉴클레오타이드 서열, 핵산 중합효소 및 절단 효소를 사용하여 특정 핵산 절편을 특이적으로 증폭시키는 신속한 등온 증폭 방법이다.
일 구현예에서, 상기 검출 올리고뉴클레오타이드는 도 1의 주형과 같이 타겟 올리고뉴클레오타이드와 결합할 수 있는, 즉, 이에 상보적인 염기 서열을 3'및 5'양 말단에 모두 포함하고 있으며, 그 사이에는 니킹 효소 인식 영역을 포함할 수 있다.
구체적으로, 상기 제1 주형 영역 및 제2 주형 영역은 서로 독립적으로, 타겟 올리고뉴클레오타이드와 실질적으로 상보적인 혼성화 뉴클레오타이드 서열을 가질 수 있다. 본원에서 사용되는 용어 "혼성화"는 상보적인 단일가닥 핵산들이 이중가닥 핵산을 형성하는 것을 의미한다. 혼성화는 2개의 핵산 가닥 간의 상보성이 완전한 경우나 일부 미스매치 염기가 존재하는 경우 발생할 수 있다. 혼성화에 필요한 상보성의 정도는 혼성화 조건에 따라 달라질 수 있으며, 특히 온도에 의하여 조절될 수 있다.
일 구현예에서, 상기 제1 주형 영역 및 상기 제2 주형 영역은 실질적으로 동일한 핵산 서열을 포함할 수 있다. 다른 구현예에서, 상기 제1 주형 영역 및 제2 주형 영역은 서로 다른 핵산 서열을 포함하고, 상기 제2 주형 영역에 상보적인 염기 서열이 상기 제1 주형 영역에 혼성화될 수 있다. 일 구현예에서, 상기 제2 주형 영역은 상기 제1 주형 영역보다 긴 핵산 서열을 포함할 수 있고, 말단에 니킹 효소 인식 서열을 더 포함할 수 있다. 일 구현예에서, 상기 제1 주형 영역과 타겟 올리고뉴클레오타이드의 결합 친화도가 제2 주형 영역과 타겟 올리고뉴클레오타이드의 결합 친화도보다 우수할 수 있다. 이와 같은 구조를 이용하면, 도 2에 나타난 바와 같은 메커니즘으로 타겟 올리고뉴클레오타이드가 제1 주형 영역에 혼성화되고, 이후 반응을 통해 제2 주형 영역에서 타겟 올리고뉴클레오타이드와 동일한 단편이 생성되는 등온 증폭을 수행할 수 있다. 이에 대해서는 이하 단계 (b)에서 보다 자세히 기술한다.
본 개시내용에 따르면, 상기 검출 올리고뉴클레오타이드는 리포터 분자 및 퀀처 분자를 포함하는 상호작용적 이중표지를 포함한다.
예를 들어, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 모두 검출 올리고뉴클레오타이드의 제1 주형 영역에 위치할 수 있다. 또한, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 모두 검출 올리고뉴클레오타이드의 제2 주형 영역에 위치할 수 있다. 또한, 상기 검출 올리고뉴클레오타이드의 제1 주형 영역이 리포터 분자 및 퀀처 분자를 포함하는 상호작용적 이중 표지 중 하나를 갖고, 제2 주형 영역이 상호작용적 이중 표지 중 나머지 하나를 가질 수 있다. 예를 들어, 상기 제1 주형 영역에 리포터 분자가 위치하고, 제2 주형 영역에 퀀처 분자가 위치하거나, 상기 제1 주형 영역에 퀀처 분자가 위치하고, 제2 주형 영역에 리포터 분자가 위치할 수 있다. 상기 검출 올리고뉴클레오타이드의 일 예시가 도 4에 도시되어 있다.
상기 상호작용적 형광 표지 시스템의 대표적 예로서, FRET(fluorescence resonance energy transfer) 형광 표지 시스템은 형광 리포터 분자(공여체 분자) 및 퀀처 분자(수용체 분자)를 포함한다. FRET에서 에너지 공여체는 형광성이나, 에너지 수용체는 형광성 또는 비-형광성일 수 있다. 상호작용적 표지 시스템의 다른 형태에서, 에너지 공여체는 비-형광성, 예컨대, 발색단(chromophore)이고 에너지 수용체는 형광성이다. 상호작용적 표지 시스템의 또 다른 형태에서, 에너지 공여체는 발광성(luminescent), 예컨대, 생물발광성, 화학발광성 또는 전기화학발광성이며 수용체는 형광성이다. 상호작용적 표지 시스템은 "접촉-매개 퀀칭(contact-mediated quenching)"에 기반한 이중 표지를 포함한다(Salvatore 등, Nucleic Acids Research, 2002 (30) no.21 e122 and Johansson 등, J. AM. CHEM. SOC 2002 (124) pp 6950-6956). 상기 상호작용적 표지 시스템은 최소 2개의 분자(예컨대, 염료) 간의 상호작용에 의해 시그널 변화를 유도하는 어떠한 표지 시스템도 포함한다.
본 발명에서 유용한 리포터 분자 및 퀀처 분자는 당업계에 알려진 어떠한 분자도 포함할 수 있다. 그 예는 다음과 같다: Cy2™ (506), YO-PRO™-1 (509), YOYO™-1 (509), Calcein (517), FITC (518), FluorX™ (519), Alexa™ (520), Rhodamine 110 (520), Oregon Green™ 500 (522), Oregon Green™ 488 (524), RiboGreen™ (525), Rhodamine Green™ (527), Rhodamine 123 (529), Magnesium Green™(531), Calcium Green™ (533), TO-PRO™-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3™ (570), Alexa™ 546 (570), TRITC (572), Magnesium Orange™ (575), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), Calcium Orange™ (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine Red™ (590), Cy3.5™ (596), ROX (608), Calcium Crimson™ (615), Alexa™ 594 (615), Texas Red (615), Nile Red (628), YO-PRO™-3 (631), YOYO™-3 (631), Rphycocyanin (642), C-Phycocyanin (648), TO-PRO™-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5™ (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) 및 Quasar 705 (610). 괄호의 숫자는 나노미터 단위로 표시한 최대 발광 파장이다. 바람직하게는, 리포터 분자 및 퀀처 분자는 JOE, FAM, TAMRA, ROX 및 플루오레세인-기반 표지를 포함한다.
적합한 형광 분자 및 적합한 리포터-퀀처 쌍은 다음과 같이 다양한 문헌에 개시되어 있다: Pesce 등, editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White 등, Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996); 미국 특허 제3,996,345호 및 제4,351,760호.
본 발명에서, 광범위 파장 또는 특정 파장의 형광을 퀀칭할 수 있는 비-형광 퀀처 분자(예컨대, 블랙 퀀처 또는 다크 퀀처)가 이용될 수 있다.
리포터 및 퀀처 분자를 포함하는 시그널링 시스템에서, 상기 리포터는 FRET의 공여체를 포함하고 퀀처는 FRET의 나머지 파트너(수용체)를 포함한다. 예를 들어, 플루오레세인 염료(fluorescein dye)는 리포터로 이용되고 로다민 염료(rhodamine dye)는 퀀처로 이용된다.
상기 상호작용적 이중 표지를 포함하는 검출 올리고뉴클레오타이드가 단일 가닥 상태로 존재하는 경우, 상기 가닥은 헤어핀 또는 랜덤 코일 구조를 형성하여 상호작용적 이중 표지 간의 퀀칭을 유도할 수 있다. 상기 검출 올리고뉴클레오타이드가 타겟 올리고뉴클레오타이드와 혼성화하거나 또는 이의 혼성화로 인한 연장반응이 일어나는 경우, 상기 퀀칭은 줄어든다.
이와 같이, 3'to 5' 순서로 제1 주형 영역, 니킹 효소 인식 영역 및 제2 주형 영역을 포함하면서, 제1 주형 영역 및/또는 제2 주형 영역에 상호작용적 이중표지의 리포터 분자 및 퀀처 분자를 포함하는 구조를 가지는 검출 올리고뉴클레오타이드는 타겟 올리고뉴클레오타이드와 혼성화할 수 있으며, 상기 타겟 올리고뉴클레오타이드가 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 혼성화될 수 있다.
단계 (b): 등온 증폭 반응의 수행
본 단계는, 상기 단계 (a)의 결과물을 니킹 효소 및 가닥 치환(strand displacement) 핵산 중합효소와 함께 인큐베이팅하는 단계이다. 예를 들어, 검출 올리고뉴클레오타이드의 제1 주형 영역과 타겟 올리고뉴클레오타이드의 혼성화물을, 니킹 효소 및 가닥 치환 핵산 중합효소와 함께 인큐베이팅하여 등온 증폭 반응을 실시할 수 있다.
본원에서 사용되는 용어, "가닥 치환 핵산 중합효소"는 핵산 중합 반응시 주형 가닥의 상류 영역에 결합되어 있는 가닥을 밀어내는 활성으로 인해 새로운 가닥으로 치환하는 핵산 중합효소를 의미한다. 상기 가닥 치환 핵산 중합효소는 Bst 큰 단편 중합효소, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), Φ29 파아지, MS-2 파아지, Z-Taq, KOD, 클레나우 단편, GspSSD, GspF, OmniAmp 중합효소, SD 중합효소 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나일 수 있으나 이에 한정되지 않으며, 중합 활성 및 치환 활성을 가지는 핵산 중합효소라면 어떤 것이든 사용할 수 있다.
본원에서 사용되는 용어, "니킹 효소"는 완전한 또는 부분적 이중 가닥의 뉴클레오타이드 서열을 인식하고, 인식 영역에 대해 특이적 위치에서 하나의 가닥만을 절단시키는 엔도뉴클레아제를 지칭한다. 상기 인식 영역은 절단 효소에 따라 상이하다. 예를 들어, Nt.BstNBI는 5'-GAGTCNNNNN-3'서열을 인식하여 5'to 3'방향으로 네번째 N 및 다섯번째 N 사이를 절단할 수 있다. 상기 니킹 효소는 Nb.BbvCⅠ, Nt.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsⅠ, Nt.BsmAI, Nt.BspQI, Nb.BsrDI, Nt.BstNBⅠ, Nb.BssSI, Nt.Alw 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나일 수 있으나 이에 한정되지 않으며, 절단 활성을 가지는 효소라면 어떤 것이든 사용할 수 있다.
상기 등온 증폭 반응은 도 2를 참조하여 설명할 수 있다. 한편, 도 2에 도시된 주형은 본 발명의 일 구현예에 따른 검출 올리고뉴클레오타이드에서 상호작용적 이중 표지가 생략된 구조이다. 단계 (a)에서 전술한 바와 같이, 타겟 올리고뉴클레오타이드가 검출 올리고뉴클레오타이드의 제1 주형 영역에 혼성화될 수 있다. 이후, 상기 제1 주형 영역에 혼성화된 타겟 올리고뉴클레오타이드는 핵산 중합효소에 의해 상기 검출 올리고뉴클레오타이드에 상보적인 연장 서열을 포함하는 연장 가닥을 생성한다. 니킹 효소 인식 영역을 비롯하여 제2 주형 영역을 주형으로 하여 연장된 연장 가닥은 결과적으로 상기 제2 주형 영역에 상응하는 위치에 타겟 올리고뉴클레오타이드와 동일한 핵산 서열을 포함한다.
다음으로, 상기 연장 가닥은 니킹 효소에 의해 상기 니킹 효소 인식 영역에서 절단이 유도될 수 있다. 이와 같이 절단이 발생한 영역에서, 가닥 치환 핵산 중합효소에 의해 연장 가닥의 3'말단이 연장되면서 절단 산물이 방출된다. 상기 절단 산물은 타겟 올리고뉴클레오타이드와 실질적으로 동일한 서열을 포함한다.
따라서, 상기 타겟 올리고뉴클레오타이드가 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 혼성화되면, 가닥 치환 핵산 중합효소 및 니킹 효소에 의해 절단 산물인 타겟 올리고뉴클레오타이드의 지수함수적 증폭을 구현할 수 있다.
단계 (c): 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널 검출
본 단계는 상기 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 검출한다. 이때, 상기 시그널은 전술한 검출 올리고뉴클레오타이드로부터 제공될 수 있다.
본 발명자들은 EXPAR 기술의 민감도 및 특이도를 보다 높이고자 연구하는 과정에서, 도 1에 기재된 주형 올리고뉴클레오타이드와 캡처링 앤드 템플레이팅 올리고뉴클레오타이드(Capturing and Templating Oligonucleotide; CTO; 미국 특허 제8,809,239호 참조)를 조합하여 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 발생시키는 등온 증폭 반응을 고안하였다.
도 3에 개략적으로 나타난 바와 같이, 이는 도 1의 주형에 의해 지수함수적으로 증폭된 타겟 올리고뉴클레오타이드가 CTO의 3' 캡처링 부위에 혼성화되어 시그널을 발생시키는 방법이다. 상기 CTO는 3'to 5'방향으로 상기 타겟 올리고뉴클레오타이드에 상보적인 뉴클레오타이드 서열을 포함하는 캡처링 부위 및 상기 타겟 올리고뉴클레오타이드에 비-상보적인 뉴클레오타이드 서열을 포함하는 템플레이팅 부위를 포함한다. CTO는 템플레이팅 부위에 퀀처 분자 및 형광 리포터 분자로 구성된 상호작용적 이중 표지를 포함한다.
타겟 올리고뉴클레오타이드가 존재하는 경우, 상기 타겟 올리고뉴클레오타이드가 CTO의 캡처링 부위에 어닐링되고, CTO의 템플레이팅 부위 상에서 연장되어 CTO와 연장이합체(이합체 CTO)를 형성한다. 상기 연장이합체의 형성은 시그널을 제공하며, 연장이합체-형성 온도에서 시그널을 측정함으로써 타겟 올리고뉴클레오타이드의 존재에 의존적으로 발생되는 시그널을 검출할 수 있다.
상기 CTO를 이용하는 방법은 CTO에 혼성화된 타겟 올리고뉴클레오타이드가 연장되어 연장 가닥을 형성한 후, 상기 연장 가닥이 검출되는 프로세스로 분류될 수 있다. 상기 CTO를 이용하는 방법은 상기 연장 가닥의 형성을 상기 연장 가닥 및 상기 CTO 간의 이합체를 이용하여 검출하는 것을 특징으로 한다.
이하 실시예 1에서 설명한 바와 같이, CTO를 이용한 EXPAR 기술은 기존의 인터컬레이팅 염료를 이용한 형광 발생 방식에 비해 타겟 올리고뉴클레오타이드 검출에 대한 민감도 및 특이도를 동등 수준 이상으로 개선하였다.
이에, 본 발명자들은 EXPAR 기술의 검출 효율을 보다 향상시키고자, 상호작용적 이중 표지를 이용하여 시그널을 발생시키는 방식을 사용하되, 보다 신속하면서도 비특이적 증폭으로 인한 시그널과 명확하게 구별할 수 있는 방법을 예의 연구 노력하였다. 그 결과, 본 발명자들은 EXPAR 증폭과 시그널 검출을 동시에 구현할 수 있는 검출 올리고뉴클레오타이드를 개발하였다. 일 구현예에 따른 검출 올리고뉴클레오타이드는 도 4에 나타낸 바와 같다.
상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 이의 연장 가닥은 상기 상호작용적 이중표지로부터의 시그널의 변화를 초래하여 검출 가능한 시그널을 제공하고, 상기 시그널의 검출은 상기 타겟 올리고뉴클레오타이드의 존재를 나타낸다. 구체적으로, 타겟 올리고뉴클레오타이드의 지수함수적 증폭을 구현하는 검출 올리고뉴클레오타이드 자체에 상호작용적 이중 표지가 위치하기 때문에, 상기 단계 (b)의 등온 증폭 반응은 타겟 올리고뉴클레오타이드의 증폭과 동시에 이의 존재를 나타내는 시그널을 발생시킬 수 있다.
상기 검출 올리고뉴클레오타이드에 포함되는 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자의 위치에 따라, 시그널 발생 메커니즘이 일부 달라질 수 있으나, 상기 시그널 발생 메커니즘은 모두 검출 올리고뉴클레오타이드의 제1 주형 영역과 타겟 올리고뉴클레오타이드의 혼성화를 기반으로 한다.
일 구현예에서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 검출 올리고뉴클레오타이드의 제1 주형 영역에 위치하며, 타겟 올리고뉴클레오타이드와 검출 올리고뉴클레오타이드의 혼성화는 상호작용적 이중표지로부터의 시그널의 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다(도 4에서 3번째 및 4번째 구조 참조). 예를 들어, 단계 (a)의 타겟 올리고뉴클레오타이드와 검출 올리고뉴클레오타이드의 혼성화는 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 발생시키며, 단계 (b)의 등온 증폭 반응을 통해 지수함수적으로 생성되는 타겟 올리고뉴클레오타이드가 단계 (a)를 통해 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 발생시킬 수 있다.
일 구현예에서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 검출 올리고뉴클레오타이드의 제2 주형 영역에 위치하며, 타겟 올리고뉴클레오타이드의 연장 가닥 생성은 상호작용적 이중표지로부터의 시그널의 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다(도 4에서 1번째 구조 참조). 예를 들어, 단계 (a)의 타겟 올리고뉴클레오타이드와 검출 올리고뉴클레오타이드의 혼성화로 인해 유발되는 단계 (b)의 등온 증폭 반응은 타겟 올리고뉴클레오타이드의 증폭과 동시에 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 발생시키며, 이때 지수함수적으로 생성되는 타겟 올리고뉴클레오타이드는 단계 (a)를 통해 검출 올리고뉴클레오타이드에 혼성화되고 단계 (b)를 통해 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 발생시킬 수 있다.
일 구현예에서, 상기 검출 올리고뉴클레오타이드의 제1 주형 영역이 리포터 분자 및 퀀처 분자를 포함하는 상호작용적 이중 표지 중 하나를 갖고, 제2 주형 영역이 상호작용적 이중 표지 중 나머지 하나를 가지며, 타겟 올리고뉴클레오타이드와 검출 올리고뉴클레오타이드의 혼성화 및 이의 연장 가닥 생성은 상호작용적 이중표지로부터의 시그널의 변화를 유도하여 검출 가능한 시그널을 제공할 수 있다(도 4에서 2번째 구조 참조).
또한, 상기 검출 올리고뉴클레오타이드의 제1 주형 영역 및 제2 주형 영역 각각이 리포터 분자 및 퀀처 분자를 모두 포함할 수 있다. 이 경우, 타겟 올리고뉴클레오타이드와 검출 올리고뉴클레오타이드의 혼성화뿐만 아니라, 혼성화 후 증폭 반응에서도 타겟의 존재를 나타내는 시그널을 제공하는 바, 보다 강한 시그널 세기를 나타낼 수 있다.
상기 타겟 올리고뉴클레오타이드가 상기 검출 올리고뉴클레오타이드에 혼성화되거나 이의 연장 가닥이 생성되기 이전에는 상기 퀀처 분자는 상기 리포터 분자로부터의 시그널을 퀀칭한다. 상기 타겟 올리고뉴클레오타이드의 혼성화 또는 이의 연장 가닥의 생성은 상기 리포터 분자와 상기 퀀처 분자를 서로 분리시켜 상기 리포터 분자로부터 검출 가능한 시그널이 제공될 수 있다. 예를 들어, 상기 타겟 올리고뉴클레오타이드의 존재에 의존적으로 일어나는 검출 올리고뉴클레오타이드와 타겟 올리고뉴클레오타이드의 혼성화 및/또는 혼성화된 타겟 올리고뉴클레오타이드의 연장으로 인해 형성된 이합체의 형성에 의존적으로 시그널이 제공될 수 있다.
II. 타겟 올리고뉴클레오타이드를 검출하기 위한 키트
본 발명의 다른 양태에서, 다음을 포함하는 타겟 올리고뉴클레오타이드를 검출하기 위한 키트를 제공한다.
검출 올리고뉴클레오타이드; 상기 검출 올리고뉴클레오타이드는 3'to 5' 순서로 제1 주형 영역, 니킹 효소 인식 영역 및 제2 주형 영역을 포함하고, 상기 제1 주형 영역 및 제2 주형 영역은 서로 독립적으로, 타겟 올리고뉴클레오타이드와 실질적으로 상보적인 혼성화 뉴클레오타이드 서열을 가지며, 상기 검출 올리고뉴클레오타이드는 리포터 분자 및 퀀처 분자를 포함하는 상호작용적 이중표지를 포함하고;
(b) 가닥 치환 핵산 중합효소;
(c) 니킹 효소; 및
(d) dNTP.
본 발명의 일 구현예에 따른 키트는 양태 I의 타겟 올리고뉴클레오타이드를 검출하는 방법을 실시하기 위해 제조되므로, 이들 사이의 공통된 내용은 본 명세서의 복잡성을 초래하는 과도한 중복을 피하기 위해 생략한다. 예를 들어, 상기 키트에 적용되는 검출 올리고뉴클레오타이드, 가닥 치환 핵산 중합효소, 니킹 효소에 관한 내용은 타겟 올리고뉴클레오타이드를 검출하는 방법에서 전술한 바와 같다.
일 구현예에서, 상기 키트는 양태 I의 방법을 기재한 설명서를 포함할 수 있다. 상기 설명서는 적합한 기록 매체에 기록될 수 있다. 예를 들어, 설명서는 종이 및 플라스틱과 같은 기판에 인쇄될 수 있다. 다른 구현예에서, 설명서는 CD-ROM 및 디스켓과 같은 적합한 컴퓨터 해독가능한 기록매체 상에 존재하는 전자 저장 데이터 파일로 존재할 수 있다. 또 다른 구현예에서, 상기 키트 내에 실질적인 설명서는 포함되지 않으며, 다만 원격 소스로부터, 예컨대 인터넷을 통해, 설명서를 얻는 수단이 제공된다. 상기 구현예의 한 예는 설명서를 볼 수 있는 웹 주소 및/또는 설명서를 다운로드할 수 있는 웹 주소를 포함하는 키트이다.
실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 첨부된 청구항에 제시된 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예
실험에 사용된 서열 정보는 아래 표 1에 나타낸 바와 같다:
이름 서열(5’-> 3’) 서열번호
X'rX' CTCCTGTAGCCCGAC CGTAGACTCT CTCCTGTAGCCCGAC(C3) 1
CTO /5BHQ1/GTCCCGCAATAGCGTTACGG[T(Cal Fluor Orange 560)]GGCTCCTGTAGCCCGAC(C3) 2
RQ-X'rX' CTCCTGTAGCCCGACCGTAGACTC/iFAM_T/CTCCTGTAGCCCGAC/3BHQ1/ 3
타겟 올리고뉴클레오타이드 GTCGGGCTACAGGAG 4
* X'= 타겟 올리고뉴클레오타이드 결합 영역(제1 주형 영역 또는 제2 주형 영역; 볼드체로 표시됨)
r = 니킹 효소 인식 영역(밑줄로 표시됨)
RQ = 리포터 및 퀀처
(C3) = C3 Spacer
실시예 1: 인터컬레이팅 염료 및 CTO 이용한 타겟 검출 비교
<타겟 검출 시약의 제조>
종래 EXPAR 시스템의 인터컬레이팅 염료를 이용한 형광 시그널 검출 방식에 비해, CTO를 이용하는 검출 방식을 비교하기 위하여, 하기와 같이, 2 종류의 타겟 검출 시약을 제조하였다.
(i) 인터컬레이팅 염료를 포함하는 타겟 검출 시약
타겟 올리고뉴클레오타이드 검출을 위해 증폭용 올리고뉴클레오타이드로서 X'rX'(서열번호: 1) 1.25 pmole, 0.75 μL Nt.BstNBI(NEB, R0607L), 0.3 μL Bst 2.0 WarmStart DNA 중합효소(NEB, M0538L), 0.3 mM 데옥시뉴클레오타이드(dNTP) 용액 믹스(NEB, N0447L), 2 mM 황산마그네슘(MgSO4) 용액(NEB, B1003S), 인터컬레이팅 염료로서 Quant-iT PicoGreen dsDNA 시약(Invitrogen, P7581), 5X 완충액(40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO4, 10 mM (NH4)2SO4, 0.5 mM DTT)을 포함하여 최종 20 μL의 타겟 검출 시약 (i)을 제조하였다.
(ii) CTO를 포함하는 타겟 검출 시약
타겟 올리고뉴클레오타이드 검출을 위해 증폭용 올리고뉴클레오타이드로서 X'rX'(서열번호: 1) 1.25 pmole, CTO(Capturing and Templating Oligonucleotides, 서열번호: 2) 1.25 pmole, 0.75 μL Nt.BstNBI(NEB, R0607L), 0.3 μL Bst 2.0 WarmStart DNA 중합효소(NEB, M0538L), 0.3 mM 데옥시뉴클레오타이드 (dNTP) 용액 믹스 (NEB, N0447L), 2 mM 황산마그네슘(MgSO4) 용액(NEB, B1003S), 5X 완충액(40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO4, 10 mM (NH4)2SO4, 0.5 mM DTT)을 포함하여 최종 20 μL의 타겟 검출 시약 (ii)를 제조하였다.
CTO는, 3' to 5' 방향으로, (i) 타겟 올리고뉴클레오타이드에 상보적인 뉴클레오타이드 서열을 포함하는 캡처링 부위 및 (ii) 타겟 올리고뉴클레오타이드에 비상보적인 뉴클레오타이드 서열을 포함하는 템플레이팅 부위를 포함한다. CTO는 5'-말단에 퀀처 분자(BHQ-1) 및 템플레이팅 부위에 형광 리포터 분자(Cal Fluor Orange 560)로 표지되었다.
주형 및 CTO는 연장을 방지하기 위해 3'-말단에 카본 스페이서로 블록킹되어 있다.
타겟 올리고뉴클레오타이드가 존재하는 경우, 상기 타겟 올리고뉴클레오타이드가 CTO의 캡처링 부위에 어닐링되고, CTO의 템플레이팅 부위 상에서 연장되어 CTO와 연장이합체(이합체 CTO)를 형성한다. 상기 연장이합체의 형성은 시그널을 제공하며, 연장이합체-형성 온도에서 시그널을 측정함으로써 증폭 곡선을 얻을 수 있다. 본 실시예에서, 타겟 올리고뉴클레오타이드에 대한 상기 연장이합체의 서열 및 길이는 55℃에서 상기 이합체를 형성하여 시그널을 제공하도록 디자인하였다.
<민감도 분석>
상기 제조된 20 μL의 타겟 검출 시약 (i) 및 (ii) 각각을 네가지 농도(농도 1: 2×109 copies/μL, 농도 2: 2×107 copies/μL, 농도 3: 2×105 copies/μL, 농도 4: 2×103 copies/μL)의 타겟 올리고뉴클레오타이드 5 μL(서열번호: 4)와 혼합하여 최종 부피 25 μL로 반응 혼합물을 제조하였다.
상기 반응 혼합물을 함유하고 있는 튜브를 실시간 열순환기(CFX96, Bio-Rad)에 위치시켜 55℃에서 반응시켰으며, 시그널의 검출은 매 17초마다 측정하였다. Ct 값은 Auto calculated single threshold에 의해 계산되었으며, 모든 실험은 2회씩 반복 실험하였다. 상기 타겟 올리고뉴클레오타이드(서열번호: 4) 대신 증류수 5 μL를 넣은 반응 혼합물을 이용하여 상기와 동일한 조건으로 음성 대조군 반응도 함께 실시하였다. 시그널 검출 결과를 도 5 및 표 2에 나타내었다.
타겟 올리고뉴클레오타이드의 농도 농도 1 농도 2 농도 3 음성대조군
평균 Ct 타겟 검출 시약 (i) 3.25 13.08 21.14 24.27
타겟 검출 시약 (ii) 6.24 13.79 20.48 22.07
분석 결과, 종래 EXPAR 시스템의 인터컬레이팅 염료를 이용한 형광 시그널 검출 방식(타겟 검출 시약 (i))에 비해, CTO를 이용하는 검출 방식(타겟 검출 시약 (ii))이 동등 수준 이상으로 타겟 올리고뉴클레오타이드를 검출하는 것을 확인하였다.
<특이도 분석>
본 실시예에서는 비타겟 핵산과의 반응에서 비특이 시그널이 검출되는지를 비교하였다. 비타겟 핵산으로, Human Genomic DNA(Promega, G1521)을 사용하였다.
상기 제조된 20 μL의 타겟 검출 시약 (i) 및 (ii) 각각을 80 ng/μL의 Human Genomic DNA (hgDNA) 5 μL를 혼합하여 최종 부피 25 μL로 반응 혼합물을 제조하였다.
상기 반응 혼합물을 함유하고 있는 튜브를 실시간 열순환기(CFX96, Bio-Rad)에 위치시켜 55℃에서 반응시켰으며, 시그널의 검출은 매 17초마다 측정하였다. Ct 값은 Auto calculated single threshold에 의해 계산되었으며, 모든 실험은 2회씩 반복 실험하였다. 상기 hgDNA 대신 증류수 5 μL를 넣은 반응 혼합물을 이용하여 상기와 동일한 조건으로 음성 대조군 반응도 함께 실시하였다. 시그널 검출 결과를 도 6 및 표 3에 나타내었다.
비타겟 핵산 hgDNA 음성대조군
평균 Ct 타겟 검출 시약 (i) 14.41 26.03
타겟 검출 시약 (ii) 21.20 21.14
종래의 인터컬레이팅 염료를 이용한 방식(타겟 검출 시약 (i))은 검출 대상이 아닌 hgDNA에 대한 시그널의 평균 Ct 값이 음성 대조군에서의 비특이적 반응에 의한 시그널의 평균 Ct 값과 분명한 차이를 나타내는 바, 특이도가 다소 떨어지는 것을 알 수 있다. 이에 반해, CTO를 이용한 방식(타겟 검출 시약 (ii))은 hgDNA에 대한 시그널과 음성 대조군의 시그널의 평균 Ct 값이 거의 동일한 바, 타겟 올리고뉴클레오타이드에 대한 특이도가 인터컬레이팅 염료 방식에 비해 우수한 것을 알 수 있다.
실시예 2: CTO 및 검출 올리고뉴클레오타이드를 이용한 타겟 검출 비교
본 실시예에서는 CTO를 이용하는 검출 방식과 본 발명에 따른 검출 올리고뉴클레오타이드를 이용한 검출 방식을 비교하기 위하여, 하기와 같이, 2 종류의 타겟 검출 시약을 제조하였다.
대조군으로서, 5X 완충액(40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO4, 10 mM (NH4)2SO4, 1.2 mM EGTA)을 사용한 것을 제외하고는 실시예 1에서의 타겟 검출 시약 (ii)와 동일한 조성으로, 최종 20 μL의 타겟 검출 시약 (iii)을 제조하였다.
또한, 타겟 올리고뉴클레오타이드 검출을 위해 증폭 및 검출을 단일 반응에서 구현할 수 있는 검출 올리고뉴클레오타이드의 일 예시로서 RQ-X'rX'(서열번호: 3) 1.25 pmole, 0.75 μL Nt.BstNBI(NEB, R0607L), 0.3 μL Bst 2.0 WarmStart DNA 중합효소(NEB, M0538L), 0.3 mM 데옥시뉴클레오타이드(dNTP) 용액 믹스(NEB, N0447L), 2 mM 황산마그네슘(MgSO4) 용액(NEB, B1003S), 5X 완충액(40 mM Tris-HCl (pH 8.8), 150 mM KCl, 4 mM MgSO4, 10 mM (NH4)2SO4, 1.2 mM EGTA)을 포함하여 최종 20 μL의 타겟 검출 시약 (iv)를 제조하였다.
20 μL의 타겟 검출 시약 (iii) 및 (iv)에 세가지 농도(농도 1: 2×1010 copies/μL, 농도 2: 2×108 copies/μL, 농도 3: 2×106 copies/μL)의 타겟 올리고뉴클레오타이드 5 μL (서열번호: 4)을 혼합하여 최종 부피 25 μL로 반응 혼합물을 제조하였다.
상기 반응 혼합물을 함유하고 있는 튜브를 실시간 열순환기(CFX96, Bio-Rad)에 위치시켜 55℃에서 반응시켰으며, 시그널의 검출은 매 17초마다 측정하였다. Ct 값은 Auto calculated single threshold에 의해 계산되었으며, 모든 실험은 2회씩 반복 실험하였다. 상기 타겟 올리고뉴클레오타이드(서열번호: 4) 대신 증류수 5 μL를 넣은 반응 혼합물을 이용하여 상기와 동일한 조건으로 음성 대조군 반응도 함께 실시하였다. 시그널 검출 결과를 도 7, 표 4 및 표 5에 나타내었다.
타겟 올리고뉴클레오타이드의 농도 농도 1 농도 2 농도 3 음성대조군
평균 Ct 타겟 검출 시약 (iii) 9.91 17.80 24.07 25.58
타겟 검출 시약 (iv) 3.51 8.53 11.66 12.90
타겟 올리고뉴클레오타이드의 농도 농도 1 농도 2 농도 3
*Ct % 타겟 검출 시약 (iii) 61.27 30.42 5.90
타겟 검출 시약 (iv) 72.78 33.85 9.58
* Ct % = [(Ct 음성 대조군 - Ct 타겟 올리고뉴클레오타이드)/Ct 음성 대조군]×100
본 발명의 일 구현예에 따른 검출 올리고뉴클레오타이드를 이용한 검출 방법은 CTO 이용 방식에 비해 TAT(turn around time)가 월등히 짧으며, 모든 농도에 민감도가 우수한 것을 확인할 수 있다. 아울러, 본 발명의 일 구현예에 따른 방법은 실험한 모든 농도에서 Ct%가 높아 비특이적 반응과 확연히 구별되는 바, 신속하면서도 정확한 등온 증폭법을 구현하는 것을 알 수 있다.
특히, 상기 CTO 이용 방식이 종래의 인터컬레이팅 염료 방식에 비해 검출 특이도 및 민감도가 모두 우수하게 구현되는 것을 실시예 1에서 확인한 바 있다. 따라서, 본 발명의 검출 올리고뉴클레오타이드는 단일의 등온 증폭 반응에서 증폭 및 시그널 검출을 동시에 구현하여, 종래 기술에 비하여 보다 정확하고 신속한 방식으로 타겟 핵산 서열을 검출하는 것을 추론할 수 있다.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서, 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.

Claims (15)

  1. 다음의 단계를 포함하는 타겟 올리고뉴클레오타이드를 검출하는 방법:
    (a) 상기 타겟 올리고뉴클레오타이드를 검출 올리고뉴클레오타이드와 혼성화하는 단계로서;
    상기 검출 올리고뉴클레오타이드는 3'에서 5' 방향으로 제1 주형 영역, 니킹(nicking) 효소 인식 영역 및 제2 주형 영역을 포함하고,
    상기 제1 주형 영역 및 제2 주형 영역은 서로 독립적으로, 상기 타겟 올리고뉴클레오타이드와 실질적으로 상보적인 혼성화 뉴클레오타이드 서열을 가지며,
    상기 검출 올리고뉴클레오타이드는 리포터 분자 및 상기 리포터 분자로부터의 시그널을 퀀칭할 수 있는 퀀처 분자를 포함하는 상호작용적 이중 표지로 표지되어 있고,
    상기 타겟 올리고뉴클레오타이드는 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 혼성화되며;
    (b) 등온 조건 하에서, 상기 단계 (a)의 결과물을 니킹 효소 및 가닥 치환(strand displacement) 핵산 중합효소와 인큐베이팅하는 단계로서;
    상기 제1 주형 영역에 혼성화된 타겟 올리고뉴클레오타이드는 상기 가닥 치환 핵산 중합효소에 의해 연장되어 상기 검출 올리고뉴클레오타이드에 상보적인 연장 가닥을 생성하고, 상기 연장 가닥은 상기 니킹 효소에 의해 상기 니킹 효소 인식 영역에서 절단되며, 상기 절단된 가닥은 상기 가닥 치환 핵산 중합효소에 의해 그의 3'-말단으로부터 연장되어 상기 타겟 올리고뉴클레오타이드를 방출하며; 및
    (c) 상기 타겟 올리고뉴클레오타이드의 존재를 나타내는 시그널을 검출하는 단계로서;
    상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 초래하여 상기 타겟 올리고뉴클레오타이드의 존재를 나타내는 검출 가능한 시그널을 제공한다.
  2. 제1항에 있어서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화는 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공하는 것을 특징으로 하는 방법.
  3. 제1항에 있어서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 상기 검출 올리고뉴클레오타이드의 제2 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드의 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공하는 것을 특징으로 하는 방법.
  4. 제1항에 있어서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자 중 하나는 제1 주형 영역에 위치하고 다른 하나는 제2 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공하는 것을 특징으로 하는 방법.
  5. 제1항에 있어서, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성 전에는 상기 퀀처 분자는 상기 리포터 분자로부터의 시그널을 퀀칭하는 반면, 상기 타겟 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 리포터 분자와 상기 퀀처 분자를 서로 분리시켜 상기 리포터 분자로부터 검출 가능한 시그널이 제공되는 것을 특징으로 하는 방법.
  6. 제1항에 있어서, 상기 타겟 올리고뉴클레오타이드는 관심 병원체의 존재하에 유래된 또는 생성된 핵산 서열 또는 이의 상보적인 핵산 서열을 포함하는 것을 특징으로 하는 방법.
  7. 제1항에 있어서, 상기 가닥 치환 핵산 중합효소는 Bst 큰 단편 중합효소, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), Φ29 파아지, MS-2 파아지, Z-Taq, KOD, 클레나우 단편, GspSSD, GspF, OmniAmp 중합효소, SD 중합효소 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는 방법.
  8. 제1항에 있어서, 상기 니킹 효소는 Nb.BbvCⅠ, Nt.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsⅠ, Nt.BsmAI, Nt.BspQI, Nb.BsrDI, Nt.BstNBⅠ, Nb.BssSI, Nt.Alw 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는, 방법.
  9. 다음을 포함하는 타겟 올리고뉴클레오타이드를 검출하기 위한 키트:
    (a) 검출 올리고뉴클레오타이드;
    상기 검출 올리고뉴클레오타이드는 3'에서 5' 방향으로 제1 주형 영역, 니킹(nicking) 효소 인식 영역 및 제2 주형 영역을 포함하고,
    상기 제1 주형 영역 및 제2 주형 영역은 서로 독립적으로, 상기 타겟 올리고뉴클레오타이드와 실질적으로 상보적인 혼성화 뉴클레오타이드 서열을 가지며,
    상기 검출 올리고뉴클레오타이드는 리포터 분자 및 상기 리포터 분자로부터의 시그널을 퀀칭할 수 있는 퀀처 분자를 포함하는 상호작용적 이중 표지로 표지되어 있고;
    (b) 가닥 치환 핵산 중합효소;
    (c) 니킹 효소; 및
    (d) dNTPs.
  10. 제9항에 있어서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 상기 검출 올리고뉴클레오타이드의 제1 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화는 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공하는 것을 특징으로 하는 키트.
  11. 제9항에 있어서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자는 상기 검출 올리고뉴클레오타이드의 제2 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드의 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공하는 것을 특징으로 하는 키트.
  12. 제9항에 있어서, 상기 상호작용적 이중 표지의 리포터 분자 및 퀀처 분자 중 하나는 제1 주형 영역에 위치하고 다른 하나는 제2 주형 영역에 위치하며, 상기 타겟 올리고뉴클레오타이드와 상기 검출 올리고뉴클레오타이드의 혼성화 또는 상기 연장 가닥의 생성은 상기 상호작용적 이중표지로부터의 시그널 변화를 유도하여 검출 가능한 시그널을 제공하는 것을 특징으로 하는 키트.
  13. 제9항에 있어서, 상기 타겟 올리고뉴클레오타이드는 관심 병원체의 존재하에 유래된 또는 생성된 핵산 서열 또는 이의 상보적인 핵산 서열을 포함하는 것을 특징으로 하는 키트.
  14. 제9항에 있어서, 상기 가닥 치환 핵산 중합효소는 Bst large fragment 중합효소, Bst 2.0, Bst 3.0, Bca (exo-), Vent, Vent (exo-), Deep Vent, Deep Vent (exo-), Φ29 파아지, MS-2 파아지, Z-Taq, KOD, 클레나우 단편, GspSSD, GspF, OmniAmp 중합효소, SD 중합효소 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는, 키트.
  15. 제9항에 있어서, 상기 니킹 효소는 Nb.BbvCⅠ, Nt.BbvCI, Nb.BsmI, Nb.BsrDI, Nb.BtsⅠ, Nt.BsmAI, Nt.BspQI, Nb.BsrDI, Nt.BstNBⅠ, Nb.BssSI, Nt.Alw 및 이의 조합으로 이루어진 군에서 선택되는 어느 하나인 것을 특징으로 하는, 키트.
PCT/KR2024/001759 2023-02-07 2024-02-06 검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법 Ceased WO2024167289A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020257021307A KR20250120312A (ko) 2023-02-07 2024-02-06 검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20230016010 2023-02-07
KR10-2023-0016010 2023-02-07

Publications (1)

Publication Number Publication Date
WO2024167289A1 true WO2024167289A1 (ko) 2024-08-15

Family

ID=92263086

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2024/001759 Ceased WO2024167289A1 (ko) 2023-02-07 2024-02-06 검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법

Country Status (2)

Country Link
KR (1) KR20250120312A (ko)
WO (1) WO2024167289A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130006477A (ko) * 2011-01-11 2013-01-16 주식회사 씨젠 Pto 절단 및 연장 어세이에 의한 타겟 핵산서열의 검출
CN106929563A (zh) * 2017-02-24 2017-07-07 山东师范大学 基于切除修复由酶介导的两步串联信号放大检测udg活性的方法
WO2018195044A1 (en) * 2017-04-17 2018-10-25 Montana State University Switch-like isothermal dna amplification demonstrating a non-linear amplification rate
US20180346974A1 (en) * 2015-11-18 2018-12-06 Fondazione Istituto Italiano Di Tecnologia Methods and kits for nucleic acid detection
WO2022117816A1 (en) * 2020-12-03 2022-06-09 The University Of Birmingham Target rna detection

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130006477A (ko) * 2011-01-11 2013-01-16 주식회사 씨젠 Pto 절단 및 연장 어세이에 의한 타겟 핵산서열의 검출
US20180346974A1 (en) * 2015-11-18 2018-12-06 Fondazione Istituto Italiano Di Tecnologia Methods and kits for nucleic acid detection
CN106929563A (zh) * 2017-02-24 2017-07-07 山东师范大学 基于切除修复由酶介导的两步串联信号放大检测udg活性的方法
WO2018195044A1 (en) * 2017-04-17 2018-10-25 Montana State University Switch-like isothermal dna amplification demonstrating a non-linear amplification rate
WO2022117816A1 (en) * 2020-12-03 2022-06-09 The University Of Birmingham Target rna detection

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
ELLIE MOK, EUGENE WEE, YULING WANG, MATT TRAU: "Comprehensive evaluation of molecular enhancers of the isothermal exponential amplification reaction", SCIENTIFIC REPORTS, vol. 6, no. 1, 1 December 2016 (2016-12-01), XP055364193, DOI: 10.1038/srep37837 *

Also Published As

Publication number Publication date
KR20250120312A (ko) 2025-08-08

Similar Documents

Publication Publication Date Title
Monis et al. Nucleic acid amplification-based techniques for pathogen detection and identification
WO2017122896A1 (ko) 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법
CN111100935B (zh) 一种细菌耐药基因检测的方法
WO2015126078A1 (ko) 핵산과 신호 프로브의 비대칭 등온증폭을 이용한 핵산의 검출방법
CA2810856C (en) Compositions and methods for quantifying a nucleic acid sequence in a sample
KR20130006477A (ko) Pto 절단 및 연장 어세이에 의한 타겟 핵산서열의 검출
CN108368557B (zh) 基于等温的双功能性寡聚核苷酸及利用其的核酸扩增和测定方法
KR20120042100A (ko) 이중표지 고정화 프로브를 이용한 고상에서의 타겟 핵산서열 검출
CN117701557A (zh) 基于熔解曲线分析的核酸多重检测方法、探针组及试剂盒
WO2017122897A1 (ko) 참돔 이리도바이러스병 원인바이러스의 검출용 유전자 마커, 및 이를 이용한 원인바이러스의 검출 방법
WO2021210779A1 (ko) 자가 프라이머 구조를 가진 헤어핀 프로브를 활용한 등온 증폭기술을 이용한 표적핵산 검출방법
KR101901749B1 (ko) 실시간 핵산 또는 단백질 검출용 단일핵산 및 이를 이용한 검출 방법
US8222389B2 (en) Method for lowering both sequence variations and increase of base line effects in a diagnostic hybridisation assay, assay for performing such a method and probe for use in the assay
CN109988865B (zh) 一种检测呼吸道病毒的方法
WO2022010238A1 (ko) 특정 인공 뉴클레오타이드 서열을 이용한 위양성 판단용 조성물 및 이를 이용한 위양성 판단 방법
WO2020145711A1 (ko) Egfr 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2024167289A1 (ko) 검출 올리고뉴클레오타이드를 이용하여 타겟 올리고뉴클레오타이드를 검출하는 방법
WO2023106866A1 (ko) 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법
CN114645081A (zh) 一种检测基因元件的方法和试剂盒
CN113046421B (zh) 一种不对称扩增靶核酸的方法
WO2018062859A1 (ko) 소형 rna 또는 소형 rna와 연관된 단백질을 탐지하는 방법
WO2021172653A1 (ko) 단일 표적 유전자의 유전적 변이 실시간 검출용 단일핵산 및 이를 이용한 검출 방법
WO2018016683A1 (ko) 다중 증폭 이중 시그널 증폭에 의한 타겟 핵산 서열의 검출 방법
WO2022149969A1 (ko) 루프구조매개 등온증폭 산물의 전사를 위한 변형 프라이머 구조 및 이의 용도
WO2018139955A1 (ru) Способ специфической идентификации последовательностей днк

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 24753614

Country of ref document: EP

Kind code of ref document: A1

WWP Wipo information: published in national office

Ref document number: 1020257021307

Country of ref document: KR

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 24753614

Country of ref document: EP

Kind code of ref document: A1