WO2023106866A1 - 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법 - Google Patents

단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법 Download PDF

Info

Publication number
WO2023106866A1
WO2023106866A1 PCT/KR2022/019959 KR2022019959W WO2023106866A1 WO 2023106866 A1 WO2023106866 A1 WO 2023106866A1 KR 2022019959 W KR2022019959 W KR 2022019959W WO 2023106866 A1 WO2023106866 A1 WO 2023106866A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleotides
nucleic acid
tagged
target nucleic
loop
Prior art date
Application number
PCT/KR2022/019959
Other languages
English (en)
French (fr)
Inventor
고오성
박현신
한성현
박지훈
이효빈
Original Assignee
주식회사 씨젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 씨젠 filed Critical 주식회사 씨젠
Publication of WO2023106866A1 publication Critical patent/WO2023106866A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage

Definitions

  • the present disclosure relates to a tagged loop primer comprising a single-stranded interactive double labeling system and a method for isothermal amplification of nucleic acids using the same.
  • Nucleic acid amplification technology is a technique mainly used in the fields of molecular biology and biotechnology, and is a method capable of detecting and analyzing a small amount of target nucleic acid present in a sample.
  • PCR Polymerase chain reaction
  • PCR Polymerase chain reaction
  • a real-time PCR method using a fluorescent substance is a method of detecting an increase in fluorescence intensity due to nucleic acid amplification during a PCR process.
  • the real-time PCR method has the advantage of enabling multiplex detection by using different fluorescent dyes for each target, but has the disadvantage of requiring expensive equipment and requiring a lot of time for detection.
  • an isothermal amplification method has been developed that does not require expensive real-time PCR equipment and can detect target nucleic acids in a faster time than PCR.
  • An example of isothermal amplification is rolling circle amplification (RCA, M. M. Ali, F. Li, Z. Zhang, K. Zhang, D.-K. Kang, J. A. Ankrum, X. C. Le and W. Zhao, Chem. Soc. Rev. , 2014, 43, 3324-3341.), loop-mediated isothermal amplification (LAMP, Y. Mori, H. Kanda and T. Notomi, J. Infect.
  • RPA recombinase polymerase amplification
  • NASBA nucleic acid sequence based amplification
  • SDA strand displacement amplification
  • HAD helicase dependent amplification
  • TMA transcription-mediated amplification
  • LAMP LAMP was reported in 2000 by Notomi et al (T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino and T. Hase, Nucleic Acids Res., 2000, 28, E63).
  • Notomi et al T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino and T. Hase, Nucleic Acids Res., 2000, 28, E63.
  • Nagamine et al K. Nagamine, T. Hase and T. Notomi, Mol. Cell. Probes, 2002, 16, 223-229
  • the standard detection method for LAMP is turbidity measurement by precipitation of magnesium pyrophosphate (Y. Mori, K. Nagamine, N. Tomita and T. Notomi, Biochem. Biophys. Res. Commun., 2001, 289, 150-154).
  • other methods include gel electrophoresis, metal indicator for calcium, colorimetric LAMP, coffee-ring effect on colloidal-crystal matrix, paper-based rapid detection of LAMP magnetic bead agglomerates, analysis of melting and annealing curves, intercalation such as SYBR green collating fluorescent dyes, bioluminescence or electrochemiluminescence via pyrophosphate conversion; Recently, a method for detecting fluorescence specific to a target nucleic acid amplification sequence using an assimilating probe (WO2011-163425) has been developed.
  • isothermal amplification methods such as the LAMP method can amplify genes at one temperature in a short time (usually within 1 hour) and do not require expensive equipment compared to real-time PCR, so they have been applied to rapid on-site diagnosis.
  • the present inventors have tried to develop a single-stranded loop primer that can be used in a loop-mediated isothermal amplification (LAMP) reaction method and is applied with a new signaling method that has not been applied to the existing LAMP method.
  • the present inventors include a 3'-targeting portion that forms a complementary bond to the target nucleic acid and a 5'-tagging portion that does not form a complementary bond to the target nucleic acid, and the 5'-tagging portion includes a reporter molecule and
  • the present invention was completed by discovering that, when a loop-mediated isothermal amplification reaction is performed using a tagged loop primer in which quencher molecules are linked at a predetermined interval, one or more target nucleic acids can be effectively detected.
  • an object of the present invention is to provide a tagged loop primer for a loop-mediated isothermal amplification reaction.
  • Another object of the present invention is to provide a method for detecting a target nucleic acid using the tagged loop primer.
  • Another object of the present invention is to provide a composition for a loop-mediated isothermal amplification reaction comprising the tagged loop primer.
  • a tagged loop primer for detecting a target nucleic acid having (i) F3c, F2c, F1c, B1, B2 and B3 or (ii) B3c, B2c, B1c, F1, F2 and F3 in the 3' to 5' direction including A tagged loop primer for detecting a target nucleic acid is provided:
  • a 3′-targeting region comprising a nucleotide sequence complementary to all or part of the sequence between B1 and B2 or between F1 and F2 of the target nucleic acid;
  • a 5'-tagging region comprising a nucleotide sequence that is non-complementary to the target nucleic acid
  • the 5'-tagging site includes a reporter molecule and a quencher molecule
  • the reporter molecule and the quencher molecule of the 5'-tagged region are located close to each other so that the quencher molecule quenches a signal from the reporter molecule
  • the reporter molecule and the quencher molecule of the 5'-tagging region are separated from each other so that the quencher molecule quenches the signal from the reporter molecule.
  • the 5'-tagging region is spatially folded.
  • the 5'-tagging region when the target nucleic acid is present, the 5'-tagging region is spatially unfolded.
  • the 5'-tagging region forms a hairpin structure.
  • the hairpin structure of the 5'-tagged region is disrupted.
  • the tagged primer is 20 to 150 nucleotides in length.
  • the 3'-targeting site in the LAMP reaction, has a nucleotide length sufficient to hybridize to the target nucleic acid.
  • the 3'-targeting portion is 10 to 100 nucleotides in length.
  • the 3'-targeting region has a Tm value of 40 °C to 70 °C.
  • the 5'-tagging portion has a length of nucleotides such that the reporter molecule and the quencher molecule can be separated from each other so that the quencher molecule unquenches a signal from the reporter molecule.
  • the 5'-tagging portion is at least 10 nucleotides in length.
  • the reporter molecule and the quencher molecule are spaced at least 10 nucleotides apart from each other.
  • one of the reporter molecule and the quencher molecule is linked to the 5'-end of the 5'-tagging site, and the other is internal deoxythymidine (internal deoxythymidine) to the 5'-tagging site. It is linked to internal deoxythymidine (dT).
  • a method for detecting at least one target nucleic acid comprising performing a loop mediated isothermal amplification (LAMP) reaction using at least one tagged loop primer according to the present disclosure.
  • LAMP loop mediated isothermal amplification
  • the LAMP reaction is performed at a temperature between 50 °C and 75 °C.
  • the target nucleic acid is derived from a virus.
  • the virus is an RNA virus.
  • the LAMP reaction additionally uses a conventional untagged loop primer.
  • composition for a loop-mediated isothermal amplification reaction comprising the tagged loop primer according to the present disclosure is provided.
  • the tagged loop primer of the present disclosure includes both a reporter molecule and a quencher molecule in a single strand, and is characterized in that it can simultaneously serve as a probe as well as a primer.
  • the tagged loop primer according to the present disclosure does not require a process of synthesizing a pair of probes, such as a conventional method using two probes, for example, an anabolic probe method, and the two probes hybridize at an isothermal amplification reaction temperature. There is no hassle of designing to maintain the same state, and there is an advantage in that the possibility of noise generation due to non-specific breakdown of some complementary bonds between the two probes can be blocked.
  • the tagged loop primer according to the present disclosure has the advantage of being easy to manufacture and effectively simultaneously detecting a plurality of target nucleic acids as well as a single target nucleic acid by using the tagged loop primer.
  • LAMP Loop-mediated isothermal amplification
  • FIG. 2 schematically shows the structure of a tagged loop primer according to the present disclosure.
  • Figure 2 (a) is complementary to (i) a 5'-tagging site including a reporter molecule and a quencher molecule and (ii) all or part of the sequence between B1 and B2 or between F1 and F2 of the target nucleic acid in the tagged loop primer.
  • a 3'-targeting site containing a specific nucleotide sequence is shown.
  • Figure 2 (b) shows that the 5'-tagging site of the tagged loop primer generates a quenching effect by forming a spatially folded structure such as a random coil, bringing the reporter molecule and the quencher molecule into close proximity.
  • Figure 2(c) shows that the quenching effect occurs as the 5'-tagging site of the tagged loop primer forms a hairpin structure, bringing the reporter molecule and the quencher molecule into close proximity.
  • LAMP loop-mediated isothermal amplification
  • Figure 3 shows the 3'-targeting region of the tagged loop primer using a forward tagged loop primer (tagged LF) containing a nucleotide sequence complementary to all or part of the sequence between F1 and F2 of the target nucleic acid. This is an example of the LAMP method.
  • tagged LF forward tagged loop primer
  • Figure 3 (b) shows the 3'-targeting site of the tagged loop primer using a reverse tagged loop primer (tagged LB) containing a nucleotide sequence complementary to all or part of the sequence between B1 and B2 of the target nucleic acid. This is an example of the LAMP method.
  • the 5'-tagging site of the tagged loop primer exists as a single strand, it exists in the form of a random coil (or hairpin structure), so that the reporter molecule and the quencher molecule Positioned in close proximity, the quencher molecule quenches the signal from the reporter molecule (see (i) or (ii) in Figures 3 (a) and (b)), but the 5'-tagging site undergoes a double-stranded conformation through the LAMP reaction.
  • the reporter molecule and the quencher molecule are separated from each other so that the quencher molecule quenches the signal from the reporter molecule (see (iii) in FIGS. 3(a) and (b)).
  • Figure 4 shows the Mono RT-LAMP results of the RdRp gene target nucleic acid of Example 3.
  • Figure 5 shows the Mono RT-LAMP results of the N gene target nucleic acid of Example 3.
  • Figure 6 shows the results of Mono RT-LAMP of the RNase P gene target nucleic acid of Example 3.
  • Example 7 shows the results of Multi RT-LAMP of RdRP gene, N gene, and RNase P gene target nucleic acids in Example 3.
  • the present inventors have tried to develop a single-stranded loop primer that can be used in a loop-mediated isothermal amplification (LAMP) reaction method and is applied with a new signaling method that has not been applied to the existing LAMP method.
  • the present inventors include a 3'-targeting portion that forms a complementary bond to the target nucleic acid and a 5'-tagging portion that does not form a complementary bond to the target nucleic acid, and the 5'-tagging portion includes a reporter molecule and It has been found that when a loop-mediated isothermal amplification reaction is performed using a tagged loop primer in which quencher molecules are linked at a predetermined interval, one or more target nucleic acids can be effectively detected.
  • a 3' to 5' direction including (i) F3c, F2c, F1c, B1, B2 and B3 or (ii) B3c, B2c, B1c, F1, F2 and a tagged loop primer for detecting a target nucleic acid having F3:
  • a 3′-targeting region comprising a nucleotide sequence complementary to all or part of the sequence between B1 and B2 or between F1 and F2 of the target nucleic acid;
  • a 5'-tagging region comprising a nucleotide sequence that is non-complementary to the target nucleic acid
  • the 5'-tagging site includes a reporter molecule and a quencher molecule
  • the reporter molecule and the quencher molecule of the 5'-tagged region are located close to each other so that the quencher molecule quenches a signal from the reporter molecule
  • the reporter molecule and the quencher molecule of the 5'-tagging region are separated from each other so that the quencher molecule quenches the signal from the reporter molecule.
  • LAMP loop-mediated isothermal amplification
  • loop-mediated isothermal amplification is used as a meaning including loop-mediated isothermal amplification (RT-LAMP).
  • Loop-mediated isothermal amplification is a nucleic acid amplification method capable of amplifying a target nucleic acid with high sensitivity and specificity under isothermal conditions (Notomi, T. et al. 2000. Loop-Mediated Isothermal Amplification of DNA. Nucleic Acids Res 28, E63).
  • the LAMP method uses a DNA polymerase having strand displacement activity and a set of at least 4 to 6 primers specifically designed at various sites of a target nucleic acid (see FIG. 1).
  • the tagged loop primer of the present disclosure is a primer used for a loop-mediated isothermal amplification reaction for detecting a target nucleic acid from a biological sample or a non-biological sample isolated from a subject, through a loop-mediated isothermal amplification reaction using the same, The presence or absence of a target nucleic acid in a sample can be quickly determined.
  • the tagged loopprimer of the present disclosure is characterized by including both a reporter molecule and a quencher molecule in a single strand, and is also described as a "single-stranded double-labeled loopprimer".
  • the tagged loop primer according to the present disclosure is (i) a 5'-tagging region including a reporter molecule and a quencher molecule and (ii) between B1 and B2 or F1 of the target nucleic acid. and a 3'-targeting region comprising a nucleotide sequence complementary to all or part of the sequence between F2.
  • the term “between” when used in reference to two numbers or positions is to be construed as not including the two numbers or positions, whereas the term “between” includes the two numbers or positions.
  • the term "subject” refers to an individual suspected of containing a target nucleic acid (eg, a specific pathogen) to be detected using the method of the present disclosure.
  • a target nucleic acid eg, a specific pathogen
  • examples of the subject include, but are not limited to, mammals such as dogs, cats, rodents, primates, and humans, and in particular, humans.
  • sample may refer to any analyte that contains or is suspected to contain a nucleic acid to be detected.
  • the samples include biological samples (eg, cells, tissues, and body fluids) and non-biological samples (eg, food, water, and soil), and the biological samples include, for example, viruses, bacteria, tissues, cells, blood (whole blood). , plasma and serum), lymph, bone marrow, saliva, sputum, swab, aspiration, milk, urine, feces, eye fluid, semen, brain extract, spinal fluid, joint fluid, thymus fluid, bronchial lavage fluid, ascites fluid, or amniotic fluid, but is not limited thereto.
  • biological samples eg, cells, tissues, and body fluids
  • non-biological samples eg, food, water, and soil
  • the biological samples include, for example, viruses, bacteria, tissues, cells, blood (whole blood). , plasma and serum), lymph, bone marrow, saliva, sputum, sw
  • the sample may be used interchangeably with 'specimen' herein.
  • the sample can be obtained from a subject, particularly a mammal, more particularly a human, for example, a swab, saliva, sputum, aspiration, bronchus It may be bronchoalveolar lavage (BAL), gargle, or blood, but is not limited thereto.
  • a subject particularly a mammal, more particularly a human, for example, a swab, saliva, sputum, aspiration, bronchus It may be bronchoalveolar lavage (BAL), gargle, or blood, but is not limited thereto.
  • a subject particularly a mammal, more particularly a human, for example, a swab, saliva, sputum, aspiration, bronchus It may be bronchoalveolar lavage (BAL), gargle, or blood, but is not limited thereto.
  • BAL bronchoalveolar lavage
  • the sample derived from the subject is a swab, saliva, or a mixture thereof.
  • the smear is a nasopharyngeal swab, a nostril swab, an oropharyngeal swab, an oral swab, a saliva swab ), genital swab, rectal swab, or a combination of two or more of these.
  • the sample may undergo a nucleic acid extraction process known in the art for an efficient amplification reaction (ie, LAMP reaction) (see: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)).
  • LAMP reaction an efficient amplification reaction
  • the nucleic acid extraction process may vary depending on the type of sample.
  • a nucleic acid purification process may be added as needed.
  • the sample can be directly analyzed without extracting nucleic acids from the sample.
  • Pannacio et al. Nucleic Acids Res. 1993 September 25; 21(19): 4656
  • Pandori et al. BMC Infect Dis. 2006 Jun 24;6: 104
  • WO 2021-261864 may be used.
  • primer used herein refers to a single-stranded oligonucleotide used in an amplification reaction, and refers to a nucleic acid molecule that is extended by adding a nucleotide to its 3'-terminus by a covalent bond in a nucleic acid amplification or synthesis reaction using a polymerase. .
  • the four types of primers are composed of two types of outer primers and two types of inner primers, and the outer primers are composed of forward outer (F3) primers and two backward outer (B3) primers. It is constructed and serves to unwind DNA double strands during the non-cyclic step of the reaction.
  • the inner primer consists of two types, a forward inner primer (FIP) and a backward inner primer (BIP), and nucleotides corresponding to the forward and reverse nucleotide sequences to create a loop essential for the LAMP reaction.
  • the additional two loop primers consist of a forward loop (LoopF) primer and two backward loop (LoopB) primers, and attach to a nucleotide sequence to which the inner primer does not bind to accelerate the LAMP reaction. .
  • Primer sets used for LAMP are designed for six distinct regions (F3, F2, F1, B1c, B2c and B3) on the target nucleic acid, and F3 and B3 are the two outer primers to determine the size of the amplified product FIP and BIP are two inner primers.
  • FIP is composed of F1c and F2 sequences
  • BIP is a hybrid primer composed of B1c and B2 sequences.
  • the LAMP reaction largely includes an initial construct production step and a cycling amplification step, and unlike PCR, it does not include a single-stranded denaturation step.
  • the F2 of FIP binds to the F2c region to initiate elongation.
  • BIP works in the same way.
  • the F3 primer binds to the F3c region to initiate DNA synthesis in a strand displacement manner, and is released as the DNA strand extended from the FIP is replaced.
  • the single strand released in this way forms a loop at its 5'-terminal region through F1/F1c binding, and the synthesis reaction proceeds in the same way for BIP and B3 primers, resulting in a dumbbell-shaped single strand with loops formed at both ends.
  • a stranded nucleic acid molecule is formed.
  • DNA synthesis starts from the 3' end of the F1 region, and a cycling step proceeds.
  • the cycling amplification step only two internal primers (optionally, together with a loop primer) are used, and first, one internal primer binds to the loop and DNA synthesis occurs in a strand displacement manner, creating a new loop region and then creating a new loop.
  • DNA synthesis occurs in a strand displacement method using a single-stranded nucleic acid molecule having a plurality of loop regions as a template, and consequently, the target nucleic acid is amplified.
  • step (i) of FIG. 1 the forward inner primer (FIP) hybridizes to the target nucleic acid and extends, and the forward outer primer (F3) hybridizes and extends to the outside of the forward inner primer (FIP). As this occurs, strand displacement occurs, and the extended strand of FIP is separated into a single strand. At this time, the 5'-terminal portion of the extended strand of FIP separated into a single strand forms a loop by hybridization between F1c and F1.
  • the reverse inner primer (BIP) hybridizes and extends to the extended strand of the FIP generated in step (i), and the reverse outer primer (B3) hybridizes and extends to the outside of the reverse outer primer (BIP), thereby replacing the strand.
  • the extended strand of BIP separates into a single strand.
  • the extended strand of BIP separated into a single strand forms a loop at its 5'-end by hybridization between F1 and F1c, and at its 3'-end by hybridization between B1c and B1 to form a loop. So, it forms a dumbbell shape.
  • FIP hybridizes to the dumbbell-shaped single-stranded DNA product generated in (ii) of FIG.
  • dumbbell-shaped single-stranded DNA product In (iv) of FIG. 1, BIP is hybridized and extended using the dumbbell-shaped single-stranded DNA product of (iii) of FIG. 1 as a template. 1(iii) and 1(iv), the reverse loop primer (LB) and the forward loop primer (LF) are respectively located in the loop region of the dumbbell-shaped DNA product (specifically, the loop between B1 and B2 or loop between F1 and F2) to accelerate the production of new DNA products (i.e., amplification).
  • the reverse loop primer LB
  • LF forward loop primer
  • the accelerating primer, LB or LF primer binds to the single-stranded region of the above-described dumbbell structure, and specifically, binds to a loop between B1 and B2 or a loop between F1 and F2.
  • the use of LB or LF primers increases the origin where DNA synthesis begins, resulting in an effect of speeding up the reaction rate.
  • six loops are usually formed in the process, and only two loops are used as origins for synthesis, but in the case of using LB and LF primers, all six loops are used as origins for synthesis, and synthesis The amount of DNA produced increases.
  • Suitable lengths of primers used in LAMP may be determined in consideration of a number of factors, such as temperature, application field, source of the primer, and length of the final amplification product.
  • the length of the primer may be at least 8 nucleotides, 9 nucleotides, 10 nucleotides, 15 nucleotides, 20 nucleotides, 25 nucleotides or 30 nucleotides.
  • it may be at least 8 nucleotides, 9 nucleotides, 10 nucleotides, 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides or 15 nucleotides for F3 and B3, and at least 25 nucleotides, 26 nucleotides, 27 nucleotides for FIP and BIP. , 28 nucleotides, 29 nucleotides or 30 nucleotides, and in the case of conventionally untagged LF and LB, it may be at least 11 nucleotides, 12 nucleotides, 13 nucleotides, 14 nucleotides or 15 nucleotides, but is not limited thereto.
  • the primer set is prepared using commercially available primer design software, such as Primer Explorer V5 (Fujitsu, Japan), LAVA (LAMP Assay Versatile Analysis) and LAMP Designer ( It can be designed using various design software such as PREMIER Biosoft).
  • primer design software such as Primer Explorer V5 (Fujitsu, Japan), LAVA (LAMP Assay Versatile Analysis) and LAMP Designer ( It can be designed using various design software such as PREMIER Biosoft).
  • nucleic acid refers to a polymer of deoxyribonucleotides or ribonucleotides in either single-stranded form or double-stranded form, said nucleotides being different from naturally occurring nucleotides. Derivatives of natural nucleotides, non-natural nucleotides or modified nucleotides that can function in the same way.
  • target nucleic acid refers to a nucleic acid sequence to be detected.
  • the target nucleic acid sequence may be hybridized with the tagged loop primer for the loop-mediated isothermal amplification reaction of the present disclosure. More specifically, as the type of nucleic acid in the target nucleic acid of the present disclosure, deoxyribonucleotide (DNA), ribonucleotide (RNA), and a mixture or combination thereof may be used.
  • DNA deoxyribonucleotide
  • RNA ribonucleotide
  • modified base means a base to which the above 5 nucleotides have been chemically modified. Specifically, for example, methylcytidine, pseudouridine, 4-thiouridine, dihydrouridine, cuosine, hypoxanthine (inosine (I)), etc. correspond to this, but are not limited thereto.
  • the target nucleic acid must be a single-stranded chain for detection, but even a double-stranded or high-order nucleic acid can be used after being converted to a single-stranded chain by heat denaturation, alkali denaturation, or the like.
  • the target nucleic acid of the present disclosure includes an embodiment in which such denaturation treatment is added.
  • the double-stranded target nucleic acid can be dissociated into a single strand by an enzymatic reaction using an enzyme having strand-displacement activity or an enzyme such as helicase. .
  • thermodynamic activity at which the polymer, which is a reaction product, can form a ring structure is maintained.
  • Specialized DNA polymerases with high strand displacement activity such as Bacillus stearothermophilus (Bst) DNA polymerase, Thermus thermophilus (Tth) DNA polymerase, Thermus aquaticus (Taq) DNA polymerase, Thermococcus litoralis DNA polymerase; and Bacillus caldotenax DNA polymerase, the extension reaction can proceed while dissociating the double-stranded DNA in the forward direction, and thus the target nucleic acid is not limited to a single-stranded sequence.
  • cDNA prepared by reverse transcription using RNA as a template is also included in the "target nucleic acid”.
  • the target nucleic acid can be a human, animal, plant or microbial nucleic acid.
  • Microorganisms may be fungi, protozoa, bacteria, viruses, or algae.
  • the target nucleic acid may be a viral nucleic acid, and specifically, the target nucleic acid may be an RNA viral nucleic acid.
  • the target nucleic acid can be a respiratory viral nucleic acid.
  • influenza virus nucleic acid respiratory syncytial virus (RSV) nucleic acid, adenovirus nucleic acid, enterovirus nucleic acid, parainfluenza virus nucleic acid, metapneumovirus (MPV) nucleic acid, bocavirus nucleic acid, It may be a rhinovirus nucleic acid and/or a coronavirus nucleic acid, but is not limited thereto. More specifically, the target nucleic acid may be a nucleic acid of SARS-CoV-2.
  • the nucleic acid of SARS-CoV-2 may be selected from the group consisting of E gene, N gene, RdRP gene, S gene, and combinations thereof.
  • the isothermal amplification reaction may include a reverse transcription reaction step. Details thereof can be found in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and Noonan, K. F. et al., Nucleic Acids Res. 16:10366 (1988).
  • Reverse transcription is a reaction in which cDNA is synthesized from RNA by a reverse transcription reaction using a reverse transcriptase.
  • the reverse transcription reaction can be performed in the same tube as the LAMP reaction (one step reaction), and cDNA is first generated through a separate reverse transcription reaction and then used in the LAMP reaction step (two step reaction).
  • a two-step reaction can be preferably used.
  • reverse transcriptase also called RNA-dependent DNA polymerase, refers to an enzyme that synthesizes complementary DNA using RNA as a template.
  • the reverse transcriptase may use reverse transcriptases derived from various sources, such as Avian Myeloblastosis Virus-derived Reverse Transcriptase (AMV RTase), murine leukemia virus-derived Reverse transcriptase (Murine Leukemia Virus-derived Reverse Transcriptase; MuLV RTase) and Rous-Associated Virus 2 Reverse Transcriptase (RAV-2 RTase) may be used, but are not limited thereto.
  • AMV RTase Avian Myeloblastosis Virus-derived Reverse Transcriptase
  • MuLV RTase murine leukemia virus-derived Reverse Transcriptase
  • RMV-2 RTase Rous-Associated Virus 2 Reverse Transcriptase
  • Reverse transcriptase requires a primer to synthesize cDNA from an RNA template.
  • primers There are three types of primers used in the reverse transcription reaction: (i) oligo dT primer that anneales to the poly A tail of mRNA and synthesizes cDNA from the 3' end, (ii) made of random nucleotides of 6-9 nt in size. These are random primers that start synthesis in all regions of RNA and (iii) target specific primers that synthesize only target cDNA.
  • the 5'-tagging site of the tagged loop primer of the present disclosure when the target nucleic acid is absent, forms a spatially folded structure so that the reporter molecule and the quencher molecule are in close proximity to each other (Fig. 2 see (b)).
  • Fig. 2 see (b)
  • the reporter molecule and the quencher molecule are in close proximity to each other, a quenching effect occurs, and no signaling effect by the reporter molecule occurs.
  • an assimilating probe used for real-time monitoring of a target nucleic acid in a conventional LAMP reaction, it includes two oligonucleotide strands, each of which includes a reporter molecule or a quencher molecule, and the two oligonucleotides
  • the principle that a quenching effect occurs by forming a complementary bond between oligonucleotides is used.
  • unlike conventional anabolic probes it is differentiated in that it uses a single-stranded loop primer containing an interactive double-labeling system.
  • a process of synthesizing a pair of probes by slowly decreasing the temperature from a high temperature to a low temperature is required before the LAMP reaction for nucleic acid amplification.
  • the temperature at which the binding of the two strands of the oligonucleotide is denatured into a single strand so that the two oligonucleotides can be maintained in a hybridized state even at the isothermal amplification reaction temperature.
  • the 5'-tagging portion of the tagged loop primer of the present disclosure when the target nucleic acid is present, forms a spatially unfolded structure, so that the reporter molecule and the quencher molecule are spaced apart from each other to unquench (see (iii) of FIG. 3 (a)).
  • This is the point where the tagged loop primer of the present disclosure is most differentiated from conventional anabolic probes, and the tagged loop primer of the present disclosure can minimize the occurrence of non-specific signaling to the target nucleic acid.
  • the reporter molecule and quencher molecule used in this disclosure constitute an interactive dual label system between which energy is non-radioactively transferred.
  • a fluorescence resonance energy transfer (FRET) labeling system includes a fluorescence reporter molecule (donor molecule) and a quencher molecule (acceptor molecule).
  • FRET fluorescence resonance energy transfer
  • the energy donor is fluorescent, but the energy acceptor can be either fluorescent or non-fluorescent.
  • the energy donor is non-fluorescent, such as a chromophore, and the energy acceptor is fluorescent.
  • the energy donor is luminescent, eg bioluminescent, chemiluminescent or electrochemiluminescent and the acceptor is fluorescent.
  • Interactive dual labels include pairs of labels that provide a detectable signal based on contact-mediated quenching (Salvatore et al., Nucleic Acids Research, 2002 (30) no.21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956).
  • the interactive label system includes all or any cases involving signal change due to interaction between at least two molecules (eg, dyes).
  • Reporter molecules and quencher molecules useful as single or dual labels can include any molecule known in the art. Examples include: Cy2 TM (506), YO-PRO TM -1 (509), YOYO TM -1 (509), Calcein (517), FITC (518), FluorX TM (519), Alexa TM ( 520), Rhodamine 110 (520), Oregon Green TM 500 (522), Oregon Green TM 488 (524), RiboGreen TM (525), Rhodamine Green TM (527), Rhodamine 123 (529), TO-PRO TM -1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3 TM (570) ), Alexa TM 546 (570), TRITC (572), Phycoerythrin R&B (575), Rhodamine Phalloidin (575),
  • the reporter molecule and quencher molecule may each be fluorescent.
  • the reporter molecule may be fluorescent while the quencher molecule may be non-fluorescent.
  • non-fluorescent dark quenchers capable of quenching fluorescence of a wide range of wavelengths or specific wavelengths may be used in the present disclosure.
  • the quencher molecule is fluorescent, a target nucleic acid sequence can be detected from a signal change of the fluorescent quencher molecule.
  • Reporter molecules and quencher molecules can be linked to oligonucleotides according to conventional methods.
  • the reporter molecule and the quencher molecule can be linked to the probe via a spacer comprising at least 3 carbon atoms (eg, a 3-carbon spacer, a 6-carbon spacer, a 9-carbon spacer, or a 12-carbon spacer).
  • the expression "forming a spatially folded structure” means that the 5'-tagging site to which the reporter molecule and the quencher molecule are bound are arranged in a three-dimensional space in a linear or helical form peculiar to double-stranded nucleic acid having a certain direction. It means having a shape that is conformationally and randomly folded, specifically, a folded structure such as a random coil.
  • the 5'-tagging site of the tagged loop primer of the present disclosure may form a hairpin structure so that the reporter molecule and the quencher molecule come close to each other in the absence of a target nucleic acid (Fig. 2(c) ) reference).
  • the 5'-tagging site of the tagged loop primer of the present disclosure when the target nucleic acid is present, collapses the hairpin structure so that the reporter molecule and the quencher molecule are separated from each other and unquenched (Fig. see (iii) in 3 (b)).
  • hairpin structure used herein has the same meaning as “stem-loop structure” and refers to a structure in which complementary bonds are formed inside a single strand of nucleic acid. Formation of the hairpin structure results in narrowing of the distance between distantly spaced nucleic acids.
  • the tagged loop primer according to the present disclosure includes both a reporter molecule and a quencher molecule at the 5'-tagged region, and in the absence of a target nucleic acid, the reporter molecule and the quencher molecule are formed through spatially folded structure or hairpin structure formation.
  • the molecules come into close proximity and a quenching effect occurs.
  • the 5'-tagged region has a distinct advantage in the manner in which quenching occurs by forming a spatially folded structure, such as a random coil, rather than in the manner of forming a hairpin structure.
  • the complementary sequence is present in a single strand and fixed at a certain distance, so that the stem structure It is easy to reshape, and the possibility of generating a bias is greatly reduced compared to the moving probe.
  • a method of forming a spatially folded structure for example, a random coil
  • a method of generating a signal by bond collapse of a double strand There is no problem of bias that may occur in a moving probe or a stem-loop structure.
  • the tagged loop primer of the present disclosure does not require a specific length.
  • the tagged loop primer of the present disclosure is 15-150 nucleotides, 15-140 nucleotides, 15-130 nucleotides, 15-120 nucleotides, 15-110 nucleotides, 15-100 nucleotides, 15-90 nucleotides, 15 -80 nucleotides, 15-70 nucleotides, 15-60 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 20-150 nucleotides, 20-140 nucleotides, 20-130 nucleotides, 20-120 nucleotides, 20-110 nucleotides, 20 -100 nucleotides, 20-90 nucleotides, 20-80 nucleotides, 20-70 nucleotides, 20-60 nucleotides, 20-50 nucleotides, 20-40 nucleotides, 30-150 nucleotides, 30-140 nucleotides, 30-130 nucleotides, 30 -120 nucleot
  • the 3'-targeting portion of the tagged loop primer of the present disclosure is of sufficient length to specifically hybridize to the target nucleic acid under loop mediated isothermal amplification (LAMP) reaction conditions.
  • LAMP loop mediated isothermal amplification
  • the 3'-targeting portion of the tagged loop primer of the present disclosure is 10-100 nucleotides, 10-90 nucleotides, 10-80 nucleotides, 10-70 nucleotides, 10-60 nucleotides, 10-50 nucleotides, 10-40 nucleotides, 10-30 nucleotides, 10-20 nucleotides, 12-100 nucleotides, 12-90 nucleotides, 12-80 nucleotides, 12-70 nucleotides, 12-60 nucleotides, 12-50 nucleotides, 12-40 nucleotides, 12-30 nucleotides, 12-20 nucleotides, 15-100 nucleotides, 15-90 nucleotides, 15-80 nucleotides, 15-70 nucleotides, 15-60 nucleotides, 15-50 nucleotides, 15-40 nucleotides, 15-30 nucleotides or It has a length of 15-20 nucleotides.
  • the 3'-targeting site of the tagged loop primer of the present disclosure may have a Tm value of 40 ° C to 70 ° C, specifically, 45 ° C to 70 ° C, 50 ° C to 70 ° C, 55 ° C to 70 °C, 60 °C to 70 °C, 40 °C to 65 °C, 45 °C to 65 °C, 50 °C to 65 °C, 55 °C to 65 °C, or 60 °C to 65 °C, but is not limited thereto. does not
  • the 5'-tagging portion of the tagged loop primer of the present disclosure is a nucleotide length such that the reporter molecule and the quencher molecule can be spaced apart from each other so that the quencher molecule unquenches a signal from the reporter molecule have
  • the 5'-tagging portion of the tagged loop primer of the present disclosure has a length of at least 5 nucleotides, specifically at least 10 nucleotides. More specifically, the 5'-tagging portion is 5-50 nucleotides, 5-45 nucleotides, 5-40 nucleotides, 5-35 nucleotides, 5-30 nucleotides, 5-25 nucleotides, 5-24 nucleotides, 5-23 nucleotides, 5-22 nucleotides, 5-21 nucleotides, 5-20 nucleotides, 8-50 nucleotides, 8-45 nucleotides, 8-40 nucleotides, 8-35 nucleotides, 8-30 nucleotides, 8-25 nucleotides, 8-24 nucleotides, 8-23 nucleotides, 8-22 nucleotides, 8-21 nucleotides, 8-20 nucleotides, 10-50 nucleotides, 10-45 nucleotides, 10-40 nucle
  • either the reporter molecule or the quencher molecule is located 1-5 nucleotides apart from the 5'-end or 5'-end of the 5'-tagging site of the present invention, and the other is in the form of a fragment. (Conformation) is located at a position to quench or unquench the signal from the reporter molecule.
  • the distance between the reporter molecule and the quencher molecule becomes close and the quenching effect appears, but the double-stranded 5'-tagging site When formed and unfolded, it means that the reporter molecule and the quencher molecule are separated from each other by a distance that can be unquenched due to the distance between the reporter molecule and the quencher molecule and bound to the 5'-tagging site.
  • one of the reporter molecule and the quencher molecule is bound to the 5'-end of the 5'-tagging site, and the other is internal deoxythymidine present at the 5'-tagging site. ; dT).
  • the internal dT refers to an internal dT that is separated from the 5'-end of the 5'-tagging region by a distance sufficient to quench or unquench the signal from the reporter molecule depending on the type of the fragment.
  • any of the reporter molecule and the quencher molecule can be bound to the 5'-end of the 5'-tagging site or to a position 1-5 nucleotides away from the 5'-end, and the effect of the invention is derived no matter which one is bound. does not affect
  • end refers to the last nucleotide, e.g., 5'-end refers to the last nucleotide in the 5' direction in a sequence, and 3'-end refers to the last nucleotide in the 3' direction in a sequence. refers to
  • terminal region refers to a region that includes the last nucleotide in a sequence and several or several tens of nucleotides adjacent thereto.
  • the reporter molecule and the quencher molecule are located at a distance of at most 50 nucleotides from each other, more specifically, for example, at most 45 nucleotides, at most 40 nucleotides, at most 35 nucleotides, at most 30 nucleotides, or at most 25 nucleotides. They are located at a distance of nucleotides apart.
  • the reporter molecule and the quencher molecule are located at least 4 nucleotides apart, specifically at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, more specifically at least 5 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides apart.
  • the reporter molecule and the quencher molecule are 5-45 nucleotides, 5-40 nucleotides, 5-35 nucleotides, 5-30 nucleotides, 5-25 nucleotides, 5-24 nucleotides, 5-23 nucleotides, 5-23 nucleotides, 22 nucleotides, 5-21 nucleotides, 5-20 nucleotides, 8-45 nucleotides, 8-40 nucleotides, 8-35 nucleotides, 8-30 nucleotides, 8-25 nucleotides, 8-24 nucleotides, 8-23 nucleotides, 8- 22 nucleotides, 8-21 nucleotides, 8-20 nucleotides, 10-45 nucleotides, 10-40 nucleotides, 10-35 nucleotides, 10-30 nucleotides, 10-25 nucleotides, 10-24 nucleotides, 10-23 nucleotides, 10- 22 nucleotides, 10-21 nucleotides
  • the present disclosure provides a method for detecting a target nucleic acid comprising performing a loop-mediated isothermal amplification (LAMP) reaction using one or more of the above-described tagged loop primers.
  • LAMP loop-mediated isothermal amplification
  • a forward tagged loop primer tagged LF
  • a reverse tagged loop primer tagged LB
  • Both LBs can be used, and when there are two or more target nucleic acids, it is possible to simultaneously detect two or more target nucleic acids by additionally using one or more of a tagged LF and a tagged LB suitable for each target nucleic acid.
  • the methods of the present disclosure are for detection of one target nucleic acid or simultaneous detection of two or more target nucleic acids.
  • all primer sets suitable for each target must be included.
  • the primer set in one embodiment includes four primers (F3, B3, FIP, BIP) essential for the LAMP reaction and one or more tagged loop primers of the present disclosure (at least one of tagged LF and tagged LB).
  • the above-described primer sets must be prepared for each target nucleic acid.
  • one or more of two types of untagged loop primers (LF and LB) that have been generally used in the prior art may be additionally included to improve the reaction rate.
  • the isothermal temperature condition of the method of the present disclosure is any one temperature selected from 50 ° C to 75 ° C, specifically, any one selected from 50 ° C to 70 ° C, selected from 50 ° C to 65 ° C Any one temperature, any one selected from 55 ° C to 75 ° C, any one selected from 55 ° C to 70 ° C, any one selected from 55 ° C to 65 ° C, any one selected from 60 ° C to 75 ° C A temperature of, any one temperature selected from 60 °C to 70 °C, or any one temperature selected from 60 °C to 65 °C.
  • the isothermal temperature condition is 60°C, 61°C, or 62°C, and in more specific embodiments is 62°C, but is not limited thereto.
  • the methods of the present disclosure are performed on DNA, cDNA or RNA nucleic acids.
  • the target nucleic acid can be a human, animal, plant or microbial nucleic acid.
  • Microorganisms may be fungi, protozoa, bacteria, viruses, or algae.
  • the target nucleic acid may be a viral nucleic acid, and specifically, the target nucleic acid may be an RNA viral nucleic acid.
  • the target nucleic acid may be a respiratory viral nucleic acid.
  • influenza virus nucleic acid respiratory syncytial virus (RSV) nucleic acid, adenovirus nucleic acid, enterovirus nucleic acid, parainfluenza virus nucleic acid, metapneumovirus (MPV) nucleic acid, bocavirus nucleic acid, It may be a rhinovirus nucleic acid and/or a coronavirus nucleic acid, but is not limited thereto. More specifically, the target nucleic acid may be a nucleic acid of SARS-CoV-2.
  • the nucleic acid of SARS-CoV-2 is selected from the group consisting of E gene, N gene, RdRP gene, S gene, and combinations thereof.
  • the isothermal amplification reaction may include a reverse transcription reaction step. Details thereof are as described above.
  • a nucleic acid detection device capable of detecting a fluorescent dye in real time during the RT-LAMP reaction is used isothermally in real time without separate electrophoresis or addition of SYBR Green I after the reaction. Amplification can be confirmed, and whether or not the target nucleic acid is amplified can be confirmed through the annealing peak.
  • the step of performing the loop mediated isothermal amplification (LAMP) reaction of the present disclosure can be performed using a tagged loop primer and an untagged loop primer together.
  • the term "untagged loop primer" in the present specification refers to conventional loop primers LB and LF that have been used to improve the reaction rate of a conventionally known LAMP reaction.
  • an untagged loop primer unlike the tagged loop primer of the present disclosure, it is preferable not to include a 5'-tagging site.
  • the untagged loop primer is used together with the tagged loop primer of the present disclosure, it is helpful to increase the sensitivity of target nucleic acid detection by further improving the reaction rate in the LAMP reaction.
  • an untagged loop primer it is understood that a person skilled in the art can easily design it by conventionally known design methods, and is not particularly limited.
  • the target nucleic acid detection method of the present disclosure relates to a method characterized by the use of a tagged loop primer, which is another aspect of the present disclosure described above, so that redundant content is incorporated and excessive complexity described herein is avoided. Avoid duplicate entries for this reason.
  • the present disclosure provides a composition for a loop-mediated isothermal amplification (LAMP) reaction comprising the above-described tagged loop primer.
  • LAMP loop-mediated isothermal amplification
  • composition for a loop-mediated isothermal amplification reaction of the present disclosure may be mixed with a lysate of a detection sample and used to perform a loop-mediated isothermal amplification reaction.
  • the composition for the loop-mediated isothermal amplification (LAMP) reaction may include a composition for the reverse transcription reaction.
  • the reverse transcription reaction composition may include a reverse transcription polymerase and/or a reverse transcription primer.
  • the reverse transcription primer may be an oligo dT-primer, a random primer, or a target-specific primer.
  • the reverse transcription primer may be a target-specific primer.
  • the target-specific primers are used to synthesize cDNA in a reverse transcription reaction, and then form a primer pair or a primer set with another primer in a target nucleic acid sequence amplification reaction to use as a primer pair for amplification of the obtained cDNA It can be.
  • the composition for the LAMP reaction may additionally include reverse transcriptase, DNA polymerase, dNTPs, buffer, and/or magnesium.
  • the DNA polymerase is a polymerase derived from a thermophilic microorganism, and may include, in particular, a polymerase lacking a 5'->3' exonuclease function.
  • a polymerase lacking a 5'->3' exonuclease function.
  • the DNA polymerase may be Bst DNA polymerase, but (i) has strand displacement activity, and (ii) maintains thermodynamic activity that allows the reaction product, the polymer, to form a ring structure It is not limited to Bst DNA polymerase if it satisfies two main requirements that can cause a polymerization reaction at a temperature (eg, between 50 ° C and 75 ° C).
  • a temperature eg, between 50 ° C and 75 ° C
  • GspSSD DNA polymerase having a faster amplification ability and stronger reverse transcriptase activity than the Bst DNA polymerase mainly used in the existing LAMP reaction may be used, but is not limited thereto.
  • the composition for the LAMP reaction may additionally include a nucleotide analogue instead of dNTPs.
  • Nucleotide analogues are those that are modified or not found in nature and which can polymerize alone or together with natural nucleotides in the process of template-directed DNA synthesis.
  • the buffer includes, but is not limited to, a sodium phosphate buffer, a potassium phosphate buffer, a Tris-HCl buffer, or a Tricine buffer.
  • the magnesium may be used in the form of a salt such as magnesium acetate, magnesium chloride or magnesium sulfate.
  • a composition for a loop-mediated isothermal amplification reaction selectively contains reagents necessary for carrying out a target amplification reaction (eg, a LAMP reaction) such as nucleic acid polymerase, buffer, polymerase cofactor, and deoxyribonucleotide-5-triphosphate.
  • a target amplification reaction eg, a LAMP reaction
  • the composition for the LAMP reaction may also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit nucleic acid polymerase activity.
  • the composition for the LAMP reaction may include oligonucleotides or reagents necessary for conducting a positive control reaction.
  • compositions for the LAMP reaction may be present in individual containers or a plurality of components may be present in one container.
  • the present disclosure provides a kit for detecting a target nucleic acid comprising the loop-mediated isothermal amplification (LAMP) composition described above.
  • LAMP loop-mediated isothermal amplification
  • the kit for detecting a target nucleic acid of the present disclosure may include, in addition to the composition for detecting a target nucleic acid necessary for detecting a target nucleic acid, a container for storing/transporting the composition, tools and tools necessary for detecting a target nucleic acid, and the like.
  • the RdRP gene and/or N gene of SARS-CoV-2 were used as the target nucleic acid.
  • the SARS-CoV-2 synthetic genome composed of RNA Tewist Synthetic SARS-CoV-2 RNA control 2, Twist Bioscience, Cat. No. 1020244 was used as a template.
  • the SARS-CoV-2 synthetic genome prepared at a concentration of 10 6 copies/ ⁇ L was serially diluted 10-fold using distilled water to obtain a total of 3 concentrations (concentration 1: 4 ⁇ 10 3 copies/ ⁇ L, concentration 2: 4 ⁇ 10 2 copies/ ⁇ L, concentration 3: 4 ⁇ 10 1 copies/ ⁇ L) of SARS-CoV-2 synthetic genome was prepared.
  • RNA Control Human (Applied Biosystems, Cat. No. 4307281) extracted from cells was used as an internal control template.
  • Total RNA prepared at a concentration of 50 ng/ ⁇ L was serially diluted 10 times with distilled water, and a total of 2 concentrations (concentration 1: 4 ⁇ 10 -2 ng/ ⁇ L, concentration 2: 4 ⁇ 10 -3 ng/ ⁇ L) of total RNA samples were prepared.
  • Distilled water was used as a negative control.
  • a primer set (F3, B3, FIP, BIP, LF, LB) and a loop primer according to the present disclosure were prepared as shown in Table 1 below.
  • a negative control reaction was also performed under the same conditions as above using a reaction mixture containing 5 ⁇ L of distilled water instead of the target nucleic acid.
  • these results mean that the target nucleic acid can be detected using the tagged loop primer according to the present disclosure.
  • F3 S
  • a negative control reaction was also performed under the same conditions as above using a reaction mixture containing 5 ⁇ L of distilled water instead of the target nucleic acid.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 개시는 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법에 관한 것이다. 본 개시의 루프 매개 등온 증폭 반응용 태그된 루프프라이머는 제조가 용이하고, 본 개시의 태그된 루프프라이머를 사용하면 단일 타겟 핵산은 물론 복수의 타겟 핵산을 효과적으로 동시 검출 가능하다.

Description

단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법
본 개시는 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법에 관한 것이다.
핵산 증폭 기술은 분자생물학 및 생명공학 분야에서 주로 사용되는 기술로 샘플 내에 존재하는 소량의 타겟 핵산을 검출하고 분석할 수 있는 방법이다. 핵산 증폭을 위해 PCR(Polymerase chain reaction) 기술이 가장 흔히 사용되며, 이는 이중 가닥 DNA를 단일 가닥 DNA로 변성시킨 후, 여기에 프라이머를 어닐링시키고, 어닐링된 프라이머를 중합효소에 의해 연장시키는 일련의 과정을 반복한다.
형광물질을 이용한 실시간 PCR 방법은 PCR 과정 중에 핵산 증폭에 따른 형광 세기의 증가를 검출하는 방법이다. 실시간 PCR 방법은 타겟마다 상이한 형광 염료를 사용함으로써 멀티플렉스 검출이 가능한 장점이 있으나, 고가의 장비가 필요하고 검출까지 시간이 많이 소요되는 단점이 있다.
PCR 방법의 대안으로서, 고가의 실시간 PCR 장비가 필요 없으며 PCR에 비해 더 빠른 시간 내에 타겟 핵산을 검출할 수 있는 등온 증폭법(Isothermal amplification method)이 개발되었다. 등온 증폭법의 예로는 rolling circle amplification(RCA, M. M. Ali, F. Li, Z. Zhang, K. Zhang, D.-K. Kang, J. A. Ankrum, X. C. Le and W. Zhao, Chem. Soc. Rev., 2014, 43, 3324-3341.), loop-mediated isothermal amplification(LAMP, Y. Mori, H. Kanda and T. Notomi, J. Infect. Chemother., 2013, 19, 404-411), recombinase polymerase amplification(RPA, J. Li, J. Macdonald and F. von Stetten, Analyst, 2018, 144, 31-67), nucleic acid sequence based amplification(NASBA, A. Borst, J. Verhoef, E. Boel and A. C. Fluit, Clin. Lab., 2002, 48, 487-492), strand displacement amplification(SDA, B. J. Toley, I. Covelli, Y. Belousov, S. Ramachandran, E. Kline, N. Scarr, N. Vermeulen, W. Mahoney, B. R. Lutz and P. Yager, Analyst, 2015, 140, 7540-7549), helicase dependent amplification (HAD, M. Vincent, Y. Xu and H. Kong, EMBO Rep., 2004, 5, 795-800), transcription-mediated amplification (TMA, L. Comanor, Am. J. Gastroenterol., 2001, 96, 2968-2972) 등이 있다.
상기 등온 증폭법 중에서 LAMP 방법이 가장 널리 사용되고 있다. LAMP는 2000년에 Notomi et al(T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino and T. Hase, Nucleic Acids Res., 2000, 28, E63)에 의해 처음으로 개발된 후 Nagamine et al(K. Nagamine, T. Hase and T. Notomi, Mol. Cell. Probes, 2002, 16, 223-229)에 의해 증폭 가속화를 위한 추가의 프라이머를 사용하는 것으로 최적화되었다.
LAMP의 표준 검출 방법은 마그네슘 피로포스페이트의 침전에 의한 탁도 측정법(Y. Mori, K. Nagamine, N. Tomita and T. Notomi, Biochem. Biophys. Res. Commun., 2001, 289, 150-154)이며, 그 외 방법으로서 겔 전기 영동, 칼슘에 대한 금속 지시자, 비색 LAMP, 콜로이드-결정 기질에 대한 커피-링 효과, LAMP 마그네틱 비드 응집체의 페이퍼 기반 신속 검출, 멜팅 및 어닐링 곡선 분석, SYBR green과 같은 인터컬레이팅 형광 염료, 피로포스페이트 전환을 통한 생물발광 또는 전기화학발광 등이 있다. 최근에는 동화 프로브(Assimilating probe)를 사용하여 타겟 핵산 증폭 서열에 특이적인 형광을 검출하는 방법(WO2011-163425)이 개발되었다.
일반적으로, LAMP 방법과 같은 등온 증폭 방법은 짧은 시간 내(주로 1시간 이내)에 한 온도에서 유전자를 증폭할 수 있고, 실시간 PCR에 비해 고가의 장비가 필요하지 않아 현장 신속진단에 적용되어 왔다.
LAMP 방법과 관련하여, 제조가 용이하고, 등온 증폭 반응의 검출 효율을 높일 수 있는 최적화된 프라이머 디자인에 대한 요구가 지속되어 왔다.
본 명세서 전체에 걸쳐 다수의 인용문헌 및 특허 문헌이 참조되고 그 인용이 표시되어 있다. 인용된 문헌 및 특허의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 발명자들은 루프 매개 등온 증폭(LAMP; Loop-mediated isothermal amplification) 반응 방법에 이용될 수 있고, 기존 LAMP 방법에 적용된 바 없는 새로운 시그널링 방식이 적용된 단일 가닥의 루프프라이머를 개발하고자 노력하였다. 그 결과, 본 발명자들은 타겟 핵산에 상보적인 결합을 형성하는 3’-타겟팅 부위 및 타겟 핵산에 상보적인 결합을 형성하지 않는 5’-태깅 부위를 포함하며, 상기 5’-태깅 부위에 리포터 분자 및 퀀처 분자가 소정의 간격으로 이격되어 연결된 태그된 루프프라이머를 사용하여 루프 매개 등온 증폭 반응을 실시하는 경우, 효과적으로 하나 또는 둘 이상의 타겟 핵산의 검출이 가능하다는 것을 규명함으로써 본 발명을 완성하였다.
따라서, 본 발명의 목적은 루프 매개 등온 증폭 반응용 태그된 루프프라이머를 제공하는 것이다.
본 발명의 다른 목적은 상기 태그된 루프프라이머를 이용하는 타겟 핵산 검출 방법을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 태그된 루프프라이머를 포함하는 루프 매개 등온 증폭 반응용 조성물을 제공하는 것이다.
본 개시의 일 양태에 따르면, 다음을 포함하는 3′ 에서 5′ 방향으로 (i) F3c, F2c, F1c, B1, B2 및 B3 또는 (ii) B3c, B2c, B1c, F1, F2 및 F3를 가지는 타겟 핵산을 검출하기 위한 태그된 루프프라이머를 제공한다:
(i) 상기 타겟 핵산의 B1 및 B2 사이 또는 F1 및 F2 사이의 전체 또는 일부 서열에 상보적인 뉴클레오타이드 서열을 포함하는 3’-타겟팅 부위; 및
(ii) 상기 타겟 핵산에 비-상보적인 뉴클레오타이드 서열을 포함하는 5’-태깅 부위;
상기 5’-태깅 부위는 리포터 분자 및 퀀처 분자를 포함하고,
상기 타겟 핵산이 부존재하는 경우, 상기 5’-태깅 부위의 상기 리포터 분자 및 상기 퀀처 분자는 서로 가깝게 위치하여 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭하고,
상기 타겟 핵산이 존재하는 경우, 상기 5’-태깅 부위의 상기 리포터 분자 및 상기 퀀처 분자는 서로 분리되어 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭한다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산이 부존재하는 경우, 상기 5’-태깅 부위는 공간적으로 폴딩된다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산이 존재하는 경우, 상기 5’-태깅 부위는 공간적으로 언폴딩된다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산이 부존재하는 경우, 상기 5’-태깅 부위는 헤어핀 구조를 형성한다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산이 존재하는 경우, 상기 5’-태깅 부위의 헤어핀 구조는 붕괴(disrupt)된다.
본 개시의 일 구현예에 따르면, 상기 태그된 프라이머는 20 내지 150 뉴클레오타이드 길이이다.
본 개시의 일 구현예에 따르면, 상기 LAMP 반응에서 상기 3’-타겟팅 부위는 상기 타겟 핵산에 혼성화하기에 충분한 뉴클레오타이드 길이를 가진다.
본 개시의 일 구현예에 따르면, 상기 3’-타겟팅 부위는 10 내지 100 뉴클레오타이드 길이이다.
본 개시의 일 구현예에 따르면, 상기 3’-타겟팅 부위는 40°C 내지 70°C의 Tm 값을 가진다.
본 개시의 일 구현예에 따르면, 상기 5’-태깅 부위는 상기 퀀처 분자가 상기 리포터 분자로부터 시그널을 언퀀칭하도록 상기 리포터 분자와 상기 퀀처 분자가 서로 이격될 수 있는 정도의 뉴클레오타이드 길이를 가진다.
본 개시의 일 구현예에 따르면, 상기 5’-태깅 부위는 최소 10 뉴클레오타이드 길이이다.
본 개시의 일 구현예에 따르면, 상기 리포터 분자 및 상기 퀀처 분자는 서로 최소 10 뉴클레오타이드 이격되어 있다.
본 개시의 일 구현예에 따르면, 상기 리포터 분자 및 퀀처 분자 중 어느 하나는 상기 5’-태깅 부위의 5’-말단에 연결되고, 나머지 하나는 5’-태깅 부위에 인터널 디옥시티미딘(internal deoxythymidine; dT)에 연결되어 있다.
본 개시의 일 양태에 따르면, 본 개시에 따른 하나 이상의 태그된 루프프라이머를 이용하여 루프 매개 등온 증폭(LAMP) 반응을 수행하는 단계를 포함하는 하나 이상의 타겟 핵산 검출 방법을 제공한다.
본 개시의 일 구현예에 따르면, 상기 LAMP 반응은 50°C 내지 75°C 사이의 한 온도에서 수행된다.
본 개시의 일 구현예에 따르면, 상기 타겟 핵산은 바이러스로부터 유래한다.
본 개시의 일 구현예에 따르면, 상기 바이러스는 RNA 바이러스이다.
본 개시의 일 구현예에 따르면, 상기 LAMP 반응은 종래의 태그되지 않은 루프프라이머를 추가적으로 이용한다.
본 개시의 일 양태에 따르면, 본 개시에 따른 태그된 루프프라이머를 포함하는 루프 매개 등온 증폭 반응용 조성물을 제공한다.
본 발명의 특징 및 이점을 요약하면 다음과 같다:
(a) 본 개시의 태그된 루프프라이머는 단일 가닥 내에 리포터 분자 및 퀀처 분자를 모두 포함하며, 프라이머 역할뿐만 아니라 프로브의 역할을 동시에 할 수 있는 것이 특징이다.
(b) 본 개시에 따른 태그된 루프프라이머는 종래 두 개의 프로브를 이용하는 방법, 예컨대, 동화 프로브 방법과 같이, 한 쌍의 프로브로 합성하는 과정이 필요치 않고, 등온 증폭 반응 온도에서 두 개의 프로브가 혼성화된 상태를 유지할 수 있도록 설계해야하는 번거로움이 없으며, 두 개의 프로브 간의 일부 상보성 결합의 비특이적 붕괴에 따른 노이즈 발생의 가능성을 차단할 수 있는 이점이 있다.
(c) 따라서, 본 개시에 따른 태그된 루프프라이머는 제조가 용이하고, 나아가 태그된 루프프라이머를 사용하면 단일 타겟 핵산은 물론 복수의 타겟 핵산을 효과적으로 동시 검출 가능하다는 장점이 있다.
도 1은 4종의 프라이머(F3, B3, FIP 및 BIP) 및 종래 태그되지 않은 2종의 루프프라이머(LF 및 LB)를 이용한 LAMP (Loop-mediated isothermal amplification) 방법의 일 예를 도식적으로 보여준다.
도 2는 본 개시에 따른 태그된 루프프라이머의 구조를 도시적으로 보여준다.
도 2(a)는 태그된 루프프라이머에서 (i) 리포터 분자 및 퀀처 분자를 포함하는 5‘-태깅 부위 및 (ii) 타겟 핵산의 B1 및 B2 사이 또는 F1 및 F2 사이의 전체 또는 일부 서열에 상보적인 뉴클레오타이드 서열을 포함하는 3’-타겟팅 부위를 보여준다.
도 2의 (b)는 태그된 루프프라이머의 5’-태깅 부위가 랜덤 코일과 같은 공간적으로 폴딩된 구조의 형성에 의해 리포터 분자 및 퀀처 분자가 근접하게 되어 퀀칭 효과가 발생하는 것을 보여준다.
도 2의 (c)는 태그된 루프프라이머의 5’-태깅 부위가 헤어핀 구조를 형성하여 리포터 분자 및 퀀처 분자가 근접하게 되어 퀀칭 효과가 발생하는 것을 보여준다.
도 3은 본 개시에 따른 태그된 루프프라이머를 이용한 LAMP (Loop-mediated isothermal amplification) 방법의 일 예를 도식적으로 보여준다.
도 3의 (a)는 태그된 루프프라이머의 3’-타겟팅 부위가 타겟 핵산의 F1 및 F2 사이의 전체 또는 일부 서열에 상보적인 뉴클레오타이드 서열을 포함하는 정방향 태그된 루프프라이머(태그된 LF)를 이용한 LAMP 방법의 일 예이다.
도 3의 (b)는 태그된 루프프라이머의 3’-타겟팅 부위가 타겟 핵산의 B1 및 B2 사이의 전체 또는 일부 서열에 상보적인 뉴클레오타이드 서열을 포함하는 역방향 태그된 루프프라이머(태그된 LB)를 이용한 LAMP 방법의 일 예이다.
도 3의 (a) 및 (b)에 나타난 바와 같이, 태그된 루프프라이머의 5‘-태깅 부위가 단일 가닥으로 존재하는 경우에는 랜덤 코일(또는 헤어핀 구조) 형태로 존재하여 리포터 분자 및 퀀처 분자가 근접하게 위치하여 퀀처 분자가 리포터 분자로부터의 시그널을 퀀칭하나(도 3 (a) 및 (b)의 (i) 또는 (ii) 참조), LAMP 반응을 통해 5’-태깅 부위가 이중 가닥 형태를 형성하는 경우, 리포터 분자와 퀀처 분자는 서로 이격되어 퀀처 분자는 리포터 분자로부터의 시그널을 언퀀칭 한다(도 3 (a) 및 (b)의 (iii) 참조).
도 4는 실시예 3의 RdRp 유전자 타겟 핵산의 Mono RT-LAMP 결과를 나타낸다.
도 5는 실시예 3의 N 유전자 타겟 핵산의 Mono RT-LAMP 결과를 나타낸다.
도 6은 실시예 3의 RNase P 유전자 타겟 핵산의 Mono RT-LAMP 결과를 나타낸다.
도 7은 실시예 3의 RdRP gene, N gene 그리고 RNase P gene 타겟 핵산의 Multi RT-LAMP 결과를 나타낸다.
본 발명자들은 루프 매개 등온 증폭(LAMP; Loop-mediated isothermal amplification) 반응 방법에 이용될 수 있고, 기존 LAMP 방법에 적용된 바 없는 새로운 시그널링 방식이 적용된 단일 가닥의 루프프라이머를 개발하고자 노력하였다. 그 결과, 본 발명자들은 타겟 핵산에 상보적인 결합을 형성하는 3’-타겟팅 부위 및 타겟 핵산에 상보적인 결합을 형성하지 않는 5’-태깅 부위를 포함하며, 상기 5’-태깅 부위에 리포터 분자 및 퀀처 분자가 소정의 간격으로 이격되어 연결된 태깅된 루프프라이머를 사용하여 루프 매개 등온 증폭 반응을 실시하는 경우, 효과적으로 하나 또는 둘 이상의 타겟 핵산의 검출이 가능하다는 것을 규명하였다.
본 개시의 일 양태에 따르면, 다음을 포함하는 다음을 포함하는 3′ 에서 5′ 방향으로 (i) F3c, F2c, F1c, B1, B2 및 B3 또는 (ii) B3c, B2c, B1c, F1, F2 및 F3를 가지는 타겟 핵산을 검출하기 위한 태그된 루프프라이머를 제공한다:
(i) 상기 타겟 핵산의 B1 및 B2 사이 또는 F1 및 F2 사이의 전체 또는 일부 서열에 상보적인 뉴클레오타이드 서열을 포함하는 3’-타겟팅 부위; 및
(ii) 상기 타겟 핵산에 비-상보적인 뉴클레오타이드 서열을 포함하는 5’-태깅 부위;
상기 5’-태깅 부위는 리포터 분자 및 퀀처 분자를 포함하고,
상기 타겟 핵산이 부존재하는 경우, 상기 5’-태깅 부위의 상기 리포터 분자 및 상기 퀀처 분자는 서로 가깝게 위치하여 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭하고,
상기 타겟 핵산이 존재하는 경우, 상기 5’-태깅 부위의 상기 리포터 분자 및 상기 퀀처 분자는 서로 분리되어 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭한다.
본 개시에 있어서, 루프 매개 등온 증폭(LAMP; loop-mediated isothermal amplification) 반응에 관해서는 "LAMP, Y. Mori, H. Kanda and T. Notomi, J. Infect. Chemother., 2013, 19, 404-411"에 상세히 개시되어 있다.
본 개시에서 루프 매개 등온 증폭 반응은 역전사 루프 매개 등온 증폭 반응 (RT-LAMP; Loop-mediated isothermal amplification)을 포함하는 의미로 사용되었다.
루프 매개 등온 증폭은 등온 조건에서 높은 민감도와 특이성으로 타겟 핵산을 증폭할 수 있는 핵산 증폭 방법이다(Notomi, T. et al. 2000. Loop-Mediated Isothermal Amplification of DNA. Nucleic Acids Res 28, E63). LAMP 방법은 가닥 치환(strand displacement) 활성을 갖는 DNA 중합효소 및 타겟 핵산의 여러 부위에서 특이적으로 고안된 최소 4개 내지 6개의 프라이머 세트를 사용한다(도 1 참고).
본 개시의 태그된 루프프라이머는 대상체(subject)로부터 분리한 생물학적 샘플 또는 비생물학적 샘플로부터 타겟 핵산을 검출하기 위한 루프 매개 등온 증폭 반응을 위해 사용되는 프라이머이며, 이를 사용한 루프매개 등온 증폭 반응을 통해, 샘플 내에 타겟 핵산 유무를 신속히 판별할 수 있다. 본 개시의 태그된 루프프라이머는 단일 가닥 내에 리포터 분자 및 퀀처 분자를 모두 포함하는 것을 특징으로 하며, "단일 가닥 이중 표지 루프프라이머"라고도 기재된다. 도 2의 (a)를 참조하여 설명하면, 본 개시에 따른 태그된 루프프라이머는 (i) 리포터 분자 및 퀀처 분자를 포함하는 5’-태깅 부위 및 (ii) 타겟 핵산의 B1 및 B2 사이 또는 F1 및 F2 사이의 전체 또는 일부 서열에 상보적인 뉴클레오타이드 서열을 포함하는 3’-타겟팅 부위를 포함한다.
본 명세서에서 사용되는 바와 같이, 2개의 수치 또는 위치와 관련하여 사용된 용어 “사이”는 2개의 수치 또는 위치를 포함하지 않는 것으로 해석되는 반면, 용어 “내지”는 2개의 수치 또는 위치를 포함하는 것으로 이해되어야 한다. 예를 들어, 본원에서 B1 및 B2 사이는 B1 및 B2를 포함하지 않는 것으로 해석되고, 10 내지 100은 10 및 100을 포함하는 것으로 해석된다.
본 명세서에서 사용되는 용어 "대상체(subject)"는 본 개시의 방법을 이용하여 검출하고자 하는 타겟 핵산(예컨대, 특정 병원체)을 포함하고 있을 것으로 의심되는 개체를 의미한다. 상기 대상체의 예는 비제한적으로 개, 고양이, 설치류, 영장류, 인간 등의 포유동물을 들 수 있으며, 특히 인간이다.
본 명세서에서 사용되는 용어 "샘플"은 검출하고자 하는 핵산을 포함하거나 포함하고 있을 것으로 의심되는 임의의 분석 물질을 의미할 수 있다. 예컨대, 상기 샘플은 생물학적 샘플(예컨대, 세포, 조직 및 체액) 및 비생물학적 샘플(예컨대, 음식물, 물 및 토양)을 포함하며, 상기 생물학적 샘플은 예컨대, 바이러스, 세균, 조직, 세포, 혈액(전혈, 혈장 및 혈청 포함), 림프, 골수액, 타액, 객담(sputum), 도말물(swab), 흡인액(aspiration), 우유, 소변, 분변, 안구액, 정액, 뇌 추출물, 척수액, 관절액, 흉선액, 기관지 세척액, 복수 또는 양막액일 수 있으나, 이에 한정되는 것은 아니다.
상기 샘플은 본원에서 '검체'와 상호교환적으로 사용될 수 있다.
일 구현예에 따르면, 상기 샘플은 대상체, 특히 포유동물, 보다 특히 인간으로부터 얻을 수 있으며, 예를 들어, 도말물(swab), 타액(saliva), 객담(sputum), 흡인액(aspiration), 기관지폐포세척(bronchoalveolar lavage; BAL), 가글(gargle) 또는 혈액일 수 있으나, 이에 한정되는 것은 아니다.
특정 구현예에 있어서, 상기 대상체로부터 유래된 샘플은 도말물(swab), 타액, 또는 이들의 혼합물이다.
일 구현예에 있어서, 상기 도말물은 비인두 도말물(nasopharyngeal swab), 전비강 도말물(nostril swab), 구인두 도말물(oropharyngeal swab), 구강 도말물(oral swab), 침 도말물(saliva swab), 생식기 도말물(genital swab), 직장 도말물(rectal swab) 또는 이들 중 둘 이상의 혼합 도말물이다.
일 구현예에 따르면, 상기 샘플은 효율적인 증폭 반응(즉, LAMP 반응)을 위해 본 기술분야에서 공지된 핵산 추출(nucleic acid extraction) 과정을 거칠 수 있다(참조: Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press(2001)). 상기 핵산 추출 과정은 샘플의 종류에 따라 달라질 수 있다. 필요에 따라 핵산 정제 과정을 추가할 수도 있다.
다른 구현예에 따르면, 상기 샘플은 샘플 내의 핵산을 추출하는 단계 없이 직접 분석될 수 있다. 예컨대, Pannacio et al.(Nucleic Acids Res. 1993 September 25; 21(19): 4656), Pandori et al.(BMC Infect Dis. 2006 Jun 24;6: 104) 및 WO 2021-261864에 개시된 방법을 이용할 수 있다.
본 명세서 상의 용어 "프라이머"는 증폭 반응에 사용되는 단일 가닥의 올리고뉴클레오타이드로 중합효소를 이용한 핵산 증폭 또는 합성 반응에서 그 3’-말단에 뉴클레오타이드가 공유결합에 의해 추가되어 연장되는 핵산 분자를 지칭한다.
LAMP 반응을 위해서는 필수적으로 4종의 프라이머(F3, B3, FIP, BIP)가 필요하며, 반응 속도를 향상시키기 위해 2종의 루프프라이머(LF, LB)를 추가적으로 사용할 수 있다. 상기 4종의 프라이머는 외부(outer) 프라이머 2종과 내부(inner) 프라이머 2종으로 구성되며, 외부 프라이머는 정방향 외부(forward outer, F3) 프라이머와 역방향 외부(backward outer, B3) 프라이머 2종으로 구성되고 반응의 비순환기(non-cyclic step) 동안 DNA 이중 가닥을 풀어주는 역할을 한다. 내부 프라이머는 정방향 내부 프라이머(forward inner primer, FIP)와 역방향 내부 프라이머(backward inner primer, BIP) 2종으로 구성되고 LAMP 반응에 필수적인 루프(loop)를 만들 수 있도록 정방향 및 역방향 염기서열에 해당하는 뉴클레오타이드로 구성된다. 추가 2종의 루프프라이머는 정방향 루프(forward loop, LoopF) 프라이머와 역방향 루프(backward loop, LoopB) 프라이머 2종으로 구성되며 내부(inner) 프라이머가 결합하지 않는 염기서열에 부착하여 LAMP 반응을 가속화시킨다.
LAMP에 사용되는 프라이머 세트는 타겟 핵산 상의 6개의 구분되는 영역(F3, F2, F1, B1c, B2c 및 B3)에 대하여 디자인되며, F3 및 B3는 두 개의 바깥쪽 프라이머로 증폭되는 산물의 크기를 결정하며, FIP 및 BIP는 두 개의 안쪽 프라이머로 FIP는 F1c 서열 및 F2 서열로 구성되고, BIP는 B1c 및 B2 서열로 구성되는 하이브리드 프라이머이다.
LAMP 반응은 크게 개시 구조 생산 단계 및 사이클링 증폭 단계를 포함하며, PCR과 달리 단일 가닥으로 변성시키는 단계를 포함하지 않는다. 개시 구조 생산 단계에서 FIP의 F2가 F2c 영역에 결합하여 연장을 개시한다. BIP도 이와 마찬가지로 진행된다. F3 프라이머는 F3c 영역에 결합하여 가닥 치환 방식으로 DNA 합성을 시작하여, FIP에서 연장된 DNA 가닥이 교체되면서 방출된다. 이렇게 방출된 단일 가닥은 F1/F1c 결합을 통해 그 5’-말단 부위에 루프를 형성하게 되고, BIP 및 B3 프라이머도 동일한 방식으로 합성 반응이 진행되어, 덤벨 모양의 양 말단 부위에 루프가 형성된 단일 가닥 핵산 분자가 형성된다. 이어 F1 영역의 3’ 말단으로부터 DNA 합성이 시작되며, 사이클링 단계가 진행된다. 사이클링 증폭 단계에서는 두 개의 내부 프라이머(선택적으로, 루프프라이머와 함께)만이 사용되며, 처음에는 하나의 내부 프라이머가 루프에 결합하여 가닥 치환 방식으로 DNA 합성이 일어나면서 루프 부위가 새롭게 생성되고, 새롭게 생성된 복수의 루프 부위를 가지는 단일 가닥 핵산 분자를 다시 주형으로 하여 가닥 치환 방식으로 DNA 합성이 발생하여 결론적으로 타겟 핵산이 증폭된다.
도 1을 참조하여 LAMP 반응을 간략하게 설명하면, 도 1의 (i) 단계에서, 정방향 내부 프라이머(FIP)가 타겟 핵산에 혼성화하여 연장되고, 이의 바깥쪽으로 정방향 외부 프라이머(F3)가 혼성화되어 연장되면서 가닥 치환(strand displacement)이 발생하고, FIP의 연장 가닥은 단일 가닥으로 분리된다. 이 때, 단일 가닥으로 분리된 FIP의 연장 가닥의 5’-말단 부위는 F1c 및 F1 간의 혼성화에 의해 루프를 형성하게 된다. 도 1의 (ii) 단계에서, 상기 단계 (i)에서 생성된 FIP의 연장 가닥에 역방향 내부 프라이머(BIP)가 혼성화하여 연장되고, 이의 바깥쪽으로 역방향 외부 프라이머(B3)가 혼성화되어 연장되면서 가닥 치환이 발생하고 BIP의 연장 가닥은 단일 가닥으로 분리된다. 이 때, 단일 가닥으로 분리된 BIP의 연장 가닥은, 그의 5’-말단 부위는 F1 및 F1c 간의 혼성화에 의해 루프를 형성하고, 그의 3’-말단 부위는 B1c 및 B1 간의 혼성화에 의해 루프를 형성하여, 덤벨(Dumbell) 형태를 형성한다. 도 1의 (iii) 단계에서는 상기 도 1의 (ii)에서 생성된 덤벨 (Dumbell) 형태의 단일 가닥 DNA 산물에 FIP이 혼성화되어 연장되고 새로운 덤벨 형태의 단일 가닥 DNA 산물을 생성한다. 도 1의 (iv)는 상기 도1 의 (iii)의 덤벨 형태의 단일 가닥 DNA 산물을 주형으로 BIP이 혼성화되어 연장된다. 도 1의 (iii) 및 도 1의 (iv)에서 역방향 루프프라이머(LB) 및 정방향 루프프라이머(LF)는 각각 생성된 덤벨 모양의 DNA 산물의 루프 부위(구체적으로, B1 및 B2 사이의 루프 또는 F1 및 F2 사이의 루프)에 혼성화하여 새로운 DNA 산물의 생성(즉, 증폭)을 가속화한다.
가속 프라이머인 LB 또는 LF 프라이머는 상술한 덤벨 구조의 단일 가닥 부위에 결합하며, 구체적으로, B1 및 B2 사이의 루프 또는 F1 및 F2 사이의 루프에 결합한다. LB 또는 LF 프라이머를 사용하며 DNA 합성이 시작되는 origin이 증가하여 결국 반응 속도가 빨라지는 효과를 가져온다. LAMP 반응에서는 그 과정에서 통상 6개의 루프가 형성되며, 두 개의 루프만이 합성 기원으로 사용되나, LB 및 LF 프라이머를 사용하는 경우에는 6개의 모든 루프가 합성 기원으로 사용되어, 소정의 시간 동안 합성되는 DNA 양이 증가하게 된다.
각 F3 프라이머, B3 프라이머, FIP 프라이머, BIP 프라이머, 루프 F 프라이머 (LF), 및 루프 B (LB)프라이머의 특징 및 기능에 대한 보다 상세한 설명은 문헌 Notomi et al(T. Notomi, H. Okayama, H. Masubuchi, T. Yonekawa, K. Watanabe, N. Amino and T. Hase, Nucleic Acids Res., 2000, 28, E63) 및 Nagamine et al(K. Nagamine, T. Hase and T. Notomi, Mol. Cell. Probes, 2002, 16, 223-229)을 참조할 수 있다.
본 개시의 태그된 루프프라이머를 포함하여, LAMP에 사용되는 프라이머들의 적합한 길이는 다수의 요소, 예컨대, 온도, 응용분야, 프라이머의 소스(source) 및 최종 증폭 산물의 길이 등을 고려하여 결정될 수 있다. 예컨대, 프라이머의 길이는 최소 8 뉴클레오타이드, 9 뉴클레오타이드, 10 뉴클레오타이드, 15 뉴클레오타이드, 20 뉴클레오타이드, 25 뉴클레오타이드 또는 30 뉴클레오타이드일 수 있다. 구체적으로, F3와 B3의 경우 최소 8 뉴클레오타이드, 9 뉴클레오타이드, 10 뉴클레오타이드, 11 뉴클레오타이드, 12 뉴클레오타이드, 13 뉴클레오타이드, 14 뉴클레오타이드 또는 15 뉴클레오타이드일 수 있고, FIP와 BIP의 경우 최소 25 뉴클레오타이드, 26 뉴클레오타이드, 27 뉴클레오타이드, 28 뉴클레오타이드, 29 뉴클레오타이드 또는 30 뉴클레오타이드일 수 있으며, 종래 태그되지 않은 LF와 LB의 경우 최소 11 뉴클레오타이드, 12 뉴클레오타이드, 13 뉴클레오타이드, 14 뉴클레오타이드 또는 15 뉴클레오타이드일 수 있으나, 이에 한정되는 것은 아니다.
일 구현예에 따르면, 상기 프라이머 세트는 LAMP 반응의 특징 및 프라이머의 특징을 고려하여, 시중의 프라이머 디자인 소프트웨어, 예컨대, Primer Explorer V5 (Fujitsu, Japan), LAVA (LAMP Assay Versatile Analysis) 및 LAMP Designer (PREMIER Biosoft)와 같은 다양한 디자인 소프트웨어를 사용하여 디자인될 수 있다.
본 명세서에서 사용되는 용어 "핵산", "핵산 서열" 또는 "핵산 분자"는 단일-가닥 형태 또는 이중-가닥 형태의 디옥시리보뉴클레오타이드 또는 리보뉴클레오타이드 폴리머를 의미하며, 상기 뉴클레오타이드는 자연(naturally occurring) 뉴클레오타이드와 동일한 방식으로 기능(function)할 수 있는 자연 뉴클레오타이드의 유도체, 비-자연 뉴클레오타이드 또는 변형 뉴클레오타이드를 포함할 수 있다.
본 명세서에서 사용되는 용어 "타겟 핵산", "타겟 핵산 서열" 또는 "타겟 서열"은 검출하고자 하는 핵산 서열을 의미한다. 상기 타겟 핵산 서열은 본 개시의 루프 매개 등온 증폭 반응용 태그된 루프프라이머와 혼성화될 수 있다. 보다 구체적으로, 본 개시의 타겟 핵산에 있어서의, 핵산의 종류로서는 데옥시리보뉴클레오티드(DNA), 리보뉴클레오티드(RNA) 및 이들 혼합물 또는 결합물이어도 된다. 또 그 구성 염기는 천연에 존재하는 뉴클레오티드, 예를 들어 구아닌(G), 아데닌(A), 티민(T), 사이토신(C), 우라실(U) 이지만, 그 이외의 천연 및 인공의 수식 염기를 함유하고 있어도 된다. 여기서 "수식 염기"란, 상기 5 개의 뉴클레오티드가 화학적 수식을 받은 염기를 의미한다. 구체적으로 예를 들면, 메틸시티딘, 슈도우리딘, 4-티오우리딘, 디하이드로우리딘, 큐오신, 히포크산틴(이노신(I)) 등이 이것에 해당되나, 이에 한정되지는 않는다. 본 개시에 있어서 타겟 핵산은, 검출할 때에는 단일 가닥 사슬일 필요가 있지만, 이중 가닥 사슬이나 고차 구조를 형성하고 있는 핵산이어도 열 변성, 알칼리 변성 처리 등에 의해 단일 가닥 사슬로 변환하고 나서 사용할 수 있다. 본 개시의 타겟 핵산에는 이러한 변성 처리를 부가한 양태도 포함된다. 또한, 이중 가닥 사슬에 대하여, 가닥 치환 활성(strand-displacement activity)을 가지는 효소 또는 헬리카제(helicase)와 같은 효소를 이용하는 효소적 반응에 의해 이중 가닥 구조의 타겟 핵산을 단일 가닥으로 해리시킬 수 있다. 예컨대, (i) 가닥 치환(strand displacement) 활성을 가지고, (ii) 반응 산물인 중합체가 고리구조를 형성할 수 있는 열역학적 활동성이 유지되는 온도 (예컨대, 50℃ 내지 75℃ 사이)에서 중합반응을 일으킬 수 있는 두 가지 주요 요건을 만족하는 가닥 치환 활성이 높은 특수한 DNA 중합효소, 예컨대 Bacillus stearothermophilus(Bst) DNA 중합효소, Thermus thermophilus(Tth) DNA 중합효소, Thermus aquaticus(Taq) DNA 중합효소, Thermococcus litoralis DNA 중합효소; 및 Bacillus caldotenax DNA 중합효소를 사용하는 경우, 진행방향에 있는 이중 가닥 DNA를 해리시키면서 연장 반응을 진행할 수 있는 바, 타겟 핵산은 단일 가닥 서열로 한정되지 않는다. 또한 RNA를 주형으로 한 역전사 반응에 의해 제조되는 cDNA 도 "타겟 핵산"에 포함된다.
일 구현예에 있어서, 타겟 핵산은 인간, 동물, 식물 또는 미생물의 핵산일 수 있다. 미생물은 진균(Fungi), 원생동물 (protozoa), 세균 (bacteria), 바이러스 (virus) 또는 조류 (Algae) 등 일 수 있다.
일 구현예에 있어서, 타겟 핵산은 바이러스 핵산일 수 있으며, 구체적으로, 상기 타겟 핵산은 RNA 바이러스 핵산일 수 있다.
일 구현예에 있어서, 타겟 핵산은 호흡기 바이러스 핵산일 수 있다. 예컨대, 인플루엔자 바이러스 핵산, 호흡기 세포융합 바이러스(respiratory syncytial virus; RSV) 핵산, 아데노바이러스 핵산, 엔테로바이러스 핵산, 파라인플루엔자 바이러스(parainfluenza virus) 핵산, 메타뉴모바이러스(metapneumovirus; MPV) 핵산, 보카바이러스 핵산, 라이노바이러스 핵산 및/또는 코로나바이러스 핵산 등일 수 있으나, 이에 한정되는 것은 아니다. 보다 더 구체적으로 상기 타겟 핵산은 SARS-CoV-2의 핵산일 수 있다.
일 구현예에 있어서, 상기 SARS-CoV-2의 핵산은 E 유전자, N 유전자, RdRP 유전자, S 유전자 및 이들의 조합으로 구성된 군으로부터 선택되는 것일 수 있다.
일 구현예에 따르면, 타겟 핵산이 RNA인 경우, 상기 등온 증폭 반응은 역전사 반응 단계를 포함할 수 있다. 이의 상세한 내용은 Joseph Sambrook, 등, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.(2001); 및 Noonan, K. F. 등, Nucleic Acids Res. 16:10366 (1988)에 개시되어 있다.
역전사 반응(Reverse Transcription)은 역전사 효소를 이용한 역전사 반응에 의해 RNA로부터 cDNA를 합성하는 반응이다. 역전사 반응은 LAMP 반응과 동일한 튜브 내에서 실시하는 방법(one step 반응)에 의할 수 있고, 별도의 역전사 반응을 통해 cDNA를 먼저 생성한 다음 이를 이용하여 LAMP 반응 단계에 이용(two step 반응)할 수도 있다. 원스텝 반응의 경우, 처리량이 많거나, 신속한 검출을 요하는 경우 효과적으로 사용될 수 있다. 또한, 더욱 정밀한 분석을 요하는 경우, 투스텝 반응을 바람직하게 사용할 수 있다.
본 명세서에서 용어 "역전사 효소"는 RNA-의존적 DNA 중합효소라고도 불리며, RNA를 주형으로 하고 여기에 상보적 DNA를 합성하는 효소를 의미한다.
일 구현예에서 역전사 효소는 다양한 소스로부터 기원한 역전사 효소를 사용할 수 있으며, 예를 들어, 조류 골수아세포증바이러스-유래 역전사 효소(Avian Myeloblastosis Virus-derived Reverse Transcriptase; AMV RTase), 쥐류 백혈병 바이러스-유래 역전사 효소(Murine Leukemia Virus-derived Reverse Transcriptase; MuLV RTase) 및 라우스-관련 바이러스 2 역전사효소 (Rous-Associated Virus 2 Reverse Transcriptase; RAV-2 RTase)를 사용할 수 있으나, 이에 한정되지 않는다.
역전사 효소는 RNA 주형으로부터 cDNA를 합성하기 위하여 프라이머(primer)를 필요로 한다. 역전사 반응에서 사용되는 프라이머는 크게 세 종류의 프라이머가 있다: (i) mRNA의 poly A tail에 어닐링되어 3’말단에서부터 cDNA를 합성하는 oligo dT 프라이머, (ii) 6~9nt 크기의 무작위 뉴클레오타이드로 만들어져 RNA 모든 영역에서 합성을 시작하는 랜덤 프라이머(random primer) 및 (iii) 타겟 cDNA만을 합성하는 타겟 특이적 프라이머(target specific primer)이다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 5’-태깅 부위는, 타겟 핵산이 부존재하는 경우, 공간적으로 폴딩된 구조를 형성함으로써 상기 리포터 분자 및 퀀처 분자가 서로 근접된다 (도 2의 (b) 참조). 리포터 분자 및 퀀처 분자가 서로 근접하는 경우, 퀀칭 효과가 발생하고, 리포터 분자에 의한 시그널링 효과가 발생하지 않는다. 종래 LAMP 반응에서 타겟 핵산의 실시간 모니터링을 위해 이용되는 동화 프로브(assimilating probe)의 경우, 두 개의 올리고뉴클레오타이드 가닥을 포함하고, 상기 두 개의 올리고뉴클레오타이드가 각각 리포터 분자 또는 퀀처 분자를 포함하며, 상기 두 개의 올리고뉴클레오타이드가 상보적 결합을 형성함으로써 퀀칭 효과가 발생하는 원리를 이용한다. 그리고 본 개시의 경우, 종래의 동화 프로브와 달리 상호작용적 이중 표지 시스템을 포함하는 단일 가닥의 루프프라이머를 사용한다는 점에서 차별화된다. 종래 동화 프로브의 경우, 핵산 증폭을 위한 LAMP 반응 이전에 두 개의 프로브를 고온에서부터 저온으로 천천히 온도를 감소시켜 한쌍의 프로브로 합성하는 과정이 필요하다. 또한, 2개의 올리고뉴클레오타이드 한 쌍으로 이루어진 프로브 디자인의 경우, 등온 증폭 반응 온도에서도 상기 2개의 올리고뉴클레오타이드가 혼성화된 상태로 유지될 수 있도록, 두 가닥의 올리고뉴클레오타이드의 결합이 단일 가닥으로 변성되는 온도를 고려한 뉴클레오타이드 간 전체 결합 갯수, 아데닌-구아닌, 티민-시토신 결합의 종류 및 비율 등 고려해야할 요소들이 많아지는 문제가 발생한다. 또한, 종래 동화 프로브의 경우, 상술한 수많은 요소들을 고려하여 디자인되었다 할지라도 리포터 분자 또는 퀀처 분자를 포함하는 두 가닥의 올리고뉴클레오타이드의 상보성 결합이 일부 붕괴될 가능성이 있어, 이로 인한 타겟 핵산 특이적이지 않은 신호가 발생할 수 있는 가능성이 있다. 또한, 프로브 제조를 위한 2개의 올리고뉴클레오타이드를 디자인해야 하는 번거로움이 있다. 그러나 본 개시에 따른 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머의 경우, 종래의 동화 프로브의 상술한 단점을 해결해 줄 수 있다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 5’-태깅 부위는, 타겟 핵산이 존재하는 경우, 공간적으로 언폴딩된 구조를 형성함으로써, 상기 리포터 분자 및 퀀처 분자가 서로 이격되어 언퀀칭된다(도 3 (a)의 (iii) 참조). 이는 본 개시의 태그된 루프프라이머가 종래 동화 프로브와 가장 차별화 되는 점으로서, 본 개시의 태그된 루프프라이머는 타겟 핵산에 비특이적인 시그널링 발생을 최소화할 수 있다.
일 구현예에 있어서, 본 개시에서 사용되는 리포터 분자 및 퀀처 분자는 이들 사이에 에너지가 비-방사능적(non-radioactively)으로 전달되는 상호작용적 이중 표지 시스템을 구성한다.
상기 상호작용적 이중 표지 시스템의 대표적 예로서, FRET(fluorescence resonance energy transfer) 표지 시스템은 형광 리포터 분자(공여체 분자) 및 퀀처 분자(수용체 분자)를 포함한다. FRET에서 에너지 공여체는 형광성이나, 에너지 수용체는 형광성 또는 비-형광성일 수 있다. 시그널 발생 시스템의 다른 형태에서, 에너지 공여체는 비-형광성, 예컨대, 크로모포어(chromophore)이고 에너지 수용체는 형광성이다. 상호작용적 이중 표지 시스템의 또 다른 형태에서, 에너지 공여체는 발광성(luminescent), 예컨대, 생물발광성, 화학발광성 또는 전기화학발광성이며 수용체는 형광성이다.
상호작용적 이중 표지는 접촉-매개 퀀칭(contact-mediated quenching)에 기반하여 검출 가능한 시그널을 제공하는 표지 쌍을 포함한다(Salvatore et al., Nucleic Acids Research, 2002 (30) no.21 e122 and Johansson et al., J. AM. CHEM. SOC 2002 (124) pp 6950-6956). 상기 상호작용적 표지 시스템은 최소 2개 분자(예를 들어, 염료) 간의 상호작용에 의한 시그널 변화를 포함하는 모든 또는 어떠한 케이스를 포함한다.
단일 표지 또는 이중 표지로 유용한 리포터 분자 및 퀀처 분자는 당업계에 알려진 어떠한 분자도 포함할 수 있다. 그 예로는 다음과 같다: Cy2TM (506), YO-PROTM-1 (509), YOYOTM-1 (509), Calcein (517), FITC (518), FluorXTM (519), AlexaTM (520), Rhodamine 110 (520), Oregon GreenTM 500 (522), Oregon GreenTM 488 (524), RiboGreenTM (525), Rhodamine GreenTM (527), Rhodamine 123 (529), TO-PROTM-1 (533), TOTO1 (533), JOE (548), BODIPY530/550 (550), Dil (565), BODIPY TMR (568), BODIPY558/568 (568), BODIPY564/570 (570), Cy3TM (570), AlexaTM 546 (570), TRITC (572), Phycoerythrin R&B (575), Rhodamine Phalloidin (575), (576), Pyronin Y (580), Rhodamine B (580), TAMRA (582), Rhodamine RedTM (590), Cy3.5TM (596), ROX (608), AlexaTM 594 (615), Texas Red (615), Nile Red (628), YO-PROTM-3 (631), YOYOTM-3 (631), R-phycocyanin (642), C-Phycocyanin (648), TO-PROTM-3 (660), TOTO3 (660), DiD DilC(5) (665), Cy5TM (670), Thiadicarbocyanine (671), Cy5.5 (694), HEX (556), TET (536), Biosearch Blue (447), CAL Fluor Gold 540 (544), CAL Fluor Orange 560 (559), CAL Fluor Red 590 (591), CAL Fluor Red 610 (610), CAL Fluor Red 635 (637), FAM (520), Fluorescein (520), Fluorescein-C3 (520), Pulsar 650 (566), Quasar 570 (667), Quasar 670 (705) 및 Quasar 705 (610). 괄호의 숫자는 나노미터 단위로 표시한 최대 발광 파장이다.
적합한 리포터-퀀처 쌍은 다음과 같이 많은 문헌에 개시되어 있다: Pesce 등, editors, Fluorescence Spectroscopy (Marcel Dekker, New York, 1971); White 등, Fluorescence Analysis: A Practical Approach (Marcel Dekker, New York, 1970); Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Color AND Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992); Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); Haugland, R. P., Handbook of Fluorescent Probes and Research Chemicals, 6th Edition (Molecular Probes, Eugene, Oreg., 1996) 미국 특허 번호 제3,996,345호 및 제4,351,760호.
리포터 분자 및 퀀처 분자는 각각 형광성일 수 있다. 또한, 리포터 분자는 형광성이나 퀀처 분자는 비-형광성일 수 있다. 예를 들어, 광범위 파장 또는 특정 파장의 형광을 퀀칭 할 수 있는 비-형광성 다크 퀀처를 본 개시에서 이용할 수 있다. 퀀처 분자가 형광성일 경우, 형광성 퀀처 분자의 시그널 변화로부터 타겟 핵산서열을 검출할 수 있다.
리포터 분자 및 퀀처 분자는 종래 방법들에 따라 올리고뉴클레오타이드에 연결될 수 있다. 예를 들어, 리포터 분자 및 퀀처 분자는 최소 3 개의 탄소 원자를 포함하는 스페이서(예컨대, 3-탄소 스페이서, 6-탄소 스페이서, 9-탄소 스페이서 또는 12-탄소 스페이서)를 통해 프로브에 연결될 수 있다.
본 명세서에서 사용되는 표현 "공간적으로 폴딩된 구조를 형성"은 리포터 분자 및 퀀처 분자가 결합된 5’-태깅 부위가 일정한 방향성을 갖는 직선형 또는 이중가닥 핵산 특유의 나선 형태로 3차원 공간 상에 배열된 것이 아닌, 구조적으로(conformationally) 랜덤하게 폴딩되어 있는 형상, 구체적으로 예를 들면 랜덤 코일(random coil)과 같은 폴딩된 구조를 갖는 것을 의미한다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 5’-태깅 부위는, 타겟 핵산이 부존재하는 경우, 상기 리포터 분자 및 퀀처 분자가 근접하도록 헤어핀 구조를 형성할 수 있다(도 2의 (c) 참조).
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 5’-태깅 부위는, 타겟 핵산이 존재하는 경우, 상기 헤어핀 구조가 붕괴됨으로써, 상기 리포터 분자 및 퀀처 분자가 서로 이격되어 언퀀칭된다(도 3 (b)의 (iii) 참조).
본 명세서 상의 용어 "헤어핀 구조"는 "스템-루프 구조"와 동일한 의미를 가지며, 핵산 단일 가닥 내부의 상보적인 결합이 형성되는 구조를 의미한다. 헤어핀 구조가 형성되면, 원거리에 이격된 핵산 간의 거리를 좁히는 결과를 낳게 된다.
상술한 바와 같이, 본 개시에 따른 태그된 루프프라이머는 5’-태깅 부위에 리포터 분자 및 퀀처 분자를 모두 포함하며, 타겟 핵산의 부존재시 공간적으로 폴딩된 구조 또는 헤어핀 구조 형성을 통해 리포터 분자 및 퀀처 분자가 근접하게 되어 퀀칭 효과가 발생하게 된다. 보다 더 바람직하게 5’-태깅 부위는 헤어핀 구조를 형성하는 방식 보다 공간적으로 폴딩된 구조, 예컨대 랜덤 코일을 형성함으로써 퀀칭이 발생하는 방식이 더욱 두드러진 이점을 갖는다. 종래 동화 프로브의 경우, 이중 가닥을 형성하고 있는 두 개의 핵산 가닥의 결합이 등온 증폭 반응 온도에 의존적이며, 등온 증폭 반응 온도에서 100% 혼성화되지 않고, 일부 붕괴되어 단일 가닥으로 변성될 가능성이 있으며, 이로 인해 언퀀칭되어 신호를 발생하게 되는 바, 타겟 핵산에 특이적이지 않은 이중 가닥의 결합 붕괴 발생 가능성을 내포하게 되고, 일정 부분의 바이어스가 발생할 수 있다는 부분을 상술한 바 있다. 본 개시의 일 구현예에 따른, 스템-루프 구조를 형성하는 방식의 경우, 스템 내의 결합이 붕괴(disrupt)되는 경우라도, 상보 서열이 단일 가닥내 존재하여 일정 거리상에 고정되는 바, 스템 구조의 재형성이 용이하고, 동화 프로브에 비해 바이어스 발생 가능성이 크게 낮아지는 효과가 발생한다.
또한, 스템-루프 구조를 형성하는 방식에 비해 본 개시의 다른 일 구현예에 따른 공간적으로 폴딩된 구조, 예컨대 랜덤 코일을 형성하는 방식의 경우, 이중 가닥의 결합 붕괴에 의해 신호가 발생하는 방식에 의하는 것이 아닌 바, 동화프로브 또는 스템-루프 구조에서 발생할 수 있는 바이어스의 문제가 없다.
본 개시의 태그된 루프프라이머는 특정 길이가 요구되지는 않는다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머는 15-150 뉴클레오타이드, 15-140 뉴클레오타이드, 15-130 뉴클레오타이드, 15-120 뉴클레오타이드, 15-110 뉴클레오타이드, 15-100 뉴클레오타이드, 15-90 뉴클레오타이드, 15-80 뉴클레오타이드, 15-70 뉴클레오타이드, 15-60 뉴클레오타이드, 15-50 뉴클레오타이드, 15-40 뉴클레오타이드, 20-150 뉴클레오타이드, 20-140 뉴클레오타이드, 20-130 뉴클레오타이드, 20-120 뉴클레오타이드, 20-110 뉴클레오타이드, 20-100 뉴클레오타이드, 20-90 뉴클레오타이드, 20-80 뉴클레오타이드, 20-70 뉴클레오타이드, 20-60 뉴클레오타이드, 20-50 뉴클레오타이드, 20-40 뉴클레오타이드, 30-150 뉴클레오타이드, 30-140 뉴클레오타이드, 30-130 뉴클레오타이드, 30-120 뉴클레오타이드, 30-110 뉴클레오타이드, 30-100 뉴클레오타이드, 30-90 뉴클레오타이드, 30-80 뉴클레오타이드, 30-70 뉴클레오타이드, 30-60 뉴클레오타이드, 30-50 뉴클레오타이드, 30-40 뉴클레오타이드, 35-100 뉴클레오타이드, 35-90 뉴클레오타이드, 35-80 뉴클레오타이드, 35-70 뉴클레오타이드, 35-60 뉴클레오타이드 또는 35-50 뉴클레오타이드의 길이를 가질 수 있다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 3’-타겟팅 부위는 루프 매개 등온 증폭(LAMP) 반응 조건 하에 타겟 핵산에 대해 특이적으로 혼성화되기에 충분한 길이를 갖는다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 3’-타겟팅 부위는 10-100 뉴클레오타이드, 10-90 뉴클레오타이드, 10-80 뉴클레오타이드, 10-70 뉴클레오타이드, 10-60 뉴클레오타이드, 10-50 뉴클레오타이드, 10-40 뉴클레오타이드, 10-30 뉴클레오타이드, 10-20 뉴클레오타이드, 12-100 뉴클레오타이드, 12-90 뉴클레오타이드, 12-80 뉴클레오타이드, 12-70 뉴클레오타이드, 12-60 뉴클레오타이드, 12-50 뉴클레오타이드, 12-40 뉴클레오타이드, 12-30 뉴클레오타이드, 12-20 뉴클레오타이드, 15-100 뉴클레오타이드, 15-90 뉴클레오타이드, 15-80 뉴클레오타이드, 15-70 뉴클레오타이드, 15-60 뉴클레오타이드, 15-50 뉴클레오타이드, 15-40 뉴클레오타이드, 15-30 뉴클레오타이드 또는 15-20 뉴클레오타이드의 길이를 갖는다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 3’-타겟팅 부위는 40℃ 내지 70℃의 Tm 값을 가질 수 있으며, 구체적으로, 45℃ 내지 70℃, 50℃ 내지 70℃, 55℃ 내지 70℃, 60℃ 내지 70℃, 40℃ 내지 65℃, 45℃ 내지 65℃, 50℃ 내지 65℃, 55℃ 내지 65℃ 또는 60℃ 내지 65℃의 Tm 값을 가질 수 있지만, 이에 한정되지는 않는다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 5’-태깅 부위는 상기 퀀처 분자가 상기 리포터 분자로부터 시그널을 언퀀칭하도록 상기 리포터 분자와 상기 퀀처 분자가 서로 이격될 수 있는 정도의 뉴클레오타이드 길이를 가진다.
일 구현예에 있어서, 본 개시의 태그된 루프프라이머의 5’-태깅 부위는 최소 5 뉴클레오타이드, 구체적으로는 최소 10 뉴클레오타이드의 길이를 갖는다. 보다 구체적으로 상기 5’-태깅 부위는 5-50 뉴클레오타이드, 5-45 뉴클레오타이드, 5-40 뉴클레오타이드, 5-35 뉴클레오타이드, 5-30 뉴클레오타이드, 5-25 뉴클레오타이드, 5-24 뉴클레오타이드, 5-23 뉴클레오타이드, 5-22 뉴클레오타이드, 5-21 뉴클레오타이드, 5-20 뉴클레오타이드, 8-50 뉴클레오타이드, 8-45 뉴클레오타이드, 8-40 뉴클레오타이드, 8-35 뉴클레오타이드, 8-30 뉴클레오타이드, 8-25 뉴클레오타이드, 8-24 뉴클레오타이드, 8-23 뉴클레오타이드, 8-22 뉴클레오타이드, 8-21 뉴클레오타이드, 8-20 뉴클레오타이드, 10-50 뉴클레오타이드, 10-45 뉴클레오타이드, 10-40 뉴클레오타이드, 10-35 뉴클레오타이드, 10-30 뉴클레오타이드, 10-25 뉴클레오타이드, 10-24 뉴클레오타이드, 10-23 뉴클레오타이드, 10-22 뉴클레오타이드, 10-21 뉴클레오타이드, 10-20 뉴클레오타이드, 12-50 뉴클레오타이드, 12-45 뉴클레오타이드, 12-40 뉴클레오타이드, 12-35 뉴클레오타이드, 12-30 뉴클레오타이드, 12-25 뉴클레오타이드, 12-24 뉴클레오타이드, 12-23 뉴클레오타이드, 12-22 뉴클레오타이드, 12-21 뉴클레오타이드, 12-20 뉴클레오타이드, 14-50 뉴클레오타이드, 14-45 뉴클레오타이드, 14-40 뉴클레오타이드, 14-35 뉴클레오타이드, 14-30 뉴클레오타이드, 14-25 뉴클레오타이드, 14-24 뉴클레오타이드, 14-23 뉴클레오타이드, 14-22 뉴클레오타이드, 14-21 뉴클레오타이드, 14-20 뉴클레오타이드, 15-50 뉴클레오타이드, 15-45 뉴클레오타이드, 15-40 뉴클레오타이드, 15-35 뉴클레오타이드, 15-30 뉴클레오타이드, 15-25 뉴클레오타이드, 15-24 뉴클레오타이드, 15-23 뉴클레오타이드, 15-22 뉴클레오타이드, 15-21 뉴클레오타이드, 15-20 뉴클레오타이드, 16-50 뉴클레오타이드, 16-45 뉴클레오타이드, 16-40 뉴클레오타이드, 16-35 뉴클레오타이드, 16-30 뉴클레오타이드, 16-25 뉴클레오타이드, 16-24 뉴클레오타이드, 16-23 뉴클레오타이드, 16-22 뉴클레오타이드, 16-21 뉴클레오타이드, 또는 16-20 뉴클레오타이드의 길이를 가질 수 있다.
일 구현예에 있어서, 리포터 분자 및 퀀처 분자 중 어느 하나는 본 발명의 5’-태깅 부위의 5’-말단 또는 5’-말단으로부터 1-5 뉴클레오타이드 이격된 위치에 있고, 나머지 하나는 단편의 형태(conformation)에 따라 리포터 분자로부터의 시그널을 퀀칭 또는 언퀀칭하는 위치에 위치한다. 보다 구체적으로, 5’-태깅 부위가 일반적인 조건에서 존재하는 폴딩된 형태(conformation)를 갖는 경우, 리포터 분자 및 퀀처 분자의 거리가 가까워지게 되고, 퀀칭 효과가 나타나지만, 5’-태깅 부위에 이중 가닥이 형성되어 언폴딩되는 경우, 리포터 분자 및 퀀처 분자의 거리가 멀어져 언퀸칭될 수 있는 거리만큼 리포터 분자 및 퀀처 분자가 이격되어 5‘-태깅 부위에 결합되어 있는 것을 의미한다.
일 구현예에 있어서, 리포터 분자 및 퀀처 분자 중 어느 하나는 상기 5’-태깅 부위의 5’-말단에 결합되고, 다른 하나는 5‘-태깅 부위에 존재하는 인터널 디옥시티미딘(internal deoxythymidine; dT)에 결합된다. 상술한 바와 같이, 상기 인터널 dT는 단편의 형태에 따라 리포터 분자로부터의 시그널을 퀀칭 또는 언퀀칭하기에 충분한 거리만큼 5’-태깅 부위의 5‘-말단과 이격되어 있는 인터널 dT를 의미한다.
리포터 분자 및 퀀처 분자 중 어느 것이라도 5’-태깅 부위의 5’-말단 또는 5’-말단으로부터 1-5 뉴클레오타이드 이격된 위치에 결합될 수 있으며, 어느 것이 결합되더라도 발명의 효과가 도출되는데 유의한 영향을 미치지 않는다.
본 명세서에 사용된 용어 “말단”은 마지막 뉴클레오타이드를 지칭하며, 예를 들어 5‘-말단은 서열 내의 5’ 방향으로 마지막 뉴클레오타이드를 지칭하고, 3‘-말단은 서열 내의 3’ 방향으로 마지막 뉴클레오타이드를 지칭한다.
또한, 본 명세서에 사용된 용어 “말단 부위”는 서열 내의 마지막 뉴클레오타이드 및 그와 인접한 수 개 또는 수십 개의 뉴클레오타이드를 포함하는 부위를 지칭한다.
일 구현예에 있어서, 리포터 분자 및 퀀처 분자는 서로 최대 50 뉴클레오타이드만큼 이격된 위치에 위치하며, 더욱 구체적으로 예를 들면, 최대 45 뉴클레오타이드, 최대 40 뉴클레오타이드, 최대 35 뉴클레오타이드, 최대 30 뉴클레오타이드, 또는 최대 25 뉴클레오타이드만큼 이격된 위치에 위치한다. 바람직한 구현예에 따르면, 리포터 분자 및 퀀처 분자는 최소 4 뉴클레오타이드만큼 이격된 위치에 위치하며, 구체적으로, 최소 5 뉴클레오타이드, 최소 6 뉴클레오타이드, 최소 7 뉴클레오타이드, 최소 8 뉴클레오타이드, 최소 9 뉴클레오타이드, 보다 구체적으로, 최소 10 뉴클레오타이드, 최소 11 뉴클레오타이드, 최소 12 뉴클레오타이드, 최소 13 뉴클레오타이드, 최소 14 뉴클레오타이드, 최소 15 뉴클레오타이드만큼 이격된 위치에 위치한다.
일 구현예에 있어서, 리포터 분자 및 퀀처 분자는 서로 5-45 뉴클레오타이드, 5-40 뉴클레오타이드, 5-35 뉴클레오타이드, 5-30 뉴클레오타이드, 5-25 뉴클레오타이드, 5-24 뉴클레오타이드, 5-23 뉴클레오타이드, 5-22 뉴클레오타이드, 5-21 뉴클레오타이드, 5-20 뉴클레오타이드, 8-45 뉴클레오타이드, 8-40 뉴클레오타이드, 8-35 뉴클레오타이드, 8-30 뉴클레오타이드, 8-25 뉴클레오타이드, 8-24 뉴클레오타이드, 8-23 뉴클레오타이드, 8-22 뉴클레오타이드, 8-21 뉴클레오타이드, 8-20 뉴클레오타이드, 10-45 뉴클레오타이드, 10-40 뉴클레오타이드, 10-35 뉴클레오타이드, 10-30 뉴클레오타이드, 10-25 뉴클레오타이드, 10-24 뉴클레오타이드, 10-23 뉴클레오타이드, 10-22 뉴클레오타이드, 10-21 뉴클레오타이드, 10-20 뉴클레오타이드, 12-45 뉴클레오타이드, 12-40 뉴클레오타이드, 12-35 뉴클레오타이드, 12-30 뉴클레오타이드, 12-25 뉴클레오타이드, 12-24 뉴클레오타이드, 12-23 뉴클레오타이드, 12-22 뉴클레오타이드, 12-21 뉴클레오타이드, 12-20 뉴클레오타이드, 14-45 뉴클레오타이드, 14-40 뉴클레오타이드, 14-35 뉴클레오타이드, 14-30 뉴클레오타이드, 14-25 뉴클레오타이드, 14-24 뉴클레오타이드, 14-23 뉴클레오타이드, 14-22 뉴클레오타이드, 14-21 뉴클레오타이드, 14-20 뉴클레오타이드, 15-45 뉴클레오타이드, 15-40 뉴클레오타이드, 15-35 뉴클레오타이드, 15-30 뉴클레오타이드, 15-25 뉴클레오타이드, 15-24 뉴클레오타이드, 15-23 뉴클레오타이드, 15-22 뉴클레오타이드, 15-21 뉴클레오타이드, 또는 15-20 뉴클레오타이드만큼 이격된 위치에 위치한다.
다른 양태에 따르면, 본 개시는 상술한 태그된 루프프라이머를 하나 이상 사용하여 루프 매개 등온 증폭(LAMP) 반응을 수행하는 단계를 포함하는 타겟 핵산 검출 방법을 제공한다.
태그된 루프프라이머의 경우, 도 3에 나타낸 바와 같이, 정방향 태그된 루프프라이머(태그된 LF) 및 역방향 태그된 루프프라이머(태그된 LB) 중 하나 이상을 사용할 수 있고, 바람직하게 태그된 LF 및 태그된 LB를 모두 사용할 수 있으며, 타겟 핵산이 둘 이상인 경우, 각각의 타겟 핵산에 적합한 태그된 LF 및 태그된 LB 중 하나 이상을 추가로 사용함으로써 둘 이상의 타겟 핵산을 동시에 검출하는 것이 가능하다.
일 구현예에 있어서, 본 개시의 방법은 하나의 타겟 핵산의 검출 또는 둘 이상의 타겟 핵산의 동시 검출을 위한 것이다. 본 개시의 방법이 둘 이상의 타겟 핵산의 동시 검출을 위해 적용되는 경우, 각각의 타겟에 적합한, 프라이머 세트들을 모두 포함하여야 한다. 일 구현예에서의 프라이머 세트는 LAMP 반응을 위해서 필수적인 4종의 프라이머(F3, B3, FIP, BIP) 및 본 개시의 태그된 루프프라이머 1종 이상(태그된 LF 및 태그된 LB 중 하나 이상)을 의미하고, 상술한 프라이머 세트는 각각의 타겟 핵산에 대해 각각 준비되어야 한다. 또한, 반응 속도 향상을 위해 종래 일반적으로 사용되어오던 태그되지 않은 2종의 루프프라이머(LF 및 LB) 중 1종 이상을 추가적으로 포함할 수 있다.
일 구현예에 있어서, 본 개시의 방법의 등온 온도 조건은 50℃ 내지 75℃로부터 선택된 어느 하나의 온도이며, 구체적으로, 50℃ 내지 70℃로부터 선택된 어느 하나의 온도, 50℃ 내지 65℃로부터 선택된 어느 하나의 온도, 55℃ 내지 75℃로부터 선택된 어느 하나의 온도, 55℃ 내지 70℃로부터 선택된 어느 하나의 온도, 55℃ 내지 65℃로부터 선택된 어느 하나의 온도, 60℃ 내지 75℃로부터 선택된 어느 하나의 온도, 60℃ 내지 70℃로부터 선택된 어느 하나의 온도 또는 60℃ 내지 65℃로부터 선택된 어느 하나의 온도이다. 특정 구현예에서, 등온 온도 조건은 60℃, 61℃ 또는 62℃이며, 보다 특정 구현예에서 62℃이지만, 이에 제한되는 것은 아니다.
일 구현예에 있어서, 본 개시의 방법은 DNA, cDNA 또는 RNA 핵산을 대상으로 수행하는 것이다.
일 구현예에 있어서, 타겟 핵산은 인간, 동물, 식물 또는 미생물의 핵산일 수 있다. 미생물은 진균(Fungi), 원생동물 (protozoa), 세균 (bacteria), 바이러스 (virus) 또는 조류 (Algae) 등 일 수 있다.
일 구현예에 있어서, 타겟 핵산은 바이러스 핵산일 수 있으며, 구체적으로, 상기 타겟 핵산은 RNA 바이러스 핵산일 수 있다.
구체적인 구현예에 있어서, 타겟 핵산은 호흡기 바이러스 핵산일 수 있다. 예컨대, 인플루엔자 바이러스 핵산, 호흡기 세포융합 바이러스(respiratory syncytial virus; RSV) 핵산, 아데노바이러스 핵산, 엔테로바이러스 핵산, 파라인플루엔자 바이러스(parainfluenza virus) 핵산, 메타뉴모바이러스(metapneumovirus; MPV) 핵산, 보카바이러스 핵산, 라이노바이러스 핵산 및/또는 코로나바이러스 핵산 등일 수 있으나, 이에 한정되는 것은 아니다. 보다 더 구체적으로 상기 타겟 핵산은 SARS-CoV-2의 핵산일 수 있다.
일 구현예에 있어서, 상기 SARS-CoV-2의 핵산은 E 유전자, N 유전자, RdRP 유전자, S 유전자 및 이들의 조합으로 구성된 군으로부터 선택되는 것이다.
일 구현예에 따르면, 타겟 핵산이 RNA인 경우, 상기 등온 증폭 반응은 역전사 반응 단계를 포함할 수 있다. 이의 상세한 내용은 전술한 바와 같다.
본 개시의 타겟 핵산 검출 방법을 이용하는 경우, RT-LAMP 반응 중 형광염료 등을 실시간으로 검출할 수 있는 핵산 검출 기기를 이용하여 별도의 전기영동(electrophoresis)이나 반응 후의 SYBR Green I 추가 없이 실시간으로 등온 증폭을 확인하고, annealing peak를 통해서 타겟 핵산의 증폭 여부를 확인할 수 있다.
일 구현예에 있어서, 본 개시의 루프 매개 등온 증폭(LAMP) 반응을 수행하는 단계는 태그된 루프프라이머 및 태그되지 않은 루프프라이머를 함께 사용하여 수행될 수 있다. 본 명세서 상의 용어 "태그되지 않은 루프프라이머"는 종래 알려진 LAMP 반응의 반응 속도를 향상시키기 위해 사용해오던 일반적인 루프프라이머 LB 및 LF를 의미한다. 태그되지 않은 루프프라이머의 경우, 본 개시의 태그된 루프프라이머와는 달리 5‘-태깅 부위를 포함하지 않는 것이 바람직하다. 본 개시의 태그된 루프프라이머와 함께 태그되지 않은 루프프라이머를 함께 사용하는 경우, LAMP 반응에 있어서의 반응 속도를 더욱 향상시킴으로써 타겟 핵산 검출의 민감도를 높이는데 도움이 된다. 태그되지 않은 루프프라이머의 경우, 종래 알려진 디자인 방법에 의해 당업자가 용이하게 설계할 수 있는 것으로 이해되며, 특별히 제한되지 않는다.
본 개시의 타겟 핵산 검출 방법은 상술한 본 개시의 다른 양태인 태그된 루프프라이머를 사용하는 것을 기술적 특징으로 하는 방법에 관한 것인 바, 중복되는 내용을 원용하며, 본 명세서 기재의 과도한 복잡성을 피하기 위해 중복 기재를 생략하도록 한다.
또 다른 양태에 따르면, 본 개시는 상술한 태그된 루프프라이머를 포함하는 루프 매개 등온 증폭(LAMP) 반응용 조성물을 제공한다.
본 개시의 루프 매개 등온 증폭 반응용 조성물은 검출 샘플의 용해물과 혼합하여 루프 매개 등온 증폭 반응을 실시하는데 사용될 수 있다.
일 구현예에 따르면, 상기 루프 매개 등온 증폭(LAMP) 반응용 조성물은 역전사 반응용 조성물을 포함할 수 있다.
일 구현예에 따르면, 상기 역전사 반응용 조성물은 역전사 중합효소 및/또는 역전사 프라이머를 포함할 수 있다.
일 구현예에 따르면, 상기 역전사 프라이머는 올리고 dT-프라이머, 랜덤 프라이머 또는 타겟 특이적 프라이머일 수 있다.
일 구현예에 따르면, 상기 역전사 프라이머는 타겟 특이적 프라이머일 수 있다.
일 구현예에 따르면, 상기 타겟 특이적 프라이머는 역전사 반응에서 cDNA를 합성하는데 이용되고, 이어서 타겟 핵산 서열 증폭 반응에서 다른 프라이머와 프라이머 쌍 또는 프라이머 세트를 이루어 상기 수득된 cDNA의 증폭용 프라이머 쌍으로 이용될 수 있다.
일 구현예에 따르면, 상기 LAMP 반응용 조성물은 역전사 효소, DNA 중합효소, dNTPs, 버퍼 및/또는 마그네슘 등을 추가적으로 포함할 수 있다.
일 구현예에 따르면, DNA 중합효소는 호열성 미생물 유래의 중합효소로서, 특히 5'->3' 엑소뉴클리아제 기능이 결여된 중합효소를 포함할 수 있다. 예컨대, Bacillus stearothermophilus(Bst) DNA 중합효소, Thermus thermophilus(Tth) DNA 중합효소, Thermus aquaticus(Taq) DNA 중합효소, Thermococcus litoralis DNA 중합효소; 및 Bacillus caldotenax DNA 중합효소를 포함할 수 있으나, 이에 한정되지 않는다.
일 구현예에 따르면, DNA 중합효소는 Bst DNA 중합효소일 수 있으나, (i) 가닥 치환(strand displacement) 활성을 가지고, (ii) 반응 산물인 중합체가 고리구조를 형성할 수 있는 열역학적 활동성이 유지되는 온도 (예컨대, 50℃ 내지 75℃ 사이)에서 중합반응을 일으킬 수 있는 두 가지 주요 요건을 만족할 경우 Bst DNA 중합효소에 한정되지 않는다. 또한, RT-LAMP 반응을 위해 기존의 LAMP 반응에서 주로 사용되어진 Bst DNA 중합효소 보다 빠른 증폭 능력과 강력한 역전사효소 활성을 가지고 있는 GspSSD DNA 중합효소 등을 사용할 수 있으나, 이에 한정되지 않는다.
일 구현예에 따르면, 상기 LAMP 반응용 조성물은 dNTPs 대신 뉴클레오타이드 유사체(analog)를 추가적으로 포함할 수 있다. 뉴클레오타이드 유사체는 변형되거나 또는 자연에서 발견되지 않는 것으로 주형 유도된 DNA 합성 과정에서 천연의 뉴클레오타이드와 함께 또는 단독으로 중합될 수 있는 것이다.
일 구현예에 따르면, 상기 버퍼는 소디움포스페이트 버퍼, 포타슘포스페이트 버퍼, Tris-HCl 버퍼 또는 Tricine 버퍼 등을 포함하나, 이에 한정되는 것은 아니다.
일 구현예에 따르면, 상기 마그네슘은 마그네슘 아세테이트, 마그네슘 클로라이드 또는 마그네슘 설페이트와 같은 염의 형태로 사용될 수 있다.
본 개시에서, 루프 매개 등온 증폭 반응용 조성물은 핵산 중합효소, 버퍼, 중합효소 보조인자 및 데옥시리보뉴클레오타이드-5-트리포스페이트와 같은 타겟 증폭 반응(예컨대, LAMP 반응)을 실시하는데 필요한 시약들을 선택적으로 포함할 수 있다. 선택적으로, 상기 LAMP 반응용 조성물은 또한 다양한 폴리뉴클레오타이드 분자, 역전사 효소, 다양한 버퍼 및 시약, 및 핵산 중합효소 활성을 억제하는 항체를 포함할 수 있다. 또한 상기 LAMP 반응용 조성물은 양성 대조군 반응을 실시하는 데 필요한 올리고뉴클레오타이드 또는 시약을 포함할 수 있다. 특정 반응에서 사용되는 시약의 최적량은 본 개시사항의 이점을 알고 있는 당업자에 의해서 용이하게 결정될 수 있다. 상기 LAMP 반응용 조성물의 구성성분들은 개별 용기 내에 존재하거나 복수의 구성성분들이 하나의 용기 내에 존재할 수 있다.
또 다른 양태에 따르면, 본 개시는 상술한 루프 매개 등온 증폭(LAMP) 조성물을 포함하는 타겟 핵산 검출용 키트를 제공한다.
본 개시의 타겟 핵산 검출용 키트는 타겟 핵산 검출에 필요한 상기 타겟 핵산 검출용 조성물 외에 상기 조성물을 보관/운반하기 위한 용기, 타겟 핵산 검출에 필요한 도구 및 기구 등을 포함할 수 있다.
이하, 실시예를 통하여 본 발명을 보다 상세히 설명하고자 한다. 이들 실시예는 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 첨부된 청구항에 제시된 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어 명백할 것이다.
실시예
실시예 : 타겟 핵산 서열의 검출
본 개시에 따른 태그된 루프프라이머를 이용하여, 단일 또는 복수의 타겟 핵산 검출이 가능한지 확인하였다.
1. 타겟 핵산의 준비
타겟 핵산으로, SARS-CoV-2의 RdRP 유전자 및/또는 N 유전자를 사용하였으며, 이를 위하여, RNA로 구성이 되어 있는 SARS-CoV-2 합성 게놈(Twist Synthetic SARS-CoV-2 RNA control 2, Twist Bioscience, Cat. No. 102024)을 주형으로 사용하였다. 106 copies/μL의 농도로 준비된 SARS-CoV-2 합성 게놈을 증류수를 이용하여 10배씩 연속 희석하여, 총 3가지 농도(농도 1: 4×103 copies/μL, 농도 2: 4×102 copies/μL, 농도 3: 4×101 copies/μL)의 SARS-CoV-2 합성 게놈을 준비하였다.
내부 대조군으로 RNase P를 사용하였으며, 이를 위하여, 세포에서 추출된 Total RNA Control (Human) (Applied Biosystems, Cat. No. 4307281)을 내부 대조군 주형으로 사용하였다. 50 ng/μL의 농도로 준비된 total RNA를 증류수를 이용하여 10배씩 연속 희석하고, 총 2가지 농도 (농도 1: 4×10-2 ng/μL, 농도 2: 4×10-3 ng/μL)의 total RNA 샘플을 준비하였다.
음성 대조군으로 증류수를 사용하였다.
2. 올리고뉴클레오타이드의 준비
각각의 타겟 핵산을 검출하기 위한, 프라이머 세트(F3, B3, FIP, BIP, LF, LB) 및 본 개시에 따른 루프프라이머를 하기 표 1과 같이 준비하였다.
올리고뉴클레오타이드의 서열
서열번호 유전자 올리고
유형		 서열 (5' to 3')
1 RdRp F3 ACTGACTTAACAAAGCCTTAC
2 RdRp B3 CACCATCAACAAATATTTTTCTCAC
3 RdRp FIP TGGGTGGTATGTCTGATCCCAATA-GGGATTTGTTAAAATATGACTTCAC
4 RdRp BIP TGTGTTAACTGTTTGGATGACAGA-GGTCCAAAACTTGTAGGTGG
5 RdRp LF ACGGTCAAAGAGTTTTAACCTCTC
6 RdRp LB TGCATTCTGCATTGTGCAAAC
7 RdRp 태그된 루프프라이머 CalRed610/CTCGCGAACGTATGCTGTGC/T(BHQ-2)/CCTCGTGGATAGGCACGGTCAAAGAGTTTTAACCTCTC
8 N F3 CAAGCTTTCGGCAGACGT
9 N B3 GGATCTTTGTCATCCAATTTGATGG
10 N FIP TGCGGCCAATGTTTGTAATCAGTTCTCCAGAACAAACCCAAGGAAAT
11 N BIP CCAGCGCTTCAGCGTTCTTCGACCTGTGTAGGTCAACCAC
12 N LF TGTCTGATTAGTTCCTGGTCCCCAA
13 N LB TCGCGCATTGGCATGGAAGT
14 N 태그된 루프프라이머 Quasar670/CGACGGATGCAACGTAGCGA/T(BHQ-2)/CATGCAACGTACGCTCGCGCATTGGCATGGAAGT
15 RNase P F3 TTCAAGGGCCCGGCTCTA
16 RNase P B3 GGCACTGGAAATTGTATACCTTCTC
17 RNase P FIP ACAGTTATGCAGACTAAATCCACATTGTTGTTGCAGTTTTTCCAAAGACA
18 RNase P BIP ACCATTTTACTTCAAAAGACCTCCTAGCAGGGCTATAGACAAGTTCA
19 RNase P LF TGTGTGCAAGCAATATGAAAAAGCT
20 RNase P LB TTGACCGAGGCCTGGCTT
21 RNase P 태그된 루프프라이머 CalOrange560AGTCGACCGTACTGTCGTAC/T(BHQ-2)/CGTCGCGCGAACGTTTGACCGAGGCCTGGCTT
3. 타겟 핵산의 검출
(1) Mono RT-LAMP
RdRP 유전자, N 유전자, RNase P 각각에 대한 Mono RT-LAMP 시약으로, F3 (서열번호 1, 서열번호 8 또는 서열번호 15) 4 pmole, B3 (서열번호 2, 서열번호 9 또는 서열번호 16) 4 pmole, FIP (서열번호 3, 서열번호 10 또는 서열번호 17) 32 pmole, BIP (서열번호 4, 서열번호 11 또는 서열번호 18) 32 pmole, LF (서열번호 5, 서열번호 12 또는 서열번호 19) 8 pmole, LB (서열번호 6, 서열번호 13 또는 서열번호 20) 8 pmole,태그된 루프프라이머 (서열번호 7, 서열번호 14 또는 서열번호 21) 8 pmole, WarmStart　 RTx Reverse Transcriptase (NEB, Cat. No. M0380L) 0.4 μL, Bst 2.0 WarmStart　 DNA polymerase (NEB, Cat. No. M0538L) 0.8 μL, 10 mM dNTP Mix 2.8 μL, 100 mM MgSO4 1.2 μL, 및 10X Isothermal Amplification Buffer (NEB, B0537S) 1 μL을 포함하여 최종 15 μL의 Mono RT-LAMP 시약을 각각 제조하였다.
상기 타겟 핵산별 제조된 각각의 Mono RT-LAMP 시약 15 μL에 상기 실시예 1에서 준비한 3가지(RNase P의 경우 2가지) 농도의 각각의 타겟 핵산 2.5 μL 및 증류수 2.5 μL를 혼합하여 최종 부피 20 μL로 반응 혼합물을 제조하였다. 상기 반응 혼합물을 함유하고 있는 튜브를 실시간 열순환기(CFX96, Bio-Rad)에 위치시켜 62℃에서 20분간 반응시켰으며, 시그널을 매 30초마다 측정하였다. Ct 값은 Auto calculated single threshold에 의해 계산되었으며, 모든 실험은 2회씩 반복 실험하였다.
상기 타겟 핵산 대신 증류수 5 μL를 넣은 반응 혼합물을 이용하여 상기와 동일한 조건으로 음성 대조군 반응도 함께 실시하였다.
그 결과, RdRp 유전자 타겟 핵산의 경우, 도 4에 나타난 바와 같이, 농도 1에서는 평균 Ct 값 15.5, 농도 2에서는 평균 Ct 값 18.2, 농도 3에서는 평균 Ct 값 25.8을 얻었으며, 음성 대조군은 2회 반복 실험 모두 미검출 되는 것을 확인하였다.
N 유전자 타겟 핵산의 경우, 도 5에 나타난 바와 같이, 농도 1에서는 평균 Ct 값 16.2, 농도 2에서는 평균 Ct 값 23.8을 얻었으며, 농도 3에서는 2회 반복 실험 중 1회에서만 Ct 값 38.18을 얻었고, 나머지 1회는 미검출되었다. 한편, 음성 대조군은 2회 반복 실험 모두에서 미검출되는 것을 확인하였다.
내부 대조군인 RNase P 유전자 타겟 핵산의 경우, 도 6에 나타난 바와 같이, 농도 1에서는 평균 Ct 값 18.4, 농도 2에서는 2회 반복 실험 중 1회에서만 Ct 값 22.83을 얻었고, 나머지 1회는 미검출되었다. 한편, 음성 대조군은 2회 반복 실험 모두에서 미검출되는 것을 확인하였다.
상술한 도 4 내지 도 6에 나타난 바와 같이, 이러한 결과는, 본 개시에 따른 태그된 루프프라이머를 이용하여 타겟 핵산을 검출할 수 있음을 의미한다.
(2) Multi RT-LAMP
RdRP 유전자, N 유전자, RNase P에 대한 Multi RT-LAMP 시약으로, 타겟 핵산별 F3 (서열번호 1, 서열번호 8 및 서열번호 15) 4 pmole, B3 (서열번호 2, 서열번호 9 및 서열번호 16) 4 pmole, FIP (서열번호 3, 서열번호 10 및 서열번호 17) 32 pmole, BIP (서열번호 4, 서열번호 11 및 서열번호 18) 32 pmole, LF (서열번호 5, 서열번호 12 및 서열번호 19) 8 pmole, LB (서열번호 6, 서열번호 13 및 서열번호 20) 8 pmole, 태그된 루프프라이머 (서열번호 7, 서열번호 14 및 서열번호 21) 8 pmole, WarmStart　 RTx Reverse Transcriptase (NEB, Cat. No. M0380L) 0.4 μL, Bst 2.0 WarmStart　 DNA polymerase (NEB, Cat. No. M0538L) 0.8 μL, 10 mM dNTP Mix 2.8 μL, 100 mM MgSO4 1.2 μL, 및 10X Isothermal Amplification Buffer (NEB, B0537S) 1 μL을 포함하여 최종 15 μL의 Multi RT-LAMP 시약을 제조하였다.
상기 제조된 Multi RT-LAMP 시약 15 μL에 상기 실시예 1에서 준비한 농도 2의 SARS-CoV-2 핵산게놈 2.5 μL (103 cp/rxn) 및 농도 1의 RNase P 타겟 핵산 2.5 μL(1 ng/rxn)를 혼합하여 최종 부피 20 μL로 반응 혼합물을 제조하였다. 상기 반응 혼합물을 함유하고 있는 튜브를 실시간 열순환기(CFX96, Bio-Rad)에 위치시켜 62℃에서 20분간 반응시켰으며, 시그널을 매 30초마다 측정하였다. Ct 값은 Auto calculated single threshold에 의해 계산되었으며, 모든 실험은 2회씩 반복 실험하였다.
상기 타겟 핵산 대신 증류수 5 μL를 넣은 반응 혼합물을 이용하여 상기와 동일한 조건으로 음성 대조군 반응도 함께 실시하였다.
그 결과, 도 7에 나타난 바와 같이, 하나의 반응 튜브에서, RdRp 유전자 타겟 핵산, N 유전자 타겟 핵산 및 내부 대조군인 RNase P 유전자 타겟 핵산이 모두 검출되는 것을 확인하였으며, 음성 대조군은 미검출되는 것을 확인하였다.
이러한 결과는, 본 개시에 따른 태그된 루프프라이머를 이용하여, 복수의 타겟 핵산을 검출할 수 있음을 의미한다.

Claims (19)

  1. 다음을 포함하는 3′ 에서 5′ 방향으로 (i) F3c, F2c, F1c, B1, B2 및 B3 또는 (ii) B3c, B2c, B1c, F1, F2 및 F3를 가지는 타겟 핵산을 검출하기 위한 태그된 루프프라이머:
    (i) 상기 타겟 핵산의 B1 및 B2 사이 또는 F1 및 F2 사이의 전체 또는 일부 서열에 상보적인 뉴클레오타이드 서열을 포함하는 3’-타겟팅 부위; 및
    (ii) 상기 타겟 핵산에 비-상보적인 뉴클레오타이드 서열을 포함하는 5’-태깅 부위;
    상기 5’-태깅 부위는 리포터 분자 및 퀀처 분자를 포함하고,
    상기 타겟 핵산이 부존재하는 경우, 상기 5’-태깅 부위의 상기 리포터 분자 및 상기 퀀처 분자는 서로 가깝게 위치하여 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 퀀칭하고,
    상기 타겟 핵산이 존재하는 경우, 상기 5’-태깅 부위의 상기 리포터 분자 및 상기 퀀처 분자는 서로 분리되어 상기 퀀처 분자가 상기 리포터 분자로부터의 시그널을 언퀀칭한다.
  2. 제1항에 있어서, 상기 타겟 핵산이 부존재하는 경우, 상기 5’-태깅 부위는 공간적으로 폴딩되는 것을 특징으로 하는 태그된 루프프라이머.
  3. 제2항에 있어서, 상기 타겟 핵산이 존재하는 경우, 상기 5’-태깅 부위는 공간적으로 언폴딩되는 것을 특징으로 하는 태그된 루프프라이머.
  4. 제1항에 있어서, 상기 타겟 핵산이 부존재하는 경우, 상기 5’-태깅 부위는 헤어핀 구조를 형성하는 것을 특징으로 하는 태그된 루프프라이머.
  5. 제4항에 있어서, 상기 타겟 핵산이 존재하는 경우, 상기 5’-태깅 부위의 헤어핀 구조는 붕괴되는 것을 특징으로 하는 태그된 루프프라이머.
  6. 제1항에 있어서, 상기 태그된 프라이머는 20 내지 150 뉴클레오타이드 길이인 것을 특징으로 하는 태그된 루프프라이머.
  7. 제1항에 있어서, 상기 LAMP 반응에서 상기 3’-타겟팅 부위는 상기 타겟 핵산에 혼성화하기에 충분한 뉴클레오타이드 길이를 가지는 것을 특징으로 하는 태그된 루프프라이머.
  8. 제7항에 있어서, 상기 3’-타겟팅 부위는 10 내지 100 뉴클레오타이드 길이인 것을 특징으로 하는 태그된 루프프라이머.
  9. 제1항에 있어서, 상기 3’-타겟팅 부위는 40°C 내지 70°C의 Tm 값을 가지는 것을 특징으로 하는 태그된 루프프라이머.
  10. 제1항에 있어서, 상기 5’-태깅 부위는 상기 퀀처 분자가 상기 리포터 분자로부터 시그널을 언퀀칭하도록 상기 리포터 분자와 상기 퀀처 분자가 서로 이격될 수 있는 정도의 뉴클레오타이드 길이를 가지는 것을 특징으로 하는 태그된 루프프라이머.
  11. 제10항에 있어서, 상기 5’-태깅 부위는 최소 10 뉴클레오타이드 길이인 것을 특징으로 하는 태그된 루프프라이머.
  12. 제1항에 있어서, 상기 리포터 분자 및 상기 퀀처 분자는 서로 최소 10 뉴클레오타이드 이격되어 있는 것을 특징으로 하는 태그된 루프프라이머.
  13. 제1항에 있어서, 상기 리포터 분자 및 퀀처 분자 중 어느 하나는 상기 5’-태깅 부위의 5’-말단에 연결되고, 나머지 하나는 5’-태깅 부위에 인터널 디옥시티미딘(internal deoxythymidine; dT)에 연결되어 있는 것을 특징으로 하는 태그된 루프프라이머.
  14. 제1항 내지 제13항 중 어느 한 항에 따른 하나 이상의 태그된 루프프라이머를 이용하여 루프 매개 등온 증폭(LAMP) 반응을 수행하는 단계를 포함하는 하나 이상의 타겟 핵산 검출 방법.
  15. 제14항에 있어서, 상기 LAMP 반응은 50°C 내지 75°C 사이의 한 온도에서 수행되는 것을 특징으로 하는 방법.
  16. 제14항에 있어서, 상기 타겟 핵산은 바이러스로부터 유래한 것을 특징으로 하는 방법.
  17. 제16항에 있어서, 상기 바이러스는 RNA 바이러스인 것을 특징으로 하는 방법.
  18. 제14항에 있어서, 상기 LAMP 반응은 종래의 태그되지 않은 루프프라이머를 추가적으로 이용하는 것을 특징으로 하는 방법.
  19. 제1항 내지 제13항 중 어느 한 항에 따른 태그된 루프프라이머를 포함하는 루프 매개 등온 증폭 반응용 조성물.
PCT/KR2022/019959 2021-12-10 2022-12-08 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법 WO2023106866A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20210177086 2021-12-10
KR10-2021-0177086 2021-12-10

Publications (1)

Publication Number Publication Date
WO2023106866A1 true WO2023106866A1 (ko) 2023-06-15

Family

ID=86731021

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/019959 WO2023106866A1 (ko) 2021-12-10 2022-12-08 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법

Country Status (1)

Country Link
WO (1) WO2023106866A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110021379A1 (en) * 2006-01-20 2011-01-27 Naoko Nakamura Method of designing primers for use in method of detecting target nucleic acid and assay kit
CN106222298A (zh) * 2016-07-26 2016-12-14 严银芳 一种rna病毒的lamp检测试剂盒、检测方法及应用
US20180371534A1 (en) * 2015-12-22 2018-12-27 Diasorin S.P.A. A method of fluorescent detection of isothermal loop-mediated amplification (LAMP) of a target nucleic acid, oligonucleotides and kits thereof
WO2021172370A1 (ja) * 2020-02-27 2021-09-02 栄研化学株式会社 一本鎖ｒｎａウイルスを検出する方法
US20210324484A1 (en) * 2020-03-31 2021-10-21 Diasorin S.P.A. Assays for the Detection of SARS-CoV-2

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110021379A1 (en) * 2006-01-20 2011-01-27 Naoko Nakamura Method of designing primers for use in method of detecting target nucleic acid and assay kit
US20180371534A1 (en) * 2015-12-22 2018-12-27 Diasorin S.P.A. A method of fluorescent detection of isothermal loop-mediated amplification (LAMP) of a target nucleic acid, oligonucleotides and kits thereof
CN106222298A (zh) * 2016-07-26 2016-12-14 严银芳 一种rna病毒的lamp检测试剂盒、检测方法及应用
WO2021172370A1 (ja) * 2020-02-27 2021-09-02 栄研化学株式会社 一本鎖ｒｎａウイルスを検出する方法
US20210324484A1 (en) * 2020-03-31 2021-10-21 Diasorin S.P.A. Assays for the Detection of SARS-CoV-2

Similar Documents

Publication Publication Date Title
US7799522B2 (en) Specific double-stranded probes for homogeneous detection of nucleic acid and their application methods
WO2017122896A1 (ko) 수산생물전염병 원인바이러스의 판별 및 검출용 유전자 마커,및 이를 이용한 원인바이러스의 판별 및 검출 방법
AU2001296647A1 (en) Specific double-stranded probes for homogeneous detection of nucleic acid and their application methods
KR102324117B1 (ko) 가닥 침입에 기초한 증폭에 의한 핵산 검출
CN108368557B (zh) 基于等温的双功能性寡聚核苷酸及利用其的核酸扩增和测定方法
WO2015126078A1 (ko) 핵산과 신호 프로브의 비대칭 등온증폭을 이용한 핵산의 검출방법
JP6876437B2 (ja) 鎖侵入に基づくｄｎａ増幅法
WO2017122897A1 (ko) 참돔 이리도바이러스병 원인바이러스의 검출용 유전자 마커, 및 이를 이용한 원인바이러스의 검출 방법
CN109988865B (zh) 一种检测呼吸道病毒的方法
KR102297191B1 (ko) RdRp 유전자에 특이적으로 결합하는 SARS-CoV-2 검출용 프라이머 및 이를 포함하는 키트
US20200392591A1 (en) Compositions and methods for detection of bk virus
WO2020145711A1 (ko) Egfr 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2023106866A1 (ko) 단일 가닥 상호작용적 이중 표지 시스템을 포함하는 태그된 루프프라이머 및 이를 이용한 핵산 등온 증폭 방법
WO2020145715A1 (ko) Tert 돌연변이 검출을 위한 dna 중합효소 및 이를 포함하는 키트
WO2018016683A1 (ko) 다중 증폭 이중 시그널 증폭에 의한 타겟 핵산 서열의 검출 방법
CN113046421B (zh) 一种不对称扩增靶核酸的方法
US20220364146A1 (en) Method for asymmetric amplification of multiple target nucleic acids
JP2012503472A (ja) 診断用ハイブリダイゼーションアッセイにおける核酸標的の配列変異に対する依存性を低下させるための方法
JP2021052790A (ja) Ｚｉｋａウイルス核酸を検出するための組成物および方法
US10370731B2 (en) Compositions and methods for detection of hepatitis C virus genotype 3
KR20130014996A (ko) 분해가능한 키메라 프로브를 사용한 웨스트 나일 바이러스의 실시간 검출 방법
KR102281380B1 (ko) S 유전자에 특이적으로 결합하는 SARS-CoV-2 검출용 프라이머 및 이를 포함하는 키트
US20230295705A1 (en) Modified primers for loop-mediated isothermal amplification and use thereof
KR20120020066A (ko) Ｈｉｖ-1 검출용 키트 및 이를 이용한 ｈｉｖ-1의 검출 방법
WO2013081198A1 (ko) 헤파티티스 ｃ 바이러스 검출용 키트 및 이를 이용한 헤파티티스 ｃ 바이러스의 검출 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22904695

Country of ref document: EP

Kind code of ref document: A1