WO2023277626A1 - Composition for improving skin, comprising 2-phloroeckol as active ingredient - Google Patents

Abstract

The present invention relates to a composition for improving skin, comprising 2-phloroeckol as an active ingredient. The composition comprising a 2-phloroeckol compound as an active ingredient, according to one aspect, promotes collagen synthesis, inhibits collagen breakdown, decreases expression of an inflammatory factor, increases expression of a skin-barrier-related factor, and thus can be effectively used to improve skin.

Description

Composition for skin improvement containing 2-PHLOROECKOL as an active ingredient

It relates to a composition for improving skin containing 2-phloroeckol as an active ingredient.

As the elderly population increases, skin beauty and antioxidants that can prevent aging, which can be a measure of aging, are emerging as major concerns. Wrinkles of the skin and reduced antioxidant activity in the body due to aging can be used as a measure of health. Skin aging can be divided into intrinsic aging and extrinsic aging according to factors. Intrinsic aging is known to be caused by changes in physiological functions of the skin epidermis and dermis according to age, and extrinsic aging is known to be caused by changes in physiological functions of the skin caused by environments such as air pollution, exposure to ultraviolet rays, and stress. Among these aging mechanisms, oxidative stress induced by ultraviolet rays increases free radicals in the body, and MMP-1 (Matrix Metalloproteinase-1), which decomposes collagen, hyaluronic acid ( It can be explained by damage to the skin epidermis and dermis due to the increased activity of hyaluronidase, which decomposes hyaluronic acid.

The stratum corneum of the skin exists in the outermost layer of the skin and is in direct contact with the external environment, so it plays an important barrier function to protect our body from external physical and chemical stress. This barrier function is maintained by epidermal homeostasis. Epidermal homeostasis maintains a continuous skin barrier function by forming a skin barrier called the stratum corneum through terminal differentiation through the growth division and cell migration of keratinocytes in the basal layer (Korean J Food. Sci. Technol. 43:458-463, 2011).

As keratinocytes differentiate, they produce two factors that affect moisturization. First, during differentiation of keratinocytes, the cell membrane is replaced by a structure called a cornified envelope. The keratinocyte membrane is a membrane structure in which various structural proteins including loricrin, involucrin, and filaggrin are cross-linked, providing skin protection against the external environment and evaporating moisture within keratinocytes. (Nat. Rev. Mol. Cell Biol. 6(4):328-340, 2005).

In addition, during the differentiation process of keratinocytes, keratinocytes maintain a function as a skin barrier while producing Natural Moisturizing Factor (NMF). A protein that is an important source for the production of natural moisturizing factors is filaggrin, which is decomposed into hydrophilic amino acids by CASP 14 to form natural moisturizing factors. Natural moisturizing factors function to maintain moisture in the skin by providing water holding capacity and moisture absorption in the air (J. Cell Sci. 122:1285-1294, 2009). Therefore, maintaining an appropriate level of natural moisturizing factor in the skin is a very important factor for skin health through the skin barrier function.

Fine dust is less than 10 ㎛ in diameter and is called PM (Particulate Matter) 10. Since it is only about 1/20 of skin pores, it is not blocked by the skin and easily penetrates into pores, making it difficult to remove. Once absorbed, fine dust not only causes various chemical stimuli to the skin, but also adversely affects keratinocytes and lipid membranes, lowering skin immunity and further accelerating skin aging phenomena such as acne, skin dryness, wrinkles, and pigmentation. Therefore, if the skin exposure to fine dust cannot be blocked in advance or the infiltrated fine dust cannot be removed cleanly, there is a high probability of causing skin trouble by causing an inflammatory reaction in the pores.

When the skin is exposed to fine dust, an inflammatory response is initiated to defend against it, and various immune cells and inflammation-inducing cytokines are involved. IL-1β (interleukin-1β), IL-8 (interleukin-8), and TNF-α (Tumor necrosis factor-α) are typical inflammation-inducing cytokines, and fine dust particles express these cytokines in human keratinocytes. increases

Therefore, research on mechanisms for suppressing and improving cell damage caused by ultraviolet rays or fine dust has been actively conducted, and research on cosmetics and health functional foods showing biochemical efficacy and effects is being conducted. Materials with practical efficacy and effects due to the development of the research level and the increase in technology are the main research subjects.

Plant-derived materials have been used for a long time because they are excellent in terms of safety. In particular, in Korea, functional materials mainly made of plants and herbal medicines are being actively developed because they are used in the private sector or in oriental medicine.

Rhubarb ( Eisenia bicyclis (Kjellman) Setchell) is a multi-year-old brown algae plant belonging to the kelp tree Gamtaeidae, distributed in the waters of Ulleungdo and Dokdo in Korea, and all parts are specified as edible parts in the food raw materials notified by the Ministry of Food and Drug Safety.

Rhubarb ( Eisenia bicyclis (Kjellman) Setchell) contains phlorotannins such as eckol and dieckol, sterols such as fucosterol, polysaccharides, and pyropheophytin. , Peptides, oxylipin, etc. have been reported, hyperlipidemia and diabetes treatment effect (Korean Patent Publication KP10-2008-002846), papillomavirus (HPV) infection treatment or prevention effect ( Korean Patent Publication KP10-2016-0089992). A report on whitening activity (Korean Patent Publication KP10-1749-5490000) has been made.

2-phloroeckol is a component found in brown algae such as Ecklonia cava and Gompi (Mar Drugs. 2019 Jun 16;17(6):359, J Agric Food Chem. 2012 May 30;60(21):5340-9), and its molecular weight is 496.377 g/mol and the IUPAC name is 9-(3,5-Dihydroxyphenoxy)-8-(2,4,6-trihydroxyphenoxy)-1,3,6-oxanthrenetriol. Its functions include antidiabetic (Korean Patent No. 10-0908038), hepatocellular protection (J Agric Food Chem. 2012 May 30;60(21):5340-9), anticancer (Interdiscip J Chem, 2017 e 2(2 ): 1-6) have been reported to be effective.

Dieckol is a component found in brown algae such as rhubarb, Ecklonia cava, and gompi (J Cell Biochem. 2012 Sep; 113(9):2877-83), with a molecular weight of 742.52 g/mol and an IUPAC name of 4-[4-[6-( 3,5-dihydroxyphenoxy)-4,7,9-trihydroxydibenzo-p-dioxin-2-yl]oxy-3,5-dihydroxyphenoxy]dibenzo-p-dioxin-1,3,6,8-tetrol. Its functions include antioxidant (Biosci Biotechnol Biochem. 2012;76:1445-1451), anticancer (Mol Cells. 2012;33:141-149), antidiabetic (Food Chem Toxicol. 2013;53:294-298), It has been reported to have liver cell protection (Food Chem Toxicol. 2012;50:1986-1991) and anti-inflammatory (Int Immunopharmacol. 2014;22:51-58) effects.

However, a direct study on the skin improvement effect of 2-phloroeckol has not been conducted.

One aspect is to provide a cosmetic composition for skin improvement comprising a 2-phloroeckol compound represented by Formula 1 or a cosmetically acceptable salt thereof as an active ingredient:

[Formula 1]

.

Another aspect is to provide a health functional food composition for skin improvement comprising the 2-phloroeckol compound represented by Formula 1 or a food chemically acceptable salt thereof as an active ingredient.

Another aspect is to provide a pharmaceutical composition for preventing or treating skin damage comprising the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

Another aspect is to provide an external skin preparation for preventing or improving skin damage comprising the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof as an active ingredient.

Another aspect is to provide a method for preventing, improving or treating skin damage comprising administering an effective amount of the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof to a subject in need thereof will be.

Another aspect is to provide a use of the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof for preparing a composition for skin improvement, prevention, improvement or treatment of skin damage.

One aspect provides a cosmetic composition for skin improvement comprising a 2-phloroeckol compound represented by Formula 1 below or a cosmetically acceptable salt thereof as an active ingredient:

[Formula 1]

.

The 2-phloroeckol compound may be commercially purchased and used, may be synthesized according to a conventional method, or may be preferably separated and purified from a natural product before use. In one embodiment, the 2-phloroeckol compound may be isolated from rhubarb ( Eisenia bicyclis ) extract.

The rhubarb extract may be an extract extracted by a solvent from the whole aerial part of the tree, a part thereof, or a material derived therefrom, respectively. The part may be a tree stem, root, leaf, flower, petal, seed (seed), fruit flesh, fruit skin, or fruit, and preferably may be a leaf. Whole trees, parts thereof, or materials derived therefrom used for extraction may be ground or minced or suitably dried.

The rhubarb extract can be extracted by any extraction method, such as hot water extraction, solvent extraction, distillation extraction, supercritical extraction, etc., which has been conventionally used to extract natural plants, and is preferably used in water, organic solvents, or mixed solvents thereof. characterized in that it is extracted. The organic solvent may be any one or more selected from the group consisting of alcohols having 1 to 4 carbon atoms, such as ethanol, methanol, isopropanol, and butanol, etc., preferably ethanol, and more preferably fermented alcohol can be used The alcohol concentration of the aqueous alcohol solution is 1 to 99.5 (v / v)%, for example, 10 to 99.5 (v / v)%, 1 to 70 (v / v)%, 1 to 40 (v / v)% , 5 to 25 (v/v)%, 7 to 20 (v/v)%, 5 to 25 (v/v)%, or 10 to 20 (v/v)%.

The extraction is 3 to 50 (volume / weight) times the extraction solvent with respect to rhubarb, for example, 3 to 40 (volume / weight) times, 3 to 30 (volume / weight) times, 5 to 50 (volume / weight) times weight) times, or 5 to 40 (volume/weight) times. For example, it may include adding 3 to 50 kg of the extraction solvent based on 1 kg of the material derived from the rhubarb.

The 2-phloroeckol compound may be a fraction of the rhubarb extract. The fraction refers to a material containing a specific component separated from the extract. The 2-phloroeckol compound may be separated and purified using column chromatography. The chromatography is silica gel column chromatography, HP-20 column chromatography, RP-18 column chromatography, LH-20 column chromatography ( LH-20 column chromatography), high-performance liquid chromatography, or a combination thereof can be selected and used.

The skin improvement may be at least one selected from the group consisting of skin barrier improvement, skin damage prevention or improvement, skin moisturizing, skin immunity improvement, skin defense enhancement, skin inflammation inhibition, skin soothing and skin regeneration, and the composition may be externally stimulated. It may be to protect the skin from In addition, the external stimulus may be ultraviolet rays or fine dust, and human epidermal cells and dermal cells may be damaged by the ultraviolet rays or fine dust.

Accordingly, the present inventors found that the composition containing the 2-phloroeckol compound as an active ingredient proliferates or repairs damaged epidermal cells and/or dermal cells, reduces the production of MMP-1, and improves the skin by increasing the amount of procollagen produced. It was confirmed that there is an effect to prevent, improve or treat skin damage, and it was confirmed that there is an effect of moisturizing and regenerating the skin. In addition, the composition containing the 2-phloroeckol compound as an active ingredient has the effect of improving skin by increasing the production of skin barrier proteins such as filaggrin, involucrin, loricrin and / or CASP 14 in damaged epidermal cells was confirmed, and specifically, it was confirmed that it prevented, improved or treated skin damage, and had skin moisturizing and skin barrier improving effects. In addition, the composition containing the 2-phloroeckol compound as an active ingredient has effects on Interleukin-1β (IL-1β), Interleukin-8 (IL-8) and Tumor necrosis factor-α (TNF-α) in epidermal cells damaged by fine dust. It was confirmed that there is an effect of improving the skin by reducing the same inflammatory factor, and specifically, it was confirmed that there is an effect of preventing, improving or treating skin damage, improving skin immunity, enhancing skin defense and / or inhibiting skin inflammation.

As used herein, the term "skin damage" includes external stimuli, for example, death of human skin cells by ultraviolet rays or fine dust, skin cell DNA damage, increased reactive oxygen species, increased lipid peroxidation, etc. may include erythema, sunburn, pigmentation, photoaging, skin cancer, and the like.

In the present specification, the term "skin barrier improvement" means to include both skin barrier strengthening and protective functions. It is made up of corneocytes. The multi-lamellar lipid layer formed of intercellular lipids such as ceramide, cholesterol, and fatty acids synthesized by keratinocytes of the skin barrier, maintained through normal epidermal cell division and differentiation, is a protective barrier to prevent evaporation of moisture in the skin. play a role On the other hand, among these intercellular lipids, omega hydroxy ceramide is chemically covalently linked to involucrin, a protein of the outer layer of corneocytes, to form a corneocyte lipid envelope (CLE), thereby forming a multilayer lipid membrane. It plays a role in strengthening the barrier function by physically stabilizing the intercellular lipid in the form. The skin barrier improvement is a skin disease caused by weakening of the skin barrier function, such as psoriasis, contact dermatitis, eczematous dermatitis, actinic dermatitis, seborrheic dermatitis, dermatitis herpetiformis, lichen planus, lichen sclerosus, pyoderma gangrenosum, pemphigus, bullous epidermis It can mean any action that alleviates exfoliation, systemic sclerosis or leprosy or improves the damaged skin barrier function.

As used herein, the term "acceptable" means exhibiting properties that are not toxic to cells or humans exposed to the composition.

As used herein, the term "acceptable salt" refers to a salt prepared using a specific compound according to one aspect and a relatively non-toxic acid or base. When the compounds contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of base in neat solution or in a suitable inert solvent. Pharmaceutically acceptable base addition salts include salts of sodium, potassium, calcium, ammonium, organic amines, or magnesium or similar salts. When the compounds contain relatively basic functional groups, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of an acid in neat solution or in a suitable inert solvent. Pharmaceutically acceptable acid addition salts include salts of inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, hydrogen carbonate ion, phosphoric acid, hydrogen phosphate ion, dihydrogen phosphate ion, sulfuric acid, hydrogen sulfate ion, hydroiodic acid or phosphorous acid; and salts of organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-tolylsulfonic acid, citric acid, tartaric acid, and methanesulfonic acid. and salts of amino acids (eg, arginine) and salts of organic acids such as glucuronic acid.

The acceptable salts can be synthesized by conventional chemical methods from parent compounds containing acidic or basic moieties. Generally, these salts are prepared by reacting the free acid or base form of these compounds with an appropriate stoichiometric amount of the base or acid, either in water or in an organic solvent or in a mixture of the two. In general, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol or acetonitrile are preferred.

The 2-phloroeckol compound may be included in an amount of 0.001 to 10% by weight based on the total weight of the cosmetic composition. For example, 0.001 to 5% by weight, 0.001 to 3% by weight, 0.001 to 1% by weight, 0.01 to 10% by weight, 0.01 to 5% by weight, 0.01 to 3% by weight, 0.01 to 1% by weight, 0.1 to 10% by weight %, 0.1 to 5% by weight, 0.1 to 3% by weight, or 0.1 to 1% by weight. In addition, a rhubarb extract may be further included in the composition.

The cosmetic composition includes lotion (skin lotion), toner, skin softener, skin toner, astringent, lotion, milk lotion, moisture lotion, nutrient lotion, massage cream, nutrient cream, moisture cream, hand cream, hand sanitizer, foundation, essence, Nutritional essence, packs, soaps, cleansing foams, cleansing lotions, cleansing creams, body lotions, body cleansers, suspensions, gels, powders, pastes, mask packs, and can be prepared into formulations including sheets. Compositions of such formulations may be prepared according to conventional methods in the art. The blending amount of the additional ingredients such as the moisturizing agent can be easily selected by those skilled in the art within a range that does not impair the objects and effects of the present invention.

The cosmetic composition may further include functional additives and ingredients included in general cosmetic compositions in addition to the active ingredients disclosed herein, and commonly used purified water, thickeners, preservatives, stabilizers, solubilizers, surfactants, carriers, A flavoring agent or a combination thereof may be further included. The functional additive may include a component selected from the group consisting of water-soluble vitamins, oil-soluble vitamins, high-molecular peptides, high-molecular polysaccharides, sphingolipids, and seaweed extracts. Alcohols, oils, surfactants, fatty acids, silicone oils, wetting agents, humectants, viscosity modifiers, emulsions, stabilizers, UV scattering agents, UV absorbers, coloring agents, perfumes, and the like may be exemplified as the carrier. Compounds/compositions that can be used as the alcohol, oil, surfactant, fatty acid, silicone oil, wetting agent, humectant, viscosity modifier, emulsion, stabilizer, UV scattering agent, UV absorber, coloring agent, fragrance, etc. are already known in the art. Since there is, those skilled in the art can select and use an appropriate corresponding material / composition. In addition, the cosmetic composition, if necessary, sunscreen, antioxidants (butylhydroxyanisole, gallic acid propyl, ellisorbic acid, tocopheryl acetate, butylated hydroxytoluene, etc.), preservatives (methylparaben, butylparaben , propylparaben, phenoxyethanol, imidazolidinylurea, chlorphenesin, etc.), colorant, pH adjuster (triethanolamine, citric acid, citric acid, sodium citrate, malic acid, sodium malate, fumaric acid, sodium fumarate, succinic acid , sodium succinate, sodium hydroxide, sodium hydrogen phosphate, etc.), humectants (glycerin, sorbitol, propylene glycol, butylene glycol, hexylene glycol, diglycerin, betaine, glycereth-26, methylglue Seth-20, etc.) and lubricants may be further added.

In addition, in the cosmetic composition of each formulation, appropriate components may be selected and blended according to the cosmetic formulation or purpose of use. Since the formulation components and methods may follow conventional techniques, detailed descriptions thereof are omitted herein.

Another aspect provides a health functional food composition for skin improvement comprising a 2-phloroeckol compound represented by Formula 1 or a food chemically acceptable salt thereof as an active ingredient:

[Formula 1]

.

In one embodiment, the 2-phloroeckol compound may be isolated from rhubarb ( Eisenia bicyclis ) extract.

In one embodiment, the skin improvement may be one or more selected from the group consisting of skin barrier improvement, skin damage prevention or improvement, skin moisturizing, skin immunity improvement, skin defense enhancement, skin inflammation inhibition, skin soothing and skin regeneration. .

When the 2-phloroeckol compound is used as a food additive, the compound may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to a conventional method. The mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment). For example, the 2-phloroeckol compound is 0.0001 to 99.0% by weight, for example, 0.01 to 60% by weight, 0.01% to 40% by weight, 0.01% to 30% by weight, 0.01% to 30% by weight, based on the total weight of the composition. 0.01 wt% to 10 wt%, 0.01 wt% to 5 wt%, 0.05 wt% to 60 wt%, 0.05 wt% to 40 wt%, 0.05 wt% to 30 wt%, 0.05 wt% to 20% by weight, 0.05% to 10% by weight, 0.05% to 5% by weight, 0.1% to 60% by weight, 0.1% to 40% by weight, 0.1% to 30% by weight, 0.1% to 20% by weight 0.1% to 10%, 0.1% to 5%, 5 to 20%, 5 to 18%, 6 to 15%, 8 to 15% or 7 to 10% by weight it may be However, in the case of long-term intake for the purpose of health and hygiene or health control, it may be below the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

The 2-phloroekcol compound may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to conventional methods.

There is no particular limitation on the type of food. Examples of foods to which the above substances may be added include powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, leached teas, and formulations selected from the group consisting of health drinks, etc. It includes all health foods in the usual sense.

The health beverage composition of the present invention may include various flavoring agents or natural carbohydrates as additional components, like conventional beverages. The aforementioned natural carbohydrates may include monosaccharides such as glucose and fructose, disaccharides such as maltose and sucrose, natural sweeteners such as dextrin and cyclodextrin, and synthetic sweeteners such as saccharin and aspartame. The proportion of the natural carbohydrate is generally about 0.01 to 10 g, preferably about 0.01 to 0.1 g per 100 ml of the composition of the present invention.

The health functional food may include food additives acceptable in food science, and may include appropriate carriers commonly used in the manufacture of health functional food.

In addition to the above, the composition of the present invention contains various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages; and the like. In addition, the composition of the present invention may include fruit flesh for preparing natural fruit juice, fruit juice beverages, and vegetable beverages. These components may be used independently or in combination. The ratio of these additives is not critical, but is generally selected in the range of 0.01 to 0.1 part by weight per 100 parts by weight of the composition of the present invention.

Another aspect provides a pharmaceutical composition for preventing or treating skin damage comprising a 2-phloroeckol compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient:

[Formula 1]

.

Another aspect provides a method for preventing, improving or treating skin damage comprising administering an effective amount of the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof to a subject in need thereof. .

Another aspect provides a use of the 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof for preparing a composition for skin improvement, prevention, improvement or treatment of skin damage.

The term "pharmaceutical composition" can refer to a molecule or compound that imparts some beneficial effect upon administration to a subject. Beneficial effects may include enabling diagnostic determination; amelioration of a disease, symptom, disorder or condition; reducing or preventing the occurrence of a disease, condition, disorder or condition; and responding to a disease, symptom, disorder or condition in general.

The term "prevention" refers to partially or completely delaying or preventing the onset or recurrence of a disease, disorder, or its attendant symptoms, preventing the acquisition or re-acquisition of a disease or disorder, or the risk of acquiring a disease or disorder. tells how to reduce For example, the prevention refers to any action that inhibits or delays the occurrence of skin damage or symptoms by administration of the composition according to the present invention.

The term "treatment" includes the inhibition, alleviation or elimination of the development of a disease.

The term "improvement" may refer to any action that at least reduces a parameter associated with alleviation or treatment of a condition, eg, the severity of a symptom.

The pharmaceutical composition can be administered parenterally during clinical administration and can be used in the form of a general pharmaceutical preparation. Parenteral administration may refer to administration through an administration route other than oral, such as rectal, intravenous, peritoneal, intramuscular, arterial, transdermal, nasal, inhalation, ocular and subcutaneous administration. When the pharmaceutical composition of the present invention is used as a medicine, it may additionally contain one or more active ingredients exhibiting the same or similar functions.

Types of pharmaceutically active ingredients capable of delivering the active ingredient into the subject include anticancer agents, contrast agents (dye), hormones, anti-hormonal agents, vitamins, calcium agents, mineral preparations, saccharide preparations, organic acid preparations, protein amino acid preparations, detoxifying agents, and enzymes. Preparations, metabolic preparations, diabetes concomitant medicines, tissue regeneration medicines, chlorophyll preparations, pigment preparations, tumor medicines, tumor treatment agents, radiopharmaceuticals, tissue cell diagnostic agents, tissue cell therapy agents, antibiotics preparations, antiviral agents, complex antibiotics preparations, chemicals Therapeutic agents, vaccines, toxins, toxoids, antitoxins, leptospira serum, blood products, biological agents, analgesics, immunogenic molecules, antihistamines, allergy medications, non-specific immunogenic agents, anesthetics, stimulants, psychoactive agents, small molecule compounds, nucleic acids, It may include aptamers, antisense nucleic acids, oligonucleotides, peptides, siRNAs, and micro RNAs.

The pharmaceutical composition may be prepared by further including one or more pharmaceutically acceptable carriers. A pharmaceutically acceptable carrier may be a mixture of saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol, and one or more of these components, and, if necessary, antioxidants and buffers. , bacteriostatic agents and other conventional additives may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to prepare formulations for injections such as aqueous solutions, suspensions, and emulsions, pills, capsules, granules, or tablets. Furthermore, it can be preferably formulated according to each disease or component by an appropriate method in the art.

When formulating the pharmaceutical composition, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for the suppository, Witepsol, Macrogol, Tween 61, cacao butter, liurine fat, glycerogeratin and the like may be used.

The pharmaceutical composition may include carbohydrates such as glucose, sucrose or dextran, antioxidants such as ascorbic acid or glutathione, chelating agents, and small molecules in order to increase stability or absorption. Proteins or other Stabilizers can be used as pharmaceuticals.

Another aspect provides a method of treating skin damage comprising administering the pharmaceutical composition to a subject.

The term “administering” means providing a pharmaceutical composition to a subject by any suitable method.

A pharmaceutically effective amount and an effective dosage of the pharmaceutical composition may vary depending on the formulation method, administration method, administration time and/or route of administration of the pharmaceutical composition. In addition, the type and degree of response to be achieved by administration of the pharmaceutical composition, the type of subject to be administered, age, weight, general health condition, symptom or degree of disease, gender, diet, excretion, simultaneous or It may vary according to various factors including drugs and other components of the composition used together in this case, and similar factors well known in the medical field. A person of ordinary skill in the art can readily determine and prescribe an effective dosage for the desired treatment. Administration of the pharmaceutical composition according to the present invention can be administered once a day, divided into several administrations. Therefore, the dosage is not intended to limit the scope of the present invention in any way. The dosage of the pharmaceutical composition may be 1 ug/kg/day to 1,000 mg/kg/day.

The subject may be a mammal, such as a human, cow, horse, pig, dog, sheep, goat, or cat. The subject may be a subject in need of healing of skin damage.

Another aspect provides a skin external preparation for preventing or improving skin damage, comprising a 2-phloroeckol compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient:

[Formula 1]

.

The external skin preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof. The external skin preparation is a component usually used in external preparations for skin such as cosmetics or pharmaceuticals, for example, water-based components, oil-based components, powder components, alcohols, moisturizers, thickeners, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, and fragrances. , colorants, various skin nutrients, or combinations thereof and may be suitably blended as needed. The external skin preparations include metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, bellapamil, licorice extract, glabridin, and calin. Hot-water extracts of fruits, various herbal medicines, tocopherol acetate, glycyrrhizic acid, tranexamic acid and its derivatives or salts and other drugs, vitamin C, magnesium ascorbate phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can also be mix|blended suitably.

The skin includes all skin areas of the body, including the face, hands, arms, legs, feet, chest, stomach, back, buttocks, and scalp.

The terms, methods, and effects described for the above invention are equally applied between each invention.

A composition containing a 2-phloroeckol compound according to one aspect as an active ingredient can be effectively used for skin improvement by promoting collagen synthesis, inhibiting collagen degradation, reducing the expression of inflammatory factors, and increasing the expression of skin barrier-related factors.

1 shows a negative-ion mode (ESIMS) spectrum of 2-phloroeckol.

2 shows the ¹ H-NMR spectrum of 2-phloroeckol.

3 shows HPLC spectra of rhubarb extract and 2-phloroeckol.

Figure 4 shows the UV λmax spectrum of Dieckol.

5 shows a 1 H-NMR spectrum of Dieckol.

6 shows HPLC spectra of rhubarb extract and Dieckol.

7 is a graph evaluating the cytotoxicity of 2-phloroeckol in dermal cells.

8 is a graph comparing the MMP-1 inhibitory effect of 2-phloroeckol in dermal cells damaged by ultraviolet rays.

9 is a graph comparing the MMP-1 inhibitory effect of dieckol in dermal cells damaged by ultraviolet rays.

Figure 10 is a graph comparing the amount of procollagen production of 2-phloroeckol in dermal cells damaged by ultraviolet rays.

11 is a graph comparing the amount of procollagen produced by diekcol in dermal cells damaged by ultraviolet rays.

Figure 12 is a diagram showing phosphorylation changes of signaling factors that regulate the expression of MMPs in dermal cells damaged by ultraviolet rays:

12a is a diagram showing phosphorylation changes of ERK, JNK, and p38; and FIG. 12b is a diagram showing changes in phosphorylation of c-fos.

13 is a picture analyzing the mechanism of inhibiting the expression of MMP in dermal cells damaged by ultraviolet rays.

Figure 14 is a picture showing the effect of rhubarb extract and dieckol on the skin wrinkle formation on the back of mouse skin damaged by ultraviolet rays.

15 is a graph showing the effects of rhubarb extract and dieckol on increasing skin thickness on the back of mice skin damaged by ultraviolet rays:

Figure 15a is a graph showing the effect of increasing the skin thickness of the back when rhubarb extract was administered; and FIG. 15B is a graph showing the effect of increasing skin thickness on the back when dieckol was administered.

Figure 16 is a graph showing the transdermal water content of rhubarb extract and dieckol in mouse skin damaged by ultraviolet rays:

Figure 16a is a graph showing the transdermal water content in the case of administration of rhubarb extract; And Figure 16b is a graph showing the transdermal water content when dieckol was administered.

Figure 17 is a graph showing the degree of transdermal water loss of rhubarb extract and dieckol in mouse skin damaged by ultraviolet rays:

Figure 17a is a graph showing the degree of transepidermal water loss in the case of administration of rhubarb extract; And Figure 17b is a graph showing the degree of transepidermal water loss when dieckol was administered.

18 is a graph comparing the cytotoxicity of 2-phloroeckol in epidermal cells.

19 is a graph showing the increase in filaggrin expression of 2-phloroeckol in epidermal cells damaged by ultraviolet rays.

20 is a graph showing an increase in the expression level of involucrin of 2-phloroeckol in epidermal cells damaged by ultraviolet rays.

21 is a graph showing an increase in the expression level of 2-phloroeckol and loricrin in epidermal cells damaged by ultraviolet rays.

22 is a graph showing the decrease in the expression of IL-1β of 2-phloroeckol in epidermal cells induced by fine dust.

23 is a graph showing the decrease in the amount of IL-8 expression of 2-phloroeckol in epidermal cells in which an inflammatory response was induced by fine dust.

24 is a graph showing the decrease in TNF-α expression of 2-phloroeckol in epidermal cells induced by fine dust.

It will be described in more detail through the following examples. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

Example 1: Rhubarb ( Eisenia bicyclis (Kjellman) Setchell) Preparation of extract

The rhubarb extract contained in the composition of the present invention was prepared by the following process.

First, rhubarb, which grows wild in Korea, was washed thoroughly with distilled water, desalted, and then completely dried in a cool place without sunlight until there was no change in weight. Then, after preparing 8400 kg of 30% fermented alcohol (30 times, w/w) to the completely dried dried product, 280 kg of the dried product was added. At this time, the mixing ratio of the dry matter and 30% fermented alcohol was 30 times the weight ratio. Next, 30% fermented alcohol mixed with the dry matter was put in a constant temperature water bath and stirred and extracted at 60 ° C. for 5 hours. The extracted sample was filtered with a housing filter (10 μm) and then concentrated under reduced pressure. 274 kg of the concentrate was sterilized at 90° C. for 1 hour, and then filtered through a bag filter (100 μm). The concentrate was homogenized by adding maltodextrin to a solid content of 50% (w/w), and then a water-soluble powder was obtained through spray drying.

Example 2: Preparation of 2-phloroeckol

After adding 3 times distilled water to the extracted powder obtained in Example 1, coating was performed using Silica gel 60. An extract was prepared using ethyl acetate on the coating. The extract was subjected to gel filtration using Diaion HP-20 resin. The developing solvent was solvent-fractionated using a 10% - 100% methanol mixed solution and divided into 5 small fractions (Fr. 1 to 5). Small fraction 2 (Fr.2) was subjected to gel filtration using Silica gel 60 resin. It was divided into 5 small fractions (Fr.2-1 to 5) using chloroform: methanol = 17:3 as a developing solvent, and among them, the Fr.2-3 fraction was subjected to gel filtration using Sephadex LH-20 resin. The developing solvent was solvent fractionated using a 20% - 100% methanol mixed solution and divided into 7 small fractions (Fr.2-3-1~7). From the two small fractions 2-3-6, 2-phloroeckol compound 1 (2-phloroeckol) was obtained in pure form.

In order to confirm the structure of the compound 1, as a result of ESIMS (negative-ion mode) confirmation, as shown in FIG. 1, m/z = 495 [MH]- was found. In addition, in ¹ H-NMR, as shown in FIG. 2, one hydrogen was confirmed at δH 5.76 and δH 5.94 with a meta coupling J-value of 3Hz due to C-5 and C-8, respectively. At δH 5.78, the proton attributed to C-3 appeared as a singlet, and at δH 5.81, a single peak could be identified. It was found that the peak corresponding to the hydrogen of The H-4' proton at δH 5.79 and 1,3,5-trisubstituted benzene appears as a triplet by meta-coupling with H-2' and H-6' hydrogen, and at δH 5.83, 1,3,5-trisubstituted benzene H It was found that -2' and 6' hydrogens were doublet peaks with a J-value of 1.5 Hz, corresponding to one and two hydrogens, respectively.

By synthesizing the above results and comparing them with the literature, it was confirmed that compound 1 was 2-phloroeckol (Bioorg Med Chem 2013, 21(13), 3730-3737).

Example 3: Preparation of Dieckol

After adding 3 times distilled water to the extracted powder obtained in Example 1, coating was performed using Silica gel 60. An extract was prepared using ethyl acetate on the coating. The extract was subjected to gel filtration using Diaion HP-20 resin. The developing solvent was solvent-fractionated using a 10% - 100% methanol mixed solution and divided into 5 small fractions (Fr. 1 to 5). Small fraction 3 (Fr.3) was subjected to gel filtration using RP resin. It was divided into 7 small fractions (Fr.3-1~7) using 10% - 100% methanol as a developing solvent, and among them, the Fr.3-4 fraction was subjected to gel filteration using Sephadex LH-20 resin. The developing solvent was solvent fractionated using a 20% - 100% methanol mixed solution and divided into three small fractions (Fr.3-5-1~3). Dieckol Compound 1 (Dieckol) was obtained in pure form from the small fraction 2-5-2.

In order to confirm the structure of the compound 1, ESIMS (negative-ion mode) was first confirmed, and m/z = 743 [M+H]+ was found. As a result of specifying the maximum absorbance for the compound, it was confirmed as 202,232,290 nm (see FIG. 4). In ¹ H-NMR (see FIG. 5), single peaks resulting from one hydrogen (C-3'', C-3) appeared at δ6.17 and 6.14 ppm in 1H NMR, respectively, and δ6.02, A doublet peak corresponding to one hydrogen (C-5, C-8'') at 5.99 ppm, and a doublet peak corresponding to two hydrogens (C-2''', C-6''') at δ5.95 ppm. A single peak was identified. The doublet peak resulting from the C-6'' hydrogen appearing at δ5.80 ppm and the triplet peak originating from the C-4' hydrogen overlap and appear as multiplets, and at δ5.72 ppm two hydrogens (C-2', C- 6') appeared as a doublet peak. By synthesizing the above results and comparing them with the literature, it was confirmed that compound 1 was Dieckol. (ioorg Med Chem.2013, 21(13), 3730-3737)

Experimental Example 1: 2-phloroeckol content analysis of rhubarb extract

The extracted powder obtained in Example 1 and the 2-phloroeckol obtained in Example 2 of the present invention were analyzed by high-performance liquid chromatography (HPLC) and a UV/Vis detector. Waters e2695 Series system, Waters 24489 UV/Vis detector (Worcester, MA, USA), Luna C18(2) (5 ㎛, 250 Х 4.6 ㎜, Phenomenex, Torrance, CA, USA) column were used as the HPLC instrument. All solvents used were J.T. HPLC grade solvents purchased from Baker (Phillipsburg, NJ, USA) were used. At the time of analysis, the temperature of the column was set to 30 °C, the injection volume was set to 10 µl, and the measurement wavelength was set to 230 nm. As the mobile phase, acetonitrile (ACN) and tertiary distilled water (D.W) were used, and the ACN-D.W (1:9 - 10:0, v/v) mixed solution was analyzed at a rate of 1 ml/min for 50 minutes. For the analysis sample, 200 mg of the extracted powder obtained in Example 1 was precisely weighed, 10 ml of methanol was added, dissolved in an ultrasonic shaker for 20 minutes, allowed to cool at room temperature, and the supernatant was filtered through a 0.45 μm membrane filter for use. Example 2 2-phloroeckol obtained by precisely weighing 10 mg, adding 40 ml of methanol, dissolving in an ultrasonic shaker for 20 minutes, cooling at room temperature, adding methanol, and filtering through a 0.45 μm membrane filter. For each analysis sample, the chromatogram was extracted at 230 nm, and the rhubarb extract and 2-phloroeckol peaks were compared and analyzed as shown in FIG.

Experimental Example 2: Diekcol content analysis of rhubarb extract

The extracted powder obtained in Example 1 and the D-Ecol obtained in Example 2 of the present invention were analyzed by high-performance liquid chromatography (HPLC) and a UV/Vis detector. The HPLC instrument used was a Waters e2695 Series system, a Waters 24489 UV/Vis detector (Worcester, MA, USA), and a Luna C18(2) (5 μm, 250 Х 4.6 mm, Phenomenex, Torrance, CA, USA) column. All solvents used were J.T. HPLC grade solvents purchased from Baker (Phillipsburg, NJ, USA) were used. At the time of analysis, the temperature of the column was set to 30°C, the injection volume was 10 μl, and the measurement wavelength was set to 230 nm. As the mobile phase, acetonitrile (ACN) and tertiary distilled water (D.W) were used, and the ACN-D.W (1:9 - 10:0, v/v) mixed solution was analyzed at a rate of 1 ml/min for 50 minutes. For the analysis sample, 200 mg of the extracted powder obtained in Example 1 was precisely weighed, 10 ml of methanol was added, dissolved in an ultrasonic shaker for 20 minutes, allowed to cool at room temperature, and the supernatant was filtered through a 0.45 μm membrane filter for use. 10 mg of the obtained diechol was precisely weighed, added with 40 ml of methanol, dissolved in an ultrasonic shaker for 20 minutes, allowed to cool at room temperature, and then filtered with a 0.45 μm membrane filter after adding methanol. For each analysis sample, the chromatogram was extracted at 230 nm, and the rhubarb extract peak and the diechol peak were compared and analyzed as shown in FIG. 6.

Experimental Example 3: Evaluation of cytotoxicity

With respect to the 2-phloroeckol obtained in Example 2, it was confirmed whether damage to dermal cells or epidermal cells exposed to ultraviolet rays could be restored. In order to confirm the efficacy of preventing or improving skin cell damage by ultraviolet rays, dermal cells (Hs68) were attached to a 96-well plate at a concentration of 1.0 X 10 ⁴ cells/well for 24 hours to stabilize them. In order to irradiate ultraviolet rays, the existing medium was removed, washed with PBS, and then treated with UVB at 15 mJ/cm ² . Then, after culturing for 24 hours using the medium treated with the sample, the degree of cell viability was measured by MTT assay. The MTT assay is a method for measuring the amount of formazan formed from reduced MTT by mitochondria of living cells. More specifically, each cell was treated with 100 μl of 0.5 mg/ml MTT solution and incubated for 4 hours, then the solution was completely removed and the plate dissolved in DMSO was measured at 540 nm absorbance.

In order to confirm cytotoxicity to epidermal cells, epidermal cells (HaCaT) were attached to a 96-well plate at a concentration of 1.0 X 10 ⁴ cells/well and stabilized for 24 hours. Thereafter, each concentration sample was replaced with the treated medium and cultured for 24 hours. Then, the degree of cell viability was measured by MTT assay.

As shown in FIGS. 7 and 18, cytotoxicity was not shown at all concentrations of 2-phloroeckol of Example 2 in dermal cells or epidermal cells, and based on the cytotoxicity test, the treatment concentration of 2-phloroeckol in subsequent experimental examples was determined.

Experimental Example 4: Evaluation of MMP-1 content change

It was confirmed whether 2-phloroeckol and dieckol obtained in Examples 2 and 3 could inhibit the secretion of MMP-1 from dermal cells Hs68 fibroblast. In order to confirm whether MMP-1 can be reduced by material treatment, each cell was dispensed on a 24-well plate at a concentration of 1.0 X 10 ⁵ cells/well and stabilized for 24 hours. To irradiate ultraviolet (UVB), the existing medium was removed, washed with PBS, and then treated with UVB at 15 mJ/cm ² . Then, after culturing for 24 hours using the medium treated with the sample, the level of MMP-1 secretion was measured in the supernatant using the MMP-1 Human ELISA Kit (ab100603, Abcam, US).

As shown in FIGS. 8 and 9, the concentration of MMP-1 was increased in dermal cells damaged by 15 mJ/cm ² of UVB, and 2-phloroeckol and dieckol of Examples 2 and 3 inhibited MMP-1 production. decreased in a concentration dependent manner. In addition, since the effects of 2-phloroeckol and dieckol in Examples 2 and 3 on MMP-1 production inhibition were significantly shown, it was confirmed that 2-phloroeckol and dieckol were effective in improving skin damage caused by ultraviolet rays.

Experimental Example 5: Evaluation of content change of procollagen type 1

With respect to 2-phloroeckol and dieckol obtained in Examples 2 and 3, it was confirmed whether procollagen type 1 could be increased in dermal cells Hs68 fibroblast. In order to confirm whether the secretion amount of procollagen type 1 can be increased according to material treatment, each cell was dispensed on a 24-well plate at a concentration of 1.0 X 10 ⁵ cells/well and stabilized for 24 hours. To irradiate UVB, the existing medium was removed, washed with PBS, and treated with UVB at 15 mJ/cm ² . Then, after culturing for 24 hours using the medium treated with the sample, the secretion level of procollagen type 1 was measured in the supernatant using a Procollagen Type I C-peptide (PIP) EIA kit (Mk101, Takara, Japan).

As shown in FIGS. 10 and 11, 2-phloroeckol and dieckol of Examples 2 and 3 increased the amount of procollagen production in dermal cells damaged by 15 mJ/cm ² UVB. In addition, as seen from the fact that 2-phloroeckol and dieckol of Examples 2 and 3 increased the amount of procollagen production in a concentration-dependent manner, 2-phloroeckol and dieckol help regenerate collagen fibers decomposed by ultraviolet rays to prevent or prevent skin damage caused by ultraviolet rays. confirmed to improve.

Experimental Example 6: Evaluation of changes in phosphorylation regulation of MAPK (mitogen-activated protein kinase) and AP-1 (activator protein-1) complex

With respect to dieckol obtained in Example 3, MAPK signaling that regulates MMP expression and phosphorylation of AP-1 complex, a sub-signal thereof, were confirmed. In order to confirm whether the expression levels of MAPK and AP-1 complex can vary depending on material treatment, each cell was dispensed on a 60 mm plate at a concentration of 2.0 X 10 ⁶ cells and stabilized for 24 hours. Then, in order to irradiate UVB, the existing medium was removed, washed with PBS (Phosphate Buffer Solution), and UVB was treated with 15 mJ/cm ² . After culturing for 1 hour using the medium treated with the sample, intracellular proteins were extracted with RIPA buffer (Radioimmunoprecipitation assay buffer). After separating 20 μg of each extracted protein by SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis), transferred to a nitrocellulose membrane, the primary antibodies (MAPK: phospho-p38, phospho-ERK, phospho-JNK, AP-1: phospho-c-fos) was treated for 24 hours. After that, the degree of phosphorylation of each protein was confirmed through chemiluminescence analysis.

As shown in FIGS. 12a and 12b, it was confirmed that dieckol effectively inhibits phosphorylation of p38 and extracellular signal regulated kinase (ERK) among MAPK proteins in dermal cells damaged by 15 mJ/cm ² UVB. In addition, it was confirmed that dieckol effectively reduced the phosphorylation of c-fos, which was increased by UVB treatment, in the AP-1 complex, a sub-factor of MAPK. As a result, it was confirmed that dieckol prevents or improves skin damage caused by ultraviolet rays by also inhibiting the mechanism of regulating the expression of MMP-1 (Matrix Metalloproteinase-1).

Experimental Example 7: Evaluation of expression change of TIMP (tissue inhibitor of matrix metalloproteinase)

In order to analyze the mechanism of inhibiting the expression of MMP with respect to dieckol obtained in Example 3, the expression regulation of TIMP (tissue inhibitor of matrix metalloproteinase) was confirmed. In order to confirm whether the amount of expression of TIMP can vary depending on the material treatment, each cell was dispensed on a 60 mm plate at a concentration of 2.0 X 10 ⁶ cells and stabilized for 24 hours. Then, in order to irradiate UVB, the existing medium was removed, washed with PBS (Phosphate Buffer Solution), and UVB was treated with 15 mJ/cm ² . After culturing for 1 hour using the medium treated with the sample, intracellular proteins were extracted with RIPA buffer (Radioimmunoprecipitation assay buffer). 20 μg of each extracted protein was separated by SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis), transferred to a nitrocellulose membrane, and treated with primary antibodies (TIMP: TIMP-1, TIMP-2) for 24 hours. After that, the degree of phosphorylation of each protein was confirmed through chemiluminescence analysis.

As shown in FIG. 13, although the expression of TIMP-1 and TIMP-2 was decreased in dermal cells damaged by 15 mJ/cm ² UVB, it was confirmed that dieckol effectively restored the protein expression level. As a result, it was confirmed that dieckol prevents or improves skin damage caused by ultraviolet rays by regulating the mechanism of suppressing the expression of MMP-1 (Matrix Metalloproteinase-1).

Experimental Example 8: In vivo effect analysis of rhubarb extract and dieckol

8-1. Mice and Experimental Design

In order to analyze the anti-wrinkle effect of the mice exposed to ultraviolet light for the rhubarb extract and dieckol of Examples 1 and 3, an animal model irradiated with ultraviolet light was first prepared. 5-week-old male HR-1 hairless mice (specific-pathogen-free (SPF) grade, 18 ± 2 g, Orient Bio) were set into 7 groups as follows, and 10 mice per group were tested. UV irradiation was irradiated 3 times a week for 7 weeks using a UVP crosslinker, and the UVB irradiation energy gradually increased at 60 mJ/cm ² . 60 mJ/cm ² for 1-3 weeks, 120 mJ/cm ² for 4-5 weeks, and 180 mJ/cm ² for 6-7 weeks. As a control group, normal mice (Vehicle (Control)) to which nothing was administered without irradiation with UV rays and mice irradiated with UV rays (UVB+Vehicle) to which nothing was administered after irradiation with UV rays were placed, respectively. In the experimental group, 50 mg/kg, 100 mg/kg, and 200 mg/kg of the rhubarb extract (EEB) of Example 1 were orally administered to mice irradiated with ultraviolet light, and dieckol of Example 3 was administered at 5 mg/kg and 10 mg/kg, respectively. kg orally administered. The rhubarb extract and dieckol of Examples 1 and 3 were orally administered 5 days per week during the administration period, respectively. The dark:light cycle was maintained at 12-hour:12-hour intervals, and water was freely consumed.

8-2. Evaluation of changes in back skin thickness, transepidermal water content and transepidermal water loss in UV-irradiated mice

In order to analyze the wrinkle formation inhibitory effect of the rhubarb extract and dieckol of Examples 1 and 3 on mice exposed to ultraviolet rays, the formation of wrinkles on the skin of the back of the mouse was confirmed. Skin wrinkle formation on the mouse dorsal skin was observed immediately after mouse sacrifice after 7 weeks. The degree of skin wrinkle formation was measured by analyzing the skin surface of the dorsal side of the mouse using a skin copy plate. In addition, on the day of sacrifice, the dorsal skin thickness of the mouse was measured using a bipod. Epidermal water content and transepidermal water loss (TEWL) were measured using GPSkin Barrier® (GPOWER Inc., Seoul, Korea).

As shown in FIGS. 14, 15a and 15b, it was observed that wrinkles were formed on the back skin of the UVB irradiated control group and the thickness of the back skin was increased, but rhubarb extract and dieckol reduced back skin wrinkles in a concentration-dependent manner and increased back skin thickness was found to effectively reduce

In addition, as shown in FIGS. 16a, 16b, 17a and 17b, the UVB irradiation control group decreased the transepidermal water content and increased the transepidermal water loss, but it could be confirmed that the skin water content and water loss were effectively restored by the rhubarb extract and dieckol. there was. As a result, it was confirmed that the rhubarb extract and dieckol prevent or improve skin damage caused by ultraviolet rays by confirming that they are effective in inhibiting and moisturizing skin wrinkles caused by ultraviolet rays in an animal model irradiated with ultraviolet rays.

Experimental Example 9: Evaluation of changes in skin barrier-related gene expression

In order to confirm the skin moisturizing effect of 2-phloroeckol obtained in Example 2, each sample was treated by concentration in HaCaT keratinocyte epidermal cells, and changes in the expression of skin barrier-related genes filaggrin, involucrin and loricrin were observed. Confirmed.

Specifically, 1x10 ⁶ cells of HaCaT cells were dispensed in DMEM medium (Hyclone SH30243.01) supplemented with 10% FBS in a 6-well plate and stabilized for 24 hours. To irradiate UVB, the existing medium was removed, washed with PBS, and treated with UVB at 15 mJ/cm ² . Thereafter, after culturing for 24 hours using the medium treated with the sample, the existing medium was removed, cultured for 24 hours in a serum starvation state, and then treated with trypsin-EDTA to recover cell pellets. After that, RNA was extracted from the obtained cells using Trizol reagent, cDNA was synthesized from the obtained RNA using a cDNA synthesis kit (Bio-Rad), and quantitative real time-PCR (qRT-PCR) was performed using this as a template. PCR) was performed (LightCycler 96, Roche, Switzerland). The RT-PCR reaction was performed under the condition of 40 cycles of 95 °C for 10 seconds, 60 °C for 10 seconds, and 72 °C for 10 seconds after pre-incubation at 95 °C for 600 seconds. The expression level of the gene was finally analyzed through correction for the β-actin gene.

gene	primer direction	Primer sequence (5'→ 3')	sequence number
filaggrin	Forward	AGTGCACTCAGGGGGCTCACA	One
	Reverse
CCGGCTTGGCCGTAATGTGT	2
involucrine	Forward		TTGGTCAGTGAAGCGATGAG	3
	Reverse	AGATCTGTCTGCAGGGCTGT	4
loli clean	Forward		TCATAAGAAACCCCGCTGAG	5
	Reverse	AAGGAAGGAGAGCCTGGAAG	6
β-actin	Forward	CATGTACGTTGCTATCCAGGC	7
	Reverse		CTCCTTAATGTCACGCACGAT	8

qRT-PCR was performed using the oligomers shown in Table 1 above as primers. The primer set is specific for filaggrin, involucrin, and loricrin genes, which are skin barrier-related genes. As shown in FIGS. 19 to 21, the expression levels of filaggrin, involucrin, and loricrin, which are skin barrier-related genes, were reduced in damaged epidermal cells when treated with ultraviolet rays. However, as 2-phloroeckol significantly increased all skin barrier-related genes, it was confirmed that 2-phloroeckol prevented or improved skin damage caused by ultraviolet rays by increasing the expression of skin barrier genes reduced from ultraviolet rays.

Experimental Example 10: Evaluation of changes in cytokine content related to fine dust

In order to evaluate the anti-inflammatory effect of the 2-phloroeckol obtained in Example 2 on fine dust, the cells were treated with fine dust (PM10) and the samples were treated to induce inflammatory cytokines, IL-1β and IL-8. And the expression level of TNF-α was measured. Specifically, 1x10 ⁶ cells of HaCaT cells were dispensed in DMEM medium (Hyclone SH30243.01) supplemented with 10% FBS in a 6-well plate and stabilized for 24 hours. In order to treat fine dust, the existing medium was removed, and after washing with PBS, 100 μg/ml of fine dust was treated. Then, the sample was cultured for 4 hours using the treated medium, and then mRNA was extracted from the cells, synthesized into cDNA, and quantitative real-time PCR was performed using a target template (primer), and finally, the level of gene expression of inflammatory cytokines. evaluated.

gene	primer direction	Primer sequence (5'→ 3')	sequence number
IL-1β	Forward	GTCATTCGCTCCCCACATTCT	9
	Reverse		ACTTCTTGCCCCCTTTGAAT	10
IL-8	Forward	CTGCGCCAACACAGAAATTA	11
	Reverse
ACTTCTCCACAACCCTCTGC	12
TNF-α	Forward	CCTCTCTCTAATCAGCCCTCTG	13
	Reverse	GAGGACCTGGGAGTAGATGAG	14
GAPDH	Forward		GGAGCGAGATCCCTCCAAAAT	15
	Reverse	GGCTGTTGTCATACTTCTCATGG	16

qRT-PCR was performed using the oligomers shown in Table 2 above as primers. The primer set is specific for IL-1β, IL-8 and TNF-α genes, which are inflammatory cytokine-related genes increased by fine dust. As shown in FIGS. 22 to 24, the expression of IL-1β, IL-8 and TNF-α, which are inflammatory cytokine-related genes, increased in damaged epidermal cells when fine dust was treated. However, since 2-phloroeckol reduces all inflammatory cytokine-related genes in a concentration-dependent manner, 2-phloroeckol reduces the expression of cytokines that were increased by fine dust to prevent or improve skin damage caused by fine dust. confirmed that it does.

The above results mean that 2-phloroeckol has an effect that can be usefully used for preventing, improving or treating skin damage caused by ultraviolet rays or fine dust.

Formulation Example 1: Preparation of tablets

For Example 2, tablets were prepared by mixing the ingredients in Table 3 below and tableting according to a conventional tablet manufacturing method.

raw material name	unit weight (mg)
Example 2	10.0000
silicon dioxide	15.3000
Magnesium Stearate	10.8000
crystalline cellulose	799.4951
Hydroxypropyl Methyl Cellulose	29.0700
Carboxymethyl Cellulose Calcium	27.0000
Glycerin fatty acid ester	0.6930
titanium dioxide	1.4697
red national pigment	4.4082
powdered caramel color	1.7640

Formulation Example 2: Preparation of capsules

With respect to Example 2, soft capsules were prepared by mixing the ingredients in Table 4 below and filling them into gelatin capsules according to the usual capsule preparation method.

raw material name	unit weight (mg)
Example 2	10
vitamin E	2.25
vitamin C	2.25
palm oil	0.5
hydrogenated vegetable oil	2
Yellow lead	One
lecithin	2.25
Soft capsule filling solution	427.75

Formulation Example 3: Preparation of liquid formulation

With respect to Example 2, the ingredients in Table 5 were mixed according to the beverage manufacturing method suitable for the taste and filled into a bottle or pouch to prepare a liquid formulation.

raw material name	unit weight (g)
Example 2	0.5050
xanthan gum	0.0075
fructooligosaccharide solution	0.7500
Coconut Flower Extract Powder	1.0500
Ssanghwa Concentrate	1.5000
Red Ginseng Fragrance	0.0450
Purified water	11.1425

Formulation Example 4: Preparation of Jelly

For Example 2, according to the jelly manufacturing method suitable for the taste, the ingredients in Table 6 were mixed and filled in a three-sided cloth to prepare jelly.

raw material name	unit weight (g)
Example 2	0.5000
food gel	0.3600
carrageenan	0.0600
calcium lactate	0.1000
sodium citrate	0.0600
complex gold extract	0.0200
Enzymatically Treated Stevia	0.0440
fructooligosaccharide solution	5.0000
Red Grape Concentrate	2.4000
Purified water	15.4560

Formulation Example 5: Preparation of nutrient cream

For Example 2, a nutritious cream was prepared according to a conventional method with the composition shown in Table 7 below.

Raw material	content (%)
Example 2	0.2
sitosterol	4.0
Polyglyceryl 2-oleate 3.0	3.0
Ceteares-4	2.0
cholesterol	3.0
dicetyl phosphate	0.4
concentrated glycerin	5.0
sunflower oil	22.8
carboxyvinyl polymer	0.5
triethanolamine	0.5
antiseptic	a very small amount
Spices	a very small amount
Purified water	balance

Although the above composition ratio is generally prepared as a formulation example by mixing suitable ingredients, the mixing ratio and raw materials may be arbitrarily changed as necessary.

Since the extract of the present invention is stable in all formulation test conditions, there was no problem with the stability of the formulation.

Claims (16)

1. A cosmetic composition for improving skin comprising a 2-phloroeckol compound represented by Formula 1 below or a cosmetically acceptable salt thereof as an active ingredient:

   [Formula 1]

   

   .
2. The cosmetic composition for skin improvement according to claim 1, wherein the 2-phloroeckol compound is isolated from rhubarb ( Eisenia bicyclis ) extract.
3. The cosmetic for skin improvement according to claim 1, wherein the skin improvement is one or more selected from the group consisting of skin barrier improvement, skin damage prevention or improvement, skin moisturizing, skin immunity improvement, skin defense enhancement, skin inflammation inhibition, skin soothing and skin regeneration. composition.
4. The cosmetic composition for skin improvement according to claim 1, wherein the composition protects the skin from external stimuli.
5. The cosmetic composition for skin improvement according to claim 4, wherein the external stimulus is ultraviolet rays or fine dust.
6. The cosmetic composition for skin improvement according to claim 1, wherein the 2-phloroeckol compound inhibits the expression of MMP-1 and increases procollagen synthesis.
7. The cosmetic composition for skin improvement according to claim 1, wherein the 2-phloroeckol compound reduces the expression of one or more selected from the group consisting of IL-1β, IL-8 and TNF-α.
8. The cosmetic composition for skin improvement according to claim 1, wherein the 2-phloroeckol compound increases the expression of one or more selected from the group consisting of filaggrin, involucrin, loricrin and CASP14.
9. A health functional food composition for skin improvement comprising a 2-phloroeckol compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient:

   [Formula 1]

   

   .
10. The health functional food composition for skin improvement according to claim 9, wherein the 2-phloroeckol compound is isolated from rhubarb ( Eisenia bicyclis ) extract.
11. The method according to claim 9, wherein the skin improvement is at least one selected from the group consisting of skin barrier improvement, skin damage prevention or improvement, skin moisturizing, skin immunity improvement, skin defense enhancement, skin inflammation inhibition, skin soothing and skin regeneration. Nutraceutical composition.
12. The method according to claim 9, wherein the health functional food has a formulation selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, leached teas, and health drinks. Health functional food composition.
13. A pharmaceutical composition for preventing or treating skin damage comprising a 2-phloroeckol compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient:

    [Formula 1]

    

    .
14. Skin external preparation for preventing or improving skin damage comprising a 2-phloroeckol compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient:

    [Formula 1]

    

    .
15. A method for preventing, improving or treating skin damage comprising administering an effective amount of a 2-phloroeckol compound represented by Formula 1 or a pharmaceutically acceptable salt thereof to a subject in need thereof:

    [Formula 1]

    

    .
16. Use of the 2-phloroeckol compound represented by Formula 1 below or a pharmaceutically acceptable salt thereof for the preparation of a composition for skin improvement, prevention, improvement or treatment of skin damage:

    [Formula 1]

    

    .

Images