WO2023277626A1 - Composition pour l'amélioration de la peau, comprenant du 2-phloroeckol en tant que principe actif - Google Patents

Composition pour l'amélioration de la peau, comprenant du 2-phloroeckol en tant que principe actif Download PDF

Info

Publication number
WO2023277626A1
WO2023277626A1 PCT/KR2022/009458 KR2022009458W WO2023277626A1 WO 2023277626 A1 WO2023277626 A1 WO 2023277626A1 KR 2022009458 W KR2022009458 W KR 2022009458W WO 2023277626 A1 WO2023277626 A1 WO 2023277626A1
Authority
WO
WIPO (PCT)
Prior art keywords
skin
phloroeckol
improvement
composition
formula
Prior art date
Application number
PCT/KR2022/009458
Other languages
English (en)
Korean (ko)
Inventor
이선희
신유경
김현재
안혜신
나창선
이경태
최세인
김재민
한희수
Original Assignee
코스맥스바이오 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 코스맥스바이오 주식회사 filed Critical 코스맥스바이오 주식회사
Publication of WO2023277626A1 publication Critical patent/WO2023277626A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/49—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
    • A61K8/4973—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with oxygen as the only hetero atom
    • A61K8/498—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds with oxygen as the only hetero atom having 6-membered rings or their condensed derivatives, e.g. coumarin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/357—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having two or more oxygen atoms in the same ring, e.g. crown ethers, guanadrel
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/49—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds containing heterocyclic compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97—Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783—Angiosperms [Magnoliophyta]
    • A61K8/9789—Magnoliopsida [dicotyledons]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/318—Foods, ingredients or supplements having a functional effect on health having an effect on skin health and hair or coat
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/20—Natural extracts
    • A23V2250/21—Plant extracts
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2250/00—Food ingredients
    • A23V2250/30—Other Organic compounds

Definitions

  • It relates to a composition for improving skin containing 2-phloroeckol as an active ingredient.
  • Skin aging can be divided into intrinsic aging and extrinsic aging according to factors. Intrinsic aging is known to be caused by changes in physiological functions of the skin epidermis and dermis according to age, and extrinsic aging is known to be caused by changes in physiological functions of the skin caused by environments such as air pollution, exposure to ultraviolet rays, and stress.
  • MMP-1 Microx Metalloproteinase-1
  • hyaluronic acid oxidative stress induced by ultraviolet rays increases free radicals in the body, and MMP-1 (Matrix Metalloproteinase-1), which decomposes collagen, hyaluronic acid ( It can be explained by damage to the skin epidermis and dermis due to the increased activity of hyaluronidase, which decomposes hyaluronic acid.
  • the stratum corneum of the skin exists in the outermost layer of the skin and is in direct contact with the external environment, so it plays an important barrier function to protect our body from external physical and chemical stress. This barrier function is maintained by epidermal homeostasis.
  • Epidermal homeostasis maintains a continuous skin barrier function by forming a skin barrier called the stratum corneum through terminal differentiation through the growth division and cell migration of keratinocytes in the basal layer (Korean J Food. Sci. Technol. 43:458-463, 2011).
  • keratinocytes As keratinocytes differentiate, they produce two factors that affect moisturization. First, during differentiation of keratinocytes, the cell membrane is replaced by a structure called a cornified envelope.
  • the keratinocyte membrane is a membrane structure in which various structural proteins including loricrin, involucrin, and filaggrin are cross-linked, providing skin protection against the external environment and evaporating moisture within keratinocytes. (Nat. Rev. Mol. Cell Biol. 6(4):328-340, 2005).
  • keratinocytes maintain a function as a skin barrier while producing Natural Moisturizing Factor (NMF).
  • NMF Natural Moisturizing Factor
  • a protein that is an important source for the production of natural moisturizing factors is filaggrin, which is decomposed into hydrophilic amino acids by CASP 14 to form natural moisturizing factors.
  • Natural moisturizing factors function to maintain moisture in the skin by providing water holding capacity and moisture absorption in the air (J. Cell Sci. 122:1285-1294, 2009). Therefore, maintaining an appropriate level of natural moisturizing factor in the skin is a very important factor for skin health through the skin barrier function.
  • Fine dust is less than 10 ⁇ m in diameter and is called PM (Particulate Matter) 10. Since it is only about 1/20 of skin pores, it is not blocked by the skin and easily penetrates into pores, making it difficult to remove. Once absorbed, fine dust not only causes various chemical stimuli to the skin, but also adversely affects keratinocytes and lipid membranes, lowering skin immunity and further accelerating skin aging phenomena such as acne, skin dryness, wrinkles, and pigmentation. Therefore, if the skin exposure to fine dust cannot be blocked in advance or the infiltrated fine dust cannot be removed cleanly, there is a high probability of causing skin trouble by causing an inflammatory reaction in the pores.
  • IL-1 ⁇ interleukin-1 ⁇
  • IL-8 interleukin-8
  • TNF- ⁇ Tumor necrosis factor- ⁇
  • Plant-derived materials have been used for a long time because they are excellent in terms of safety.
  • functional materials mainly made of plants and herbal medicines are being actively developed because they are used in the private sector or in oriental medicine.
  • Rhubarb Eisenia bicyclis (Kjellman) Setchell
  • Rhubarb Eisenia bicyclis (Kjellman) Setchell
  • Rhubarb Eisenia bicyclis (Kjellman) Setchell contains phlorotannins such as eckol and dieckol, sterols such as fucosterol, polysaccharides, and pyropheophytin. , Peptides, oxylipin, etc. have been reported, hyperlipidemia and diabetes treatment effect (Korean Patent Publication KP10-2008-002846), papillomavirus (HPV) infection treatment or prevention effect ( Korean Patent Publication KP10-2016-0089992). A report on whitening activity (Korean Patent Publication KP10-1749-5490000) has been made.
  • 2-phloroeckol is a component found in brown algae such as Ecklonia cava and Gompi (Mar Drugs. 2019 Jun 16;17(6):359, J Agric Food Chem. 2012 May 30;60(21):5340-9), and its molecular weight is 496.377 g/mol and the IUPAC name is 9-(3,5-Dihydroxyphenoxy)-8-(2,4,6-trihydroxyphenoxy)-1,3,6-oxanthrenetriol. Its functions include antidiabetic (Korean Patent No. 10-0908038), hepatocellular protection (J Agric Food Chem. 2012 May 30;60(21):5340-9), anticancer (Interdiscip J Chem, 2017 e 2(2 ): 1-6) have been reported to be effective.
  • Dieckol is a component found in brown algae such as rhubarb, Ecklonia cava, and gompi (J Cell Biochem. 2012 Sep; 113(9):2877-83), with a molecular weight of 742.52 g/mol and an IUPAC name of 4-[4-[6-( 3,5-dihydroxyphenoxy)-4,7,9-trihydroxydibenzo-p-dioxin-2-yl]oxy-3,5-dihydroxyphenoxy]dibenzo-p-dioxin-1,3,6,8-tetrol. Its functions include antioxidant (Biosci Biotechnol Biochem. 2012;76:1445-1451), anticancer (Mol Cells.
  • One aspect is to provide a cosmetic composition for skin improvement comprising a 2-phloroeckol compound represented by Formula 1 or a cosmetically acceptable salt thereof as an active ingredient:
  • Another aspect is to provide a health functional food composition for skin improvement comprising the 2-phloroeckol compound represented by Formula 1 or a food chemically acceptable salt thereof as an active ingredient.
  • Another aspect is to provide a pharmaceutical composition for preventing or treating skin damage comprising the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Another aspect is to provide an external skin preparation for preventing or improving skin damage comprising the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Another aspect is to provide a method for preventing, improving or treating skin damage comprising administering an effective amount of the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof to a subject in need thereof will be.
  • Another aspect is to provide a use of the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof for preparing a composition for skin improvement, prevention, improvement or treatment of skin damage.
  • One aspect provides a cosmetic composition for skin improvement comprising a 2-phloroeckol compound represented by Formula 1 below or a cosmetically acceptable salt thereof as an active ingredient:
  • the 2-phloroeckol compound may be commercially purchased and used, may be synthesized according to a conventional method, or may be preferably separated and purified from a natural product before use.
  • the 2-phloroeckol compound may be isolated from rhubarb ( Eisenia bicyclis ) extract.
  • the rhubarb extract may be an extract extracted by a solvent from the whole aerial part of the tree, a part thereof, or a material derived therefrom, respectively.
  • the part may be a tree stem, root, leaf, flower, petal, seed (seed), fruit flesh, fruit skin, or fruit, and preferably may be a leaf.
  • Whole trees, parts thereof, or materials derived therefrom used for extraction may be ground or minced or suitably dried.
  • the rhubarb extract can be extracted by any extraction method, such as hot water extraction, solvent extraction, distillation extraction, supercritical extraction, etc., which has been conventionally used to extract natural plants, and is preferably used in water, organic solvents, or mixed solvents thereof. characterized in that it is extracted.
  • extraction method such as hot water extraction, solvent extraction, distillation extraction, supercritical extraction, etc., which has been conventionally used to extract natural plants, and is preferably used in water, organic solvents, or mixed solvents thereof. characterized in that it is extracted.
  • the organic solvent may be any one or more selected from the group consisting of alcohols having 1 to 4 carbon atoms, such as ethanol, methanol, isopropanol, and butanol, etc., preferably ethanol, and more preferably fermented alcohol can be used
  • the alcohol concentration of the aqueous alcohol solution is 1 to 99.5 (v / v)%, for example, 10 to 99.5 (v / v)%, 1 to 70 (v / v)%, 1 to 40 (v / v)% , 5 to 25 (v/v)%, 7 to 20 (v/v)%, 5 to 25 (v/v)%, or 10 to 20 (v/v)%.
  • the extraction is 3 to 50 (volume / weight) times the extraction solvent with respect to rhubarb, for example, 3 to 40 (volume / weight) times, 3 to 30 (volume / weight) times, 5 to 50 (volume / weight) times weight) times, or 5 to 40 (volume/weight) times.
  • it may include adding 3 to 50 kg of the extraction solvent based on 1 kg of the material derived from the rhubarb.
  • the 2-phloroeckol compound may be a fraction of the rhubarb extract.
  • the fraction refers to a material containing a specific component separated from the extract.
  • the 2-phloroeckol compound may be separated and purified using column chromatography.
  • the chromatography is silica gel column chromatography, HP-20 column chromatography, RP-18 column chromatography, LH-20 column chromatography ( LH-20 column chromatography), high-performance liquid chromatography, or a combination thereof can be selected and used.
  • the skin improvement may be at least one selected from the group consisting of skin barrier improvement, skin damage prevention or improvement, skin moisturizing, skin immunity improvement, skin defense enhancement, skin inflammation inhibition, skin soothing and skin regeneration, and the composition may be externally stimulated. It may be to protect the skin from In addition, the external stimulus may be ultraviolet rays or fine dust, and human epidermal cells and dermal cells may be damaged by the ultraviolet rays or fine dust.
  • the present inventors found that the composition containing the 2-phloroeckol compound as an active ingredient proliferates or repairs damaged epidermal cells and/or dermal cells, reduces the production of MMP-1, and improves the skin by increasing the amount of procollagen produced. It was confirmed that there is an effect to prevent, improve or treat skin damage, and it was confirmed that there is an effect of moisturizing and regenerating the skin.
  • the composition containing the 2-phloroeckol compound as an active ingredient has the effect of improving skin by increasing the production of skin barrier proteins such as filaggrin, involucrin, loricrin and / or CASP 14 in damaged epidermal cells was confirmed, and specifically, it was confirmed that it prevented, improved or treated skin damage, and had skin moisturizing and skin barrier improving effects.
  • the composition containing the 2-phloroeckol compound as an active ingredient has effects on Interleukin-1 ⁇ (IL-1 ⁇ ), Interleukin-8 (IL-8) and Tumor necrosis factor- ⁇ (TNF- ⁇ ) in epidermal cells damaged by fine dust. It was confirmed that there is an effect of improving the skin by reducing the same inflammatory factor, and specifically, it was confirmed that there is an effect of preventing, improving or treating skin damage, improving skin immunity, enhancing skin defense and / or inhibiting skin inflammation.
  • IL-1 ⁇ Interleukin-1 ⁇
  • IL-8 Interleukin-8
  • TNF- ⁇ Tumor necrosis factor-
  • skin damage includes external stimuli, for example, death of human skin cells by ultraviolet rays or fine dust, skin cell DNA damage, increased reactive oxygen species, increased lipid peroxidation, etc. may include erythema, sunburn, pigmentation, photoaging, skin cancer, and the like.
  • skin barrier improvement means to include both skin barrier strengthening and protective functions. It is made up of corneocytes.
  • omega hydroxy ceramide is chemically covalently linked to involucrin, a protein of the outer layer of corneocytes, to form a corneocyte lipid envelope (CLE), thereby forming a multilayer lipid membrane.
  • the skin barrier improvement is a skin disease caused by weakening of the skin barrier function, such as psoriasis, contact dermatitis, eczematous dermatitis, actinic dermatitis, seborrheic dermatitis, dermatitis herpetiformis, lichen planus, lichen sclerosus, pyoderma gangrenosum, pemphigus, bullous epidermis It can mean any action that alleviates exfoliation, systemic sclerosis or leprosy or improves the damaged skin barrier function.
  • the term "acceptable" means exhibiting properties that are not toxic to cells or humans exposed to the composition.
  • the term "acceptable salt” refers to a salt prepared using a specific compound according to one aspect and a relatively non-toxic acid or base.
  • base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of base in neat solution or in a suitable inert solvent.
  • Pharmaceutically acceptable base addition salts include salts of sodium, potassium, calcium, ammonium, organic amines, or magnesium or similar salts.
  • acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of an acid in neat solution or in a suitable inert solvent.
  • Pharmaceutically acceptable acid addition salts include salts of inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, hydrogen carbonate ion, phosphoric acid, hydrogen phosphate ion, dihydrogen phosphate ion, sulfuric acid, hydrogen sulfate ion, hydroiodic acid or phosphorous acid; and salts of organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-tolylsulfonic acid, citric acid, tartaric acid, and methanesulfonic acid. and salts of amino acids (eg, arginine) and salts of organic acids such as glucuronic acid.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid
  • the acceptable salts can be synthesized by conventional chemical methods from parent compounds containing acidic or basic moieties. Generally, these salts are prepared by reacting the free acid or base form of these compounds with an appropriate stoichiometric amount of the base or acid, either in water or in an organic solvent or in a mixture of the two. In general, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred.
  • the 2-phloroeckol compound may be included in an amount of 0.001 to 10% by weight based on the total weight of the cosmetic composition. For example, 0.001 to 5% by weight, 0.001 to 3% by weight, 0.001 to 1% by weight, 0.01 to 10% by weight, 0.01 to 5% by weight, 0.01 to 3% by weight, 0.01 to 1% by weight, 0.1 to 10% by weight %, 0.1 to 5% by weight, 0.1 to 3% by weight, or 0.1 to 1% by weight.
  • a rhubarb extract may be further included in the composition.
  • the cosmetic composition includes lotion (skin lotion), toner, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrient lotion, massage cream, nutrient cream, moisture cream, hand cream, hand sanitizer, foundation, essence, Nutritional essence, packs, soaps, cleansing foams, cleansing lotions, cleansing creams, body lotions, body cleansers, suspensions, gels, powders, pastes, mask packs, and can be prepared into formulations including sheets. Compositions of such formulations may be prepared according to conventional methods in the art. The blending amount of the additional ingredients such as the moisturizing agent can be easily selected by those skilled in the art within a range that does not impair the objects and effects of the present invention.
  • the cosmetic composition may further include functional additives and ingredients included in general cosmetic compositions in addition to the active ingredients disclosed herein, and commonly used purified water, thickeners, preservatives, stabilizers, solubilizers, surfactants, carriers, A flavoring agent or a combination thereof may be further included.
  • the functional additive may include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, sphingolipids, and seaweed extracts.
  • Alcohols, oils, surfactants, fatty acids, silicone oils, wetting agents, humectants, viscosity modifiers, emulsions, stabilizers, UV scattering agents, UV absorbers, coloring agents, perfumes, and the like may be exemplified as the carrier.
  • Compounds/compositions that can be used as the alcohol, oil, surfactant, fatty acid, silicone oil, wetting agent, humectant, viscosity modifier, emulsion, stabilizer, UV scattering agent, UV absorber, coloring agent, fragrance, etc. are already known in the art. Since there is, those skilled in the art can select and use an appropriate corresponding material / composition.
  • the cosmetic composition if necessary, sunscreen, antioxidants (butylhydroxyanisole, gallic acid propyl, ellisorbic acid, tocopheryl acetate, butylated hydroxytoluene, etc.), preservatives (methylparaben, butylparaben , propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorant, pH adjuster (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, sodium malate, fumaric acid, sodium fumarate, succinic acid , sodium succinate, sodium hydroxide, sodium hydrogen phosphate, etc.), humectants (glycerin, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin, betaine, glycereth-26, methylglue Seth-20, etc.) and lubricants may be further added.
  • antioxidants butylhydroxyani
  • Another aspect provides a health functional food composition for skin improvement comprising a 2-phloroeckol compound represented by Formula 1 or a food chemically acceptable salt thereof as an active ingredient:
  • the 2-phloroeckol compound may be isolated from rhubarb ( Eisenia bicyclis ) extract.
  • the skin improvement may be one or more selected from the group consisting of skin barrier improvement, skin damage prevention or improvement, skin moisturizing, skin immunity improvement, skin defense enhancement, skin inflammation inhibition, skin soothing and skin regeneration. .
  • the 2-phloroeckol compound When used as a food additive, the compound may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method.
  • the mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
  • the 2-phloroeckol compound is 0.0001 to 99.0% by weight, for example, 0.01 to 60% by weight, 0.01% to 40% by weight, 0.01% to 30% by weight, 0.01% to 30% by weight, based on the total weight of the composition.
  • the 2-phloroekcol compound may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to conventional methods.
  • the health beverage composition of the present invention may include various flavoring agents or natural carbohydrates as additional components, like conventional beverages.
  • the aforementioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame.
  • the proportion of the natural carbohydrate is generally about 0.01 to 10 g, preferably about 0.01 to 0.1 g per 100 ml of the composition of the present invention.
  • the health functional food may include food additives acceptable in food science, and may include appropriate carriers commonly used in the manufacture of health functional food.
  • the composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages; and the like.
  • the composition of the present invention may include fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not critical, but is generally selected in the range of 0.01 to 0.1 part by weight per 100 parts by weight of the composition of the present invention.
  • Another aspect provides a pharmaceutical composition for preventing or treating skin damage comprising a 2-phloroeckol compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient:
  • Another aspect provides a method for preventing, improving or treating skin damage comprising administering an effective amount of the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof to a subject in need thereof. .
  • Another aspect provides a use of the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof for preparing a composition for skin improvement, prevention, improvement or treatment of skin damage.
  • composition can refer to a molecule or compound that imparts some beneficial effect upon administration to a subject.
  • beneficial effects may include enabling diagnostic determination; amelioration of a disease, symptom, disorder or condition; reducing or preventing the occurrence of a disease, condition, disorder or condition; and responding to a disease, symptom, disorder or condition in general.
  • prevention refers to partially or completely delaying or preventing the onset or recurrence of a disease, disorder, or its attendant symptoms, preventing the acquisition or re-acquisition of a disease or disorder, or the risk of acquiring a disease or disorder. tells how to reduce For example, the prevention refers to any action that inhibits or delays the occurrence of skin damage or symptoms by administration of the composition according to the present invention.
  • treatment includes the inhibition, alleviation or elimination of the development of a disease.
  • improvement may refer to any action that at least reduces a parameter associated with alleviation or treatment of a condition, eg, the severity of a symptom.
  • the pharmaceutical composition can be administered parenterally during clinical administration and can be used in the form of a general pharmaceutical preparation.
  • Parenteral administration may refer to administration through an administration route other than oral, such as rectal, intravenous, peritoneal, intramuscular, arterial, transdermal, nasal, inhalation, ocular and subcutaneous administration.
  • the pharmaceutical composition of the present invention may additionally contain one or more active ingredients exhibiting the same or similar functions.
  • Types of pharmaceutically active ingredients capable of delivering the active ingredient into the subject include anticancer agents, contrast agents (dye), hormones, anti-hormonal agents, vitamins, calcium agents, mineral preparations, saccharide preparations, organic acid preparations, protein amino acid preparations, detoxifying agents, and enzymes.
  • Preparations metabolic preparations, diabetes concomitant medicines, tissue regeneration medicines, chlorophyll preparations, pigment preparations, tumor medicines, tumor treatment agents, radiopharmaceuticals, tissue cell diagnostic agents, tissue cell therapy agents, antibiotics preparations, antiviral agents, complex antibiotics preparations, chemicals Therapeutic agents, vaccines, toxins, toxoids, antitoxins, leptospira serum, blood products, biological agents, analgesics, immunogenic molecules, antihistamines, allergy medications, non-specific immunogenic agents, anesthetics, stimulants, psychoactive agents, small molecule compounds, nucleic acids, It may include aptamers, antisense nucleic acids, oligonucleotides, peptides, siRNAs, and micro RNAs.
  • the pharmaceutical composition may be prepared by further including one or more pharmaceutically acceptable carriers.
  • a pharmaceutically acceptable carrier may be a mixture of saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components, and, if necessary, antioxidants and buffers.
  • bacteriostatic agents and other conventional additives may be added.
  • diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare formulations for injections such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets.
  • it can be preferably formulated according to each disease or component by an appropriate method in the art.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • Witepsol, Macrogol, Tween 61, cacao butter, liurine fat, glycerogeratin and the like may be used as a base for the suppository.
  • the pharmaceutical composition may include carbohydrates such as glucose, sucrose or dextran, antioxidants such as ascorbic acid or glutathione, chelating agents, and small molecules in order to increase stability or absorption. Proteins or other Stabilizers can be used as pharmaceuticals.
  • Another aspect provides a method of treating skin damage comprising administering the pharmaceutical composition to a subject.
  • administering means providing a pharmaceutical composition to a subject by any suitable method.
  • a pharmaceutically effective amount and an effective dosage of the pharmaceutical composition may vary depending on the formulation method, administration method, administration time and/or route of administration of the pharmaceutical composition.
  • the type and degree of response to be achieved by administration of the pharmaceutical composition, the type of subject to be administered, age, weight, general health condition, symptom or degree of disease, gender, diet, excretion, simultaneous or It may vary according to various factors including drugs and other components of the composition used together in this case, and similar factors well known in the medical field.
  • a person of ordinary skill in the art can readily determine and prescribe an effective dosage for the desired treatment.
  • Administration of the pharmaceutical composition according to the present invention can be administered once a day, divided into several administrations. Therefore, the dosage is not intended to limit the scope of the present invention in any way.
  • the dosage of the pharmaceutical composition may be 1 ug/kg/day to 1,000 mg/kg/day.
  • the subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat.
  • the subject may be a subject in need of healing of skin damage.
  • Another aspect provides a skin external preparation for preventing or improving skin damage, comprising a 2-phloroeckol compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient:
  • the external skin preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof.
  • the external skin preparation is a component usually used in external preparations for skin such as cosmetics or pharmaceuticals, for example, water-based components, oil-based components, powder components, alcohols, moisturizers, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, and fragrances. , colorants, various skin nutrients, or combinations thereof and may be suitably blended as needed.
  • the external skin preparations include metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, bellapamil, licorice extract, glabridin, and calin.
  • Hot-water extracts of fruits, various herbal medicines, tocopherol acetate, glycyrrhizic acid, tranexamic acid and its derivatives or salts and other drugs, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can also be mix
  • the skin includes all skin areas of the body, including the face, hands, arms, legs, feet, chest, stomach, back, buttocks, and scalp.
  • a composition containing a 2-phloroeckol compound according to one aspect as an active ingredient can be effectively used for skin improvement by promoting collagen synthesis, inhibiting collagen degradation, reducing the expression of inflammatory factors, and increasing the expression of skin barrier-related factors.
  • EIMS negative-ion mode
  • Figure 4 shows the UV ⁇ max spectrum of Dieckol.
  • 9 is a graph comparing the MMP-1 inhibitory effect of dieckol in dermal cells damaged by ultraviolet rays.
  • Figure 10 is a graph comparing the amount of procollagen production of 2-phloroeckol in dermal cells damaged by ultraviolet rays.
  • 11 is a graph comparing the amount of procollagen produced by diekcol in dermal cells damaged by ultraviolet rays.
  • Figure 12 is a diagram showing phosphorylation changes of signaling factors that regulate the expression of MMPs in dermal cells damaged by ultraviolet rays:
  • FIG. 12a is a diagram showing phosphorylation changes of ERK, JNK, and p38; and FIG. 12b is a diagram showing changes in phosphorylation of c-fos.
  • 13 is a picture analyzing the mechanism of inhibiting the expression of MMP in dermal cells damaged by ultraviolet rays.
  • Figure 14 is a picture showing the effect of rhubarb extract and dieckol on the skin wrinkle formation on the back of mouse skin damaged by ultraviolet rays.
  • Figure 15a is a graph showing the effect of increasing the skin thickness of the back when rhubarb extract was administered; and FIG. 15B is a graph showing the effect of increasing skin thickness on the back when dieckol was administered.
  • Figure 16 is a graph showing the transdermal water content of rhubarb extract and dieckol in mouse skin damaged by ultraviolet rays:
  • Figure 16a is a graph showing the transdermal water content in the case of administration of rhubarb extract; And Figure 16b is a graph showing the transdermal water content when dieckol was administered.
  • Figure 17 is a graph showing the degree of transdermal water loss of rhubarb extract and dieckol in mouse skin damaged by ultraviolet rays:
  • Figure 17a is a graph showing the degree of transepidermal water loss in the case of administration of rhubarb extract; And Figure 17b is a graph showing the degree of transepidermal water loss when dieckol was administered.
  • 18 is a graph comparing the cytotoxicity of 2-phloroeckol in epidermal cells.
  • 19 is a graph showing the increase in filaggrin expression of 2-phloroeckol in epidermal cells damaged by ultraviolet rays.
  • 20 is a graph showing an increase in the expression level of involucrin of 2-phloroeckol in epidermal cells damaged by ultraviolet rays.
  • 21 is a graph showing an increase in the expression level of 2-phloroeckol and loricrin in epidermal cells damaged by ultraviolet rays.
  • 22 is a graph showing the decrease in the expression of IL-1 ⁇ of 2-phloroeckol in epidermal cells induced by fine dust.
  • 23 is a graph showing the decrease in the amount of IL-8 expression of 2-phloroeckol in epidermal cells in which an inflammatory response was induced by fine dust.
  • the rhubarb extract contained in the composition of the present invention was prepared by the following process.
  • rhubarb which grows wild in Korea, was washed thoroughly with distilled water, desalted, and then completely dried in a cool place without sunlight until there was no change in weight. Then, after preparing 8400 kg of 30% fermented alcohol (30 times, w/w) to the completely dried dried product, 280 kg of the dried product was added. At this time, the mixing ratio of the dry matter and 30% fermented alcohol was 30 times the weight ratio. Next, 30% fermented alcohol mixed with the dry matter was put in a constant temperature water bath and stirred and extracted at 60 ° C. for 5 hours. The extracted sample was filtered with a housing filter (10 ⁇ m) and then concentrated under reduced pressure. 274 kg of the concentrate was sterilized at 90° C. for 1 hour, and then filtered through a bag filter (100 ⁇ m). The concentrate was homogenized by adding maltodextrin to a solid content of 50% (w/w), and then a water-soluble powder was obtained through spray drying.
  • the developing solvent was solvent-fractionated using a 10% - 100% methanol mixed solution and divided into 5 small fractions (Fr. 1 to 5). Small fraction 2 (Fr.2) was subjected to gel filtration using Silica gel 60 resin. It was divided into 5 small fractions (Fr.2-1 to
  • the developing solvent was solvent fractionated using a 20% - 100% methanol mixed solution and divided into 7 small fractions (Fr.2-3-1 ⁇ 7). From the two small fractions 2-3-6, 2-phloroeckol compound 1 (2-phloroeckol) was obtained in pure form.
  • Example 2 After adding 3 times distilled water to the extracted powder obtained in Example 1, coating was performed using Silica gel 60. An extract was prepared using ethyl acetate on the coating. The extract was subjected to gel filtration using Diaion HP-20 resin. The developing solvent was solvent-fractionated using a 10% - 100% methanol mixed solution and divided into 5 small fractions (Fr. 1 to 5). Small fraction 3 (Fr.3) was subjected to gel filtration using RP resin. It was divided into 7 small fractions (Fr.3-1 ⁇ 7) using 10% - 100% methanol as a developing solvent, and among them, the Fr.3-4 fraction was subjected to gel filteration using Sephadex LH-20 resin. The developing solvent was solvent fractionated using a 20% - 100% methanol mixed solution and divided into three small fractions (Fr.3-5-1 ⁇ 3). Dieckol Compound 1 (Dieckol) was obtained in pure form from the small fraction 2-5-2.
  • Example 1 and the 2-phloroeckol obtained in Example 2 of the present invention were analyzed by high-performance liquid chromatography (HPLC) and a UV/Vis detector.
  • HPLC high-performance liquid chromatography
  • Waters e2695 Series system, Waters 24489 UV/Vis detector (Worcester, MA, USA), Luna C18(2) (5 ⁇ m, 250 ⁇ 4.6 mm, Phenomenex, Torrance, CA, USA) column were used as the HPLC instrument. All solvents used were J.T. HPLC grade solvents purchased from Baker (Phillipsburg, NJ, USA) were used.
  • the temperature of the column was set to 30 °C
  • the injection volume was set to 10 ⁇ l
  • the measurement wavelength was set to 230 nm.
  • acetonitrile (ACN) and tertiary distilled water (D.W) were used, and the ACN-D.W (1:9 - 10:0, v/v) mixed solution was analyzed at a rate of 1 ml/min for 50 minutes.
  • ACN acetonitrile
  • D.W tertiary distilled water
  • the analysis sample 200 mg of the extracted powder obtained in Example 1 was precisely weighed, 10 ml of methanol was added, dissolved in an ultrasonic shaker for 20 minutes, allowed to cool at room temperature, and the supernatant was filtered through a 0.45 ⁇ m membrane filter for use.
  • Example 2 2-phloroeckol obtained by precisely weighing 10 mg, adding 40 ml of methanol, dissolving in an ultrasonic shaker for 20 minutes, cooling at room temperature, adding methanol, and filtering through a 0.45 ⁇ m membrane filter. For each analysis sample, the chromatogram was extracted at 230 nm, and the rhubarb extract and 2-phloroeckol peaks were compared and analyzed as shown in FIG.
  • Example 1 and the D-Ecol obtained in Example 2 of the present invention were analyzed by high-performance liquid chromatography (HPLC) and a UV/Vis detector.
  • HPLC instrument used was a Waters e2695 Series system, a Waters 24489 UV/Vis detector (Worcester, MA, USA), and a Luna C18(2) (5 ⁇ m, 250 ⁇ 4.6 mm, Phenomenex, Torrance, CA, USA) column. All solvents used were J.T. HPLC grade solvents purchased from Baker (Phillipsburg, NJ, USA) were used.
  • the temperature of the column was set to 30°C
  • the injection volume was 10 ⁇ l
  • the measurement wavelength was set to 230 nm.
  • acetonitrile (ACN) and tertiary distilled water (D.W) were used, and the ACN-D.W (1:9 - 10:0, v/v) mixed solution was analyzed at a rate of 1 ml/min for 50 minutes.
  • ACN acetonitrile
  • D.W tertiary distilled water
  • the analysis sample 200 mg of the extracted powder obtained in Example 1 was precisely weighed, 10 ml of methanol was added, dissolved in an ultrasonic shaker for 20 minutes, allowed to cool at room temperature, and the supernatant was filtered through a 0.45 ⁇ m membrane filter for use.
  • the MTT assay is a method for measuring the amount of formazan formed from reduced MTT by mitochondria of living cells. More specifically, each cell was treated with 100 ⁇ l of 0.5 mg/ml MTT solution and incubated for 4 hours, then the solution was completely removed and the plate dissolved in DMSO was measured at 540 nm absorbance.
  • epidermal cells HaCaT
  • HaCaT epidermal cells
  • each cell was dispensed on a 24-well plate at a concentration of 1.0 X 10 5 cells/well and stabilized for 24 hours.
  • UVB irradiate ultraviolet
  • the existing medium was removed, washed with PBS, and then treated with UVB at 15 mJ/cm 2 .
  • the level of MMP-1 secretion was measured in the supernatant using the MMP-1 Human ELISA Kit (ab100603, Abcam, US).
  • the concentration of MMP-1 was increased in dermal cells damaged by 15 mJ/cm 2 of UVB, and 2-phloroeckol and dieckol of Examples 2 and 3 inhibited MMP-1 production. decreased in a concentration dependent manner.
  • 2-phloroeckol and dieckol in Examples 2 and 3 since the effects of 2-phloroeckol and dieckol in Examples 2 and 3 on MMP-1 production inhibition were significantly shown, it was confirmed that 2-phloroeckol and dieckol were effective in improving skin damage caused by ultraviolet rays.
  • procollagen type 1 could be increased in dermal cells Hs68 fibroblast.
  • each cell was dispensed on a 24-well plate at a concentration of 1.0 X 10 5 cells/well and stabilized for 24 hours.
  • To irradiate UVB the existing medium was removed, washed with PBS, and treated with UVB at 15 mJ/cm 2 .
  • procollagen type 1 was measured in the supernatant using a Procollagen Type I C-peptide (PIP) EIA kit (Mk101, Takara, Japan).
  • PIP Procollagen Type I C-peptide
  • 2-phloroeckol and dieckol of Examples 2 and 3 increased the amount of procollagen production in dermal cells damaged by 15 mJ/cm 2 UVB.
  • 2-phloroeckol and dieckol of Examples 2 and 3 increased the amount of procollagen production in a concentration-dependent manner, 2-phloroeckol and dieckol help regenerate collagen fibers decomposed by ultraviolet rays to prevent or prevent skin damage caused by ultraviolet rays. confirmed to improve.
  • each cell was dispensed on a 60 mm plate at a concentration of 2.0 X 10 6 cells and stabilized for 24 hours. Then, in order to irradiate UVB, the existing medium was removed, washed with PBS (Phosphate Buffer Solution), and UVB was treated with 15 mJ/cm 2 . After culturing for 1 hour using the medium treated with the sample, intracellular proteins were extracted with RIPA buffer (Radioimmunoprecipitation assay buffer).
  • RIPA buffer Radioimmunoprecipitation assay buffer
  • dieckol effectively inhibits phosphorylation of p38 and extracellular signal regulated kinase (ERK) among MAPK proteins in dermal cells damaged by 15 mJ/cm 2 UVB.
  • ERK extracellular signal regulated kinase
  • dieckol effectively reduced the phosphorylation of c-fos, which was increased by UVB treatment, in the AP-1 complex, a sub-factor of MAPK.
  • dieckol prevents or improves skin damage caused by ultraviolet rays by also inhibiting the mechanism of regulating the expression of MMP-1 (Matrix Metalloproteinase-1).
  • TIMP tissue inhibitor of matrix metalloproteinase
  • TIMP-1 and TIMP-2 were decreased in dermal cells damaged by 15 mJ/cm 2 UVB, it was confirmed that dieckol effectively restored the protein expression level. As a result, it was confirmed that dieckol prevents or improves skin damage caused by ultraviolet rays by regulating the mechanism of suppressing the expression of MMP-1 (Matrix Metalloproteinase-1).
  • an animal model irradiated with ultraviolet light was first prepared.
  • 5-week-old male HR-1 hairless mice (specific-pathogen-free (SPF) grade, 18 ⁇ 2 g, Orient Bio) were set into 7 groups as follows, and 10 mice per group were tested.
  • UV irradiation was irradiated 3 times a week for 7 weeks using a UVP crosslinker, and the UVB irradiation energy gradually increased at 60 mJ/cm 2 . 60 mJ/cm 2 for 1-3 weeks, 120 mJ/cm 2 for 4-5 weeks, and 180 mJ/cm 2 for 6-7 weeks.
  • mice normal mice (Vehicle (Control) to which nothing was administered without irradiation with UV rays and mice irradiated with UV rays (UVB+Vehicle) to which nothing was administered after irradiation with UV rays were placed, respectively.
  • 50 mg/kg, 100 mg/kg, and 200 mg/kg of the rhubarb extract (EEB) of Example 1 were orally administered to mice irradiated with ultraviolet light
  • dieckol of Example 3 was administered at 5 mg/kg and 10 mg/kg, respectively. kg orally administered.
  • the rhubarb extract and dieckol of Examples 1 and 3 were orally administered 5 days per week during the administration period, respectively. The dark:light cycle was maintained at 12-hour:12-hour intervals, and water was freely consumed.
  • the UVB irradiation control group decreased the transepidermal water content and increased the transepidermal water loss, but it could be confirmed that the skin water content and water loss were effectively restored by the rhubarb extract and dieckol. there was.
  • the rhubarb extract and dieckol prevent or improve skin damage caused by ultraviolet rays by confirming that they are effective in inhibiting and moisturizing skin wrinkles caused by ultraviolet rays in an animal model irradiated with ultraviolet rays.
  • each sample was treated by concentration in HaCaT keratinocyte epidermal cells, and changes in the expression of skin barrier-related genes filaggrin, involucrin and loricrin were observed. Confirmed.
  • DMEM medium Hyclone SH30243.01
  • FBS FBS
  • DMEM medium Hyclone SH30243.01
  • FBS FBS
  • UVB UVB
  • the existing medium was removed, washed with PBS, and treated with UVB at 15 mJ/cm 2 .
  • the existing medium was removed, cultured for 24 hours in a serum starvation state, and then treated with trypsin-EDTA to recover cell pellets.
  • PCR quantitative real time-PCR
  • the RT-PCR reaction was performed under the condition of 40 cycles of 95 °C for 10 seconds, 60 °C for 10 seconds, and 72 °C for 10 seconds after pre-incubation at 95 °C for 600 seconds.
  • Primer sequence (5' ⁇ 3') sequence number filaggrin Forward AGTGCACTCAGGGGGCTCACA One Reverse CCGGCTTGGCCGTAATGTGT 2 involucrine Forward TTGGTCAGTGAAGCGATGAG 3 Reverse AGATCTGTCTGCAGGGCTGT 4 loli clean Forward TCATAAGAAACCCCGCTGAG 5 Reverse AAGGAAGGAGAGCCTGGAAG 6 ⁇ -actin Forward CATGTACGTTGCTATCCAGGC 7 Reverse CTCCTTAATGTCACGCACGAT 8
  • qRT-PCR was performed using the oligomers shown in Table 1 above as primers.
  • the primer set is specific for filaggrin, involucrin, and loricrin genes, which are skin barrier-related genes.
  • the expression levels of filaggrin, involucrin, and loricrin were reduced in damaged epidermal cells when treated with ultraviolet rays.
  • 2-phloroeckol significantly increased all skin barrier-related genes, it was confirmed that 2-phloroeckol prevented or improved skin damage caused by ultraviolet rays by increasing the expression of skin barrier genes reduced from ultraviolet rays.
  • Example 2 In order to evaluate the anti-inflammatory effect of the 2-phloroeckol obtained in Example 2 on fine dust, the cells were treated with fine dust (PM10) and the samples were treated to induce inflammatory cytokines, IL-1 ⁇ and IL-8. And the expression level of TNF- ⁇ was measured. Specifically, 1x10 6 cells of HaCaT cells were dispensed in DMEM medium (Hyclone SH30243.01) supplemented with 10% FBS in a 6-well plate and stabilized for 24 hours. In order to treat fine dust, the existing medium was removed, and after washing with PBS, 100 ⁇ g/ml of fine dust was treated.
  • DMEM medium Hyclone SH30243.01
  • the sample was cultured for 4 hours using the treated medium, and then mRNA was extracted from the cells, synthesized into cDNA, and quantitative real-time PCR was performed using a target template (primer), and finally, the level of gene expression of inflammatory cytokines. evaluated.
  • qRT-PCR was performed using the oligomers shown in Table 2 above as primers.
  • the primer set is specific for IL-1 ⁇ , IL-8 and TNF- ⁇ genes, which are inflammatory cytokine-related genes increased by fine dust.
  • FIGS. 22 to 24 the expression of IL-1 ⁇ , IL-8 and TNF- ⁇ , which are inflammatory cytokine-related genes, increased in damaged epidermal cells when fine dust was treated.
  • 2-phloroeckol reduces all inflammatory cytokine-related genes in a concentration-dependent manner, 2-phloroeckol reduces the expression of cytokines that were increased by fine dust to prevent or improve skin damage caused by fine dust. confirmed that it does.
  • Example 2 tablets were prepared by mixing the ingredients in Table 3 below and tableting according to a conventional tablet manufacturing method.
  • Example 2 10.0000 silicon dioxide 15.3000 Magnesium Stearate 10.8000 crystalline cellulose 799.4951 Hydroxypropyl Methyl Cellulose 29.0700 Carboxymethyl Cellulose Calcium 27.0000 Glycerin fatty acid ester 0.6930 titanium dioxide 1.4697 red national pigment 4.4082 powdered caramel color 1.7640
  • soft capsules were prepared by mixing the ingredients in Table 4 below and filling them into gelatin capsules according to the usual capsule preparation method.
  • Example 2 With respect to Example 2, the ingredients in Table 5 were mixed according to the beverage manufacturing method suitable for the taste and filled into a bottle or pouch to prepare a liquid formulation.
  • Example 2 according to the jelly manufacturing method suitable for the taste, the ingredients in Table 6 were mixed and filled in a three-sided cloth to prepare jelly.
  • Example 2 a nutritious cream was prepared according to a conventional method with the composition shown in Table 7 below.
  • composition ratio is generally prepared as a formulation example by mixing suitable ingredients, the mixing ratio and raw materials may be arbitrarily changed as necessary.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Epidemiology (AREA)
  • Birds (AREA)
  • Medicinal Chemistry (AREA)
  • Dermatology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Polymers & Plastics (AREA)
  • Biotechnology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Botany (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Cosmetics (AREA)

Abstract

La présente invention concerne une composition pour l'amélioration de la peau, comprenant du 2-phloroeckol en tant que principe actif. La composition comprenant un composé de 2-phloroeckol en tant que principe actif, selon un aspect, favorise la synthèse du collagène, inhibe la décomposition du collagène, diminue l'expression d'un facteur inflammatoire, augmente l'expression d'un facteur associé à la barrière cutanée, et peut ainsi être efficacement utilisée pour améliorer la peau.
PCT/KR2022/009458 2021-06-30 2022-06-30 Composition pour l'amélioration de la peau, comprenant du 2-phloroeckol en tant que principe actif WO2023277626A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210086096A KR20230004170A (ko) 2021-06-30 2021-06-30 2-phloroeckol을 유효성분으로 포함하는 피부 개선용 조성물
KR10-2021-0086096 2021-06-30

Publications (1)

Publication Number Publication Date
WO2023277626A1 true WO2023277626A1 (fr) 2023-01-05

Family

ID=84691900

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/009458 WO2023277626A1 (fr) 2021-06-30 2022-06-30 Composition pour l'amélioration de la peau, comprenant du 2-phloroeckol en tant que principe actif

Country Status (2)

Country Link
KR (1) KR20230004170A (fr)
WO (1) WO2023277626A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100879558B1 (ko) * 2007-07-31 2009-01-22 라이브켐 주식회사 디벤조­파라­디옥신 유도체를 유효성분으로 함유한 피부보호 및 개선제
JP2013049639A (ja) * 2011-08-30 2013-03-14 Fisheries Research Agency クロメ由来のフロロタンニン類を有効成分とする紫外線照射障害保護剤
KR20130141874A (ko) * 2012-06-18 2013-12-27 부경대학교 산학협력단 대황 유래 플로로탄닌 화합물을 유효성분으로 하는 항균성 조성물
KR20170080513A (ko) * 2015-12-31 2017-07-10 성신여자대학교 산학협력단 DPHC(diphlorethohydroxycarmalol)를 포함하는 피부 구조 개선용 조성물
KR20190046681A (ko) * 2017-10-26 2019-05-07 주식회사 보타메디 플로로탄닌을 유효성분으로 포함하는 피부 냉각용 조성물 및 제품

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100879558B1 (ko) * 2007-07-31 2009-01-22 라이브켐 주식회사 디벤조­파라­디옥신 유도체를 유효성분으로 함유한 피부보호 및 개선제
JP2013049639A (ja) * 2011-08-30 2013-03-14 Fisheries Research Agency クロメ由来のフロロタンニン類を有効成分とする紫外線照射障害保護剤
KR20130141874A (ko) * 2012-06-18 2013-12-27 부경대학교 산학협력단 대황 유래 플로로탄닌 화합물을 유효성분으로 하는 항균성 조성물
KR20170080513A (ko) * 2015-12-31 2017-07-10 성신여자대학교 산학협력단 DPHC(diphlorethohydroxycarmalol)를 포함하는 피부 구조 개선용 조성물
KR20190046681A (ko) * 2017-10-26 2019-05-07 주식회사 보타메디 플로로탄닌을 유효성분으로 포함하는 피부 냉각용 조성물 및 제품

Also Published As

Publication number Publication date
KR20230004170A (ko) 2023-01-06

Similar Documents

Publication Publication Date Title
KR101116852B1 (ko) 후박 추출물 또는 이로부터 분리된 ４-ｏ-메틸호노키올을유효성분으로 함유하는 항염, 항알러지 및 주름 개선용조성물
WO2017222317A1 (fr) Composition ayant pour effet d'améliorer l'hydratation de la peau, d'éliminer la kératine cutanée, d'améliorer l'élasticité de la peau, d'inhiber l'érythème, d'atténuer les rides cutanées ou d'atténuer le photovieillissement cutané, contenant une ionone ou un sel de celle-ci comme ingrédient actif
KR20170050062A (ko) 병풀로부터 분리한 아시아티코사이드, 마데카소사이드, 아시아틱산 및 마데카식산을 포함하는 음료 및 화장료 조성물 및 그 제조방법
KR101436199B1 (ko) 호데닌을 포함하는 피부 상태 개선용 조성물
WO2017213346A1 (fr) Composition contenant de la diosmine ou son sel comme ingrédient actif et présentant un effet d'amélioration de l'hydratation de la peau, d'exfoliation de la peau, de renforcement de l'élasticité de la peau, d'inhibition de l'érythème, de réduction des rides de la peau, ou de retardement du photovieillissement de la peau
KR101088069B1 (ko) 판두라틴 유도체 또는 이를 함유하는 카엠페리아 판두라타 추출물의 신규한 용도
WO2018004141A1 (fr) Composition ayant pour effet d'améliorer l'hydratation de la peau, d'exfolier la peau, d'améliorer l'élasticité de la peau, d'inhiber l'érythème, d'atténuer les rides cutanées ou d'atténuer le photovieillissement cutané, contenant, en tant qu'ingrédient actif, un ou plusieurs composés choisis dans le groupe constitué du cimène, de l'acide béhénique, du 2-méthoxynaphtalène, du thymol et de leurs sels
KR20140012456A (ko) 아케비아 사포닌-디를 포함하는 피부 상태 개선용 조성물
WO2021080129A1 (fr) Composition pour renforcer la barrière cutanée et soulager la dermatite atopique, comprenant de l'hydrangénol ou de la phyllodulcine en tant que principe actif
WO2017119535A1 (fr) Composition anti-âge comprenant de la carnosine, peptide de soja, et extrait d'andrographis paniculata
WO2020052571A1 (fr) Utilisation d'extrait de combretum micranthum dans des produits cosmétiques
WO2023277626A1 (fr) Composition pour l'amélioration de la peau, comprenant du 2-phloroeckol en tant que principe actif
KR101223684B1 (ko) 아프젤린을 유효성분으로 포함하는 피부 상태 개선용 조성물
WO2014003224A1 (fr) Compositions de blanchiment de la peau comprenant de la madécassoside
KR20090081956A (ko) 오가피로부터 추출된 유효성분을 함유하는 피부 미백용화장료 조성물 및 그 제조방법
KR20190018108A (ko) 티몰을 유효성분으로 함유하는 피부 주름 또는 아토피성 피부염의 예방 또는 치료용 조성물
KR102012366B1 (ko) 아슈와간다 캘러스 추출물을 포함하는 미백용 조성물
KR101069906B1 (ko) 비짜루국화 추출물을 함유하는 피부 상태개선용 조성물
KR101526435B1 (ko) 머루근 추출물을 포함하는 미백용 조성물
KR102014646B1 (ko) 골담초 유래 화합물 및 이를 함유하는 피부 미백용 조성물
KR102014685B1 (ko) 골담초 유래 화합물 및 이를 함유하는 피부 미백용 조성물
WO2023128481A1 (fr) Composition comprenant de l'inotodiol et extrait de champignon chaga le contenant afin d'améliorer une affection cutanée
WO2023282624A1 (fr) Composition pour prévenir atténuer l'obésité comprenant un extrait d'anchois ou un acide néochlorogénique en tant que principe actif
WO2023080726A1 (fr) Composition destinée à favoriser ou à améliorer le métabolisme énergétique contenant, en tant que principe actif, un extrait d'eisenia bicyclis ou du 2-phloroeckol
KR20190124351A (ko) 민물김 추출물을 유효성분으로 포함하는 피부 미백용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22833679

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE