WO2023219447A1 - 세포외 소포체 유래 mirna를 검출하는 제제를 포함하는 난소암 진단용 조성물 - Google Patents

세포외 소포체 유래 mirna를 검출하는 제제를 포함하는 난소암 진단용 조성물 Download PDF

Info

Publication number
WO2023219447A1
WO2023219447A1 PCT/KR2023/006436 KR2023006436W WO2023219447A1 WO 2023219447 A1 WO2023219447 A1 WO 2023219447A1 KR 2023006436 W KR2023006436 W KR 2023006436W WO 2023219447 A1 WO2023219447 A1 WO 2023219447A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
ovarian cancer
evs
mirna
composition
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2023/006436
Other languages
English (en)
French (fr)
Inventor
송용상
왕원위
김세익
조현아
안태진
박상익
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
HANDONG GLOBAL UNIVERCITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION
Seoul National University Hospital
Original Assignee
HANDONG GLOBAL UNIVERCITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION
Seoul National University Hospital
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220147284A external-priority patent/KR20230159796A/ko
Application filed by HANDONG GLOBAL UNIVERCITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION, Seoul National University Hospital filed Critical HANDONG GLOBAL UNIVERCITY INDUSTRY-ACADEMIC COOPERATION FOUNDATION
Publication of WO2023219447A1 publication Critical patent/WO2023219447A1/ko
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer

Definitions

  • the present invention relates to a composition for diagnosing ovarian cancer, a kit for diagnosing ovarian cancer, and a method of providing information for diagnosing ovarian cancer.
  • Ovarian cancer has the highest mortality rate among gynecological cancers and is one of the cancers with a poor prognosis, with more than 50% of patients dying. In addition, even if early treatment is successful, recurrence may occur in 60 to 85% of patients. The high mortality and recurrence rates of ovarian cancer are due to the lack of early diagnostic biomarkers and effective screening strategies, and it is important to diagnose ovarian cancer early and continuously monitor it. Meanwhile, existing invasive cancer diagnosis methods using tissue have limitations in repeated testing, making continuous monitoring of ovarian cancer difficult. Therefore, there is a need to develop a non-invasive ovarian cancer diagnostic technique that can replace this.
  • the purpose of the present invention is to provide a composition for diagnosing ovarian cancer.
  • the purpose of the present invention is to provide a kit for diagnosing ovarian cancer.
  • the purpose of the present invention is to provide a method of providing information for diagnosing ovarian cancer.
  • At least one cell selected from the group consisting ofmiR-1246,miR-1290,miR-483-5p,miR-429,miR-34b-3p,miR-34c-5p,miR-449a andmiR-145-5p A composition for diagnosing ovarian cancer, comprising an agent for detecting the expression level of exoplasmic reticulum-derived miRNA.
  • the miR-1246 consists of the sequence of SEQ ID NO: 1
  • the miR-1290 consists of the sequence of SEQ ID NO: 2
  • the miR-483-5p consists of the sequence of SEQ ID NO: 3
  • themiR-429 consists of the sequence of SEQ ID NO: 4
  • themiR-34b-3p consists of the sequence of SEQ ID NO: 5
  • themiR-34c-5p consists of the sequence of SEQ ID NO: 6
  • themiR- 449a consists of the sequence of SEQ ID NO: 7
  • the miR-145-5p consists of the sequence of SEQ ID NO: 8.
  • composition for diagnosing ovarian cancer according to 1 above wherein the extracellular vesicles are separated from blood, serum, or plasma.
  • composition for diagnosing ovarian cancer according to 1 above, wherein the agent contains a primer or probe.
  • composition is an agent for detecting the expression level of extracellular endoplasmic reticulum-derived miRNAs of miR-1246, miR-1290, and miR-483-5p; Agents that detect the expression levels of extracellular vesicle-derived miRNAs: miR-1246, miR-1290, miR-483-5p, and miR-429; Agents for detecting the expression levels of extracellular vesicle-derived miRNAs:miR-1246,miR-1290,miR-483-5p,miR-429 andmiR-34b-3p; or an agent for detecting the expression level of extracellular vesicle-derived miRNAs: Composition for cancer diagnosis.
  • compositions for diagnosing ovarian cancer comprising an agent for detecting the expression level of extracellular vesicle-derived miRNA.
  • a kit for diagnosing ovarian cancer comprising the composition of any one of items 1 to 6 above.
  • a method of providing information for diagnosing ovarian cancer comprising: comparing the expression level of at least one extracellular vesicle-derived miRNA selected from the group consisting of the expression level of the corresponding extracellular vesicle-derived miRNA in a control sample.
  • the expression level of at least one of the miR-1246, miR-1290, miR-483-5p and miR-429 is higher than the control group, or the expression level of the miR-34b-3p, miR-34c-5p,
  • a method of providing information for diagnosing ovarian cancer further comprising: determining that the subject has ovarian cancer when the expression level of at least one of miR-449a and miR-145-5p is lower than that of the control group.
  • ovarian cancer can be diagnosed more accurately and conveniently in a non-invasive manner.
  • Figures 1A to 1E schematically illustrate the process of separating extracellular vesicles from ascites and plasma, and show the results of identifying the separated extracellular vesicles.
  • Figures 2A to 2M show the process of constructing an OCEM (Ovarian cancer EV miRNA) signature based on miRNA expression profiling of biofluid-derived EVs and the results of verifying the ovarian cancer diagnosis effect of the OCEM signature.
  • OCEM Olec Cancer EV miRNA
  • Figure 3 shows the results of verifying the OCEM signature of various combinations of miRNAs and the ovarian cancer diagnostic effect of eight miRNAs alone.
  • Figures 4A to 4J show the results of verifying the ovarian cancer diagnosis effect of the OCEM signature using various public data sets (in Figure 4e, the thin solid line graph closer to the y-axis is the validation set AUC, and the thicker solid line graph inside it is the validation set AUC) training set AUC graph).
  • Figures 5A to 5G show the results confirming changes in the ovarian cancer malignant phenotype according to treatment with MA-EVs.
  • Figures 6A to 6L show the results confirming the effect of EV miR-1246 and miR-1290 on the metastatic potential of ovarian cancer cells.
  • Figures 7A to 7I show the results of identifying targets of miR-1246 and miR-1290 related to ovarian cancer metastasis and patient prognosis.
  • Figure 8 shows an experimental process that confirmed that 8 types of EV-derived miRNAs were selected and their expression profiles could effectively diagnose or predict ovarian cancer, according to an example.
  • Figures 9A to 9D show the process of selecting eight EV-derived miRNAs for constructing an ovarian cancer diagnostic signature.
  • Figures 10A to 10F show the results confirming the effects of EV miR-1246 and miR-1290 on the invasion and migration of ovarian cancer cells.
  • the present invention relates to a method of discovering an ovarian cancer diagnostic marker and effectively diagnosing ovarian cancer using a substance capable of specifically binding to the marker.
  • the method using the miRNA marker of the present invention enables early diagnosis of ovarian cancer, thereby enabling early treatment and improvement of prognosis.
  • we selected 8 types of miRNAs whose expression levels were significantly changed in samples from normal groups and ovarian cancer patients and confirmed that ovarian cancer can be effectively diagnosed or predicted through their expression profiles.
  • the present invention relates to at least one selected from the group consisting of: A composition for diagnosing ovarian cancer comprising an agent for detecting the expression level of miRNA is provided.
  • the miRNA to be detected may be an extracellular vesicle-derived miRNA.
  • miRNA or “microRNA” or “miR” means that its precursor RNA transcript can form a small stem-loop, from which the mature “miRNA” is processed by the endonuclease Dicer. refers to RNA (or RNA analogue) that contains the product of an endogenous, non-coding gene that is cleaved. MiRNAs are encoded within genes that are distinct from the mRNAs whose expression they regulate.
  • miRNA refers to a single-stranded RNA molecule of at least 10 nucleotides and up to 35 nucleotides covalently linked together.
  • the miRNA or its complementary strand molecule includes, but is not limited to, 15 to 50, 15 to 30, or 18 to 25 nucleic acids.
  • the miRNAs of the present specification include specific nucleotide sequences of the above-mentioned miR-1246, MiR-1290, MiR-483-5p, MiR-429, MiR-34b-3p, MiR-34c-5p, MiR-449a, and MiR-145-5p ( or sequence number), as well as precursors (pre-miRNA, pri-miRNA) of the above-mentioned miRNA, miRNAs with equivalent biological functions, such as homologs (i.e., homologs or orthologs), genetic polymorphisms, etc. Also includes variants and derivatives of. Such precursors, homologs, variants or derivatives can be specifically identified using miRBase release 20 (http://www.mirbase.org/).
  • the miRNA of the present specification may be a gene product of a miR gene, and this gene product may include a mature miRNA or a miRNA precursor (e.g., pre-miRNA or pri-miRNA as described above).
  • a miRNA precursor e.g., pre-miRNA or pri-miRNA as described above.
  • the base sequence of the miRNA mentioned in this specification may be SEQ ID NO: 1 to 8 (see Table 1 below).
  • the present invention relates to at least one selected from the group consisting of:
  • a composition for diagnosing ovarian cancer can be provided, including an agent for detecting the expression level of extracellular vesicle-derived miRNA.
  • extracellular vesicle refers to the endoplasmic reticulum secreted by cells into the external environment for information exchange between cells. Extracellular vesicles may be exosomes.
  • the composition of the present invention diagnoses ovarian cancer by measuring the expression level of miRNA derived from extracellular vesicles (e.g., extracellular vesicles isolated from blood, extracellular vesicles isolated from plasma, or extracellular vesicles isolated from serum) of the subject. can do.
  • Detection of extracellular vesicle-derived miRNA can usually be performed by extracting extracellular vesicles from a sample isolated from a subject and measuring the level of miRNA in the extracellular vesicles. Detection of such extracellular vesicle miRNAs can be measured by hybridization reaction and amplification reaction, but is not limited thereto and can be easily performed using various techniques known in the art.
  • Extracellular vesicles may be isolated from blood, serum, or plasma.
  • composition of the present invention can detect the above-mentioned types of miRNAs from extracellular vesicles isolated from blood, serum, or plasma, and can exhibit an accurate ovarian cancer diagnosis effect in a non-invasive manner.
  • the ovarian cancer may be, but is not limited to, high-grade serous ovarian cancer.
  • the present inventors identified miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a, and miR-145-5p as biomarkers for ovarian cancer diagnosis. It was confirmed that some combinations showed better efficacy.
  • the composition for diagnosing ovarian cancer of the present invention includes miR-1246, miR-1290, and miR-483-5p; miR-1246,miR-1290,miR-483-5p andmiR-429; miR-1246,miR-1290,miR-483-5p,miR-429 andmiR-34b-3p; miR-1246,miR-1290,miR-483-5p,miR-429,miR-34b-3p andmiR-34c-5p; Alternatively, expression levels for miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a, and miR-145-5p can be measured. It may contain agents.
  • the composition for diagnosing ovarian cancer may include an agent for detecting extracellular vesicle-derived miR-1246, miR-1290, and miR-483-5p.
  • the composition for diagnosing ovarian cancer may further include an agent for detecting extracellular vesicle-derived miR-1246, miR-1290, and miR-483-5p, as well as an agent for detecting extracellular vesicle-derived miR-429. You can.
  • the composition for diagnosing ovarian cancer detects extracellular vesicle-derived miR-429 and miR-34b-3p along with an agent that detects extracellular vesicle-derived miR-1246, miR-1290, and miR-483-5p. Additional agents may be included.
  • the composition for diagnosing ovarian cancer includes an agent for detecting extracellular vesicle-derived miR-1246, miR-1290, and miR-483-5p, along with extracellular vesicle-derived miR-429, miR-34b-3p, and miR It may further include an agent that detects -34c-5p.
  • the composition for diagnosing ovarian cancer includes extracellular endoplasmic reticulum-derived miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a, and It may include an agent that detects miR-145-5p.
  • the agent may be a substance that specifically binds to the at least one miRNA, and may include, for example, a primer or probe.
  • Detection of nucleic acids can be performed by an amplification reaction using one or more oligonucleotide primers that hybridize to the nucleic acid molecule or the complement of the nucleic acid molecule.
  • detection of extracellular vesicle miRNAs using primers can be performed by amplifying the gene sequence using an amplification method such as PCR and then confirming whether the gene is amplified by a method known in the art.
  • a primer is a short nucleic acid sequence that has a short free 3' hydroxyl group that can form a base pair with a complementary template and serves as a starting point for copying the template strand.
  • Primers can initiate DNA synthesis in the presence of four different nucleoside triphosphates and a reagent for polymerization (i.e., DNA polymerase or reverse transcriptase) in an appropriate buffer solution and temperature.
  • ovarian cancer can be diagnosed by performing PCR amplification using sense and antisense primers that specifically bind to the at least one miRNA and confirming the expression level. PCR conditions and lengths of sense and antisense primers can be modified based on those known in the art.
  • a probe refers to a nucleic acid fragment such as RNA or DNA that is as short as a few bases or as long as several tens of bases and is labeled. Probes may be manufactured in the form of oligonucleotide probes, single stranded DNA probes, double stranded DNA probes, RNA probes, etc. In the present invention, ovarian cancer can be diagnosed by confirming the expression level by performing hybridization using a probe complementary to one or more of the above miRNAs. Selection of appropriate probes and hybridization conditions can be modified based on those known in the art.
  • Primers or probes can be appropriately designed by those skilled in the art based on known sequences.
  • primers or probes can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods.
  • These nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, capping, substitution of a native nucleotide with one or more homologs, and modifications between nucleotides, such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphorylates). amidate, carbamate, etc.) or charged linkages (e.g. phosphorothioate, phosphorodithioate, etc.).
  • the expression level of miRNA can be measured according to methods commonly used in the field, such as reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), and real-time reverse transcriptase polymerase reaction. (RealtimeRT-PCR), RNase protection assay (RPA), Northern blotting, or gene chip, etc., but are not limited to these.
  • RT-PCR reverse transcriptase polymerase reaction
  • Competitive RT-PCR competitive reverse transcriptase polymerase reaction
  • RPA RNase protection assay
  • Northern blotting or gene chip, etc.
  • the present invention provides a kit for diagnosing ovarian cancer comprising the above-described composition.
  • the kit may further include ingredients, tools, reagents, etc. commonly used in the art to be suitable for use as an ovarian cancer diagnostic kit, as well as an agent for measuring the expression level of the above-described miRNA or extracellular vesicle-derived miRNA. .
  • the components, tools or reagents may be carriers, labeling substances capable of generating detectable signals, chromophores, solubilizers, detergents, buffers, stabilizers, etc.
  • the labeling substance is an enzyme, it may include a substrate that can measure enzyme activity and a reaction stopper.
  • the carrier may be a soluble carrier or an insoluble carrier, and the soluble carrier includes physiologically acceptable buffers known in the art, such as PBS, and examples of the insoluble carrier include polystyrene, polyethylene, polypropylene, polyester, and polyacrylic. It may be ronitrile, fluororesin, cross-linked dextran, polysaccharide, polymers such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof.
  • the present invention provides a method of providing information for diagnosing ovarian cancer.
  • the method of providing information of the present invention is (a) from a sample of a subject. And comparing the expression level of at least one extracellular vesicle-derived miRNA selected from the group consisting of miR-145-5p with the expression level of the corresponding extracellular vesicle-derived miRNA in the control sample.
  • “Comparison with the expression level of the corresponding extracellular vesicle-derived miRNA in the control sample” means comparing the expression level of a specific miRNA derived from the extracellular vesicles isolated from the sample of the individual subject to diagnosis and the same type of control miRNA.
  • the method of providing information of the present invention is (b) the expression level of at least one of the miR-1246, miR-1290, miR-483-5p and miR-429 is high compared to the control group, or the expression level of the miR-34b-3p and the miR-429 is high compared to the control group.
  • the method may further include determining that the subject has ovarian cancer when the expression level of at least one of -34c-5p, miR-449a, and miR-145-5p is lower than that of the control group.
  • the control group may be a normal control group.
  • the subject may be an animal that currently has ovarian cancer, has previously had ovarian cancer, or is suspected of having ovarian cancer.
  • the sample may be selected from the group consisting of blood, serum, plasma, ascites, or urine.
  • the sample may be selected from the group consisting of extracellular vesicles isolated from blood, extracellular vesicles isolated from serum, or extracellular vesicles isolated from plasma.
  • step (b) the subject may be judged to have ovarian cancer if the expression levels of miR-1246, miR-1290, and miR-483-5p are higher than those of the control group.
  • the subject may be determined to have ovarian cancer if the expression levels of miR-1246, miR-1290, miR-483-5p, and miR-429 are higher than the control group.
  • step (b) if the expression level of miR-1246, miR-1290, miR-483-5p, and miR-429 is high compared to the control group, and the expression level of miR-34b-3p is low compared to the control group, the subject is It may be considered ovarian cancer.
  • step (b) the expression levels of miR-1246, miR-1290, miR-483-5p, and miR-429 are higher than the control group, and the expression levels of miR-34b-3p and miR-34c-5p are higher than the control group. If it is high, the subject may be judged to have ovarian cancer.
  • stage (b) the expression levels of miR-1246, miR-1290, miR-483-5p, and miR-429 are higher than the control group, and the expression levels of miR-34b-3p, miR-34c-5p, miR-449a, and miR-429 are higher than those of the control group. If the expression level of -145-5p is high compared to the control group, the subject may be judged to have ovarian cancer.
  • the method of providing information of the present invention may further include the step of isolating extracellular vesicles from a sample of a subject before performing step (a).
  • the present invention provides a composition for predicting ovarian cancer metastasis, comprising an agent for detecting the expression level of at least one miRNA selected from the group consisting of miR-1246 or miR-1290.
  • the miRNA to be detected may be an extracellular vesicle-derived miRNA.
  • the present invention provides a kit for predicting ovarian cancer metastasis comprising the above-described composition.
  • the present invention (i) compares the expression level of at least one extracellular vesicle-derived miRNA selected from the group consisting of miR-1246 and miR-1290 from the sample of the subject to the expression level of the corresponding extracellular vesicle-derived miRNA in the control sample.
  • a method of providing information for predicting ovarian cancer metastasis is provided, including the step of comparing.
  • the method of providing information of the present invention may further include (ii) determining that the subject has ovarian cancer when the expression level of at least one of the miR-1246 and the miR-1290 is higher than that of the control group. .
  • the method of providing information of the present invention may further include the step of isolating extracellular vesicles from a sample of a subject before performing step (i).
  • the collected ascites samples were centrifuged at 2500 rpm and 4°C for 10 minutes, separated into cell fractions and cell-free fractions, and used and stored in experiments.
  • the cell-free supernatant was filtered through a Falcon 70 ⁇ m filter (Corning, USA) and stored at -70°C for future use.
  • Whole blood was collected from an EDTA-treated tube and centrifuged at 2500 g for 15 minutes at 4°C to remove cells. The supernatant was then collected and centrifuged again to remove platelets and stored at -70°C for future use.
  • the EV pellet was suspended in PBS and diluted to the appropriate concentration. EV concentration and size distribution were measured by nanoparticle tracking analysis (NTA) using the NanoSight NS300 system (Malvern Technologies, Malvern, UK).
  • the obtained cells were lysed in lysis buffer and incubated at 4°C for 30 minutes.
  • the lysed cells were centrifuged at 13,000 rpm at 4°C for 20 minutes to obtain protein from the supernatant, and the obtained protein concentration was confirmed using the BCA Protein Assay kit (Thermo Scientific, Waltham, MA, USA).
  • 5X loading buffer was added to the protein and boiled at 99.9°C for 5 minutes to denature the protein structure for Western blotting. Proteins were loaded on SDS-PAGE, separated by size through electrophoresis, and then transferred to a nitrocellulose membrane.
  • the nitrocellulose membrane onto which the protein was transferred was incubated in 5% skim milk for 1 hour and incubated with primary and secondary antibodies of the protein to be identified. Finally, the signal was detected using ECL Western Blotting Detection Reagent (Amersham, UK).
  • QIAquick PCR Purification Kit Qiagen, Hilden, Germany
  • AMPure XP beads Beckmancoulter, CA, USA.
  • the yield and size distribution of the small RNA library were measured using the Agilent 2100 Bioanalyzer instrument (Agilent Technologies, Santa Clara, CA, USA). Then, single-end 75 sequencing was performed on the generated high-throughput sequences on the NextSeq500 system (Illumina, SanDiego, CA, USA).
  • Human ovarian cancer cell lines SKOV3 and KURAMOCHI were used in this study.
  • the medium composition was RPMI1640 (WelGENE, Seoul, Korea) supplemented with 10% fetal bovine serum (FBS; Gibco, MD, USA) and 100 ⁇ g/mL penicillin-streptomycin (Invitrogen, Carlsbard, CA, USA) to support cells. Cultured. Culture conditions were carried out in an incubator set at 37°C and 5% CO 2 .
  • the lipid membrane of isolated EVs was stained and labeled using the PKH67 green fluorescent cell linker mini kit (Sigma, USA), and the cell membrane was labeled with the PKH26 red fluorescent cell linker mini kit (Sigma, USA). Ovarian cancer cells were treated with labeled EVs and co-cultured for 6 hours. EV uptake by ovarian cancer was confirmed using a confocal microscope LSM800 (EVOS, USA).
  • Transwell inserts 8 ⁇ m-sized Transwell inserts (BD Biosciences, CA, USA) were used.
  • inserts were pre-coated with Matrigel (BD Biosciences, CA, USA).
  • Matrigel BD Biosciences, CA, USA.
  • Ovarian cancer cells were dispensed into the upper chamber in serum-free medium and maintained for 24 hours. Then, medium containing 10% FBS was added to the lower chamber and incubated for 24 hours.
  • Transwell inserts were washed with PBS, and infiltrated and migrated cells were stained with 0.5% crystal violet. Then, the remaining cells on the upper surface of the inserts were removed, and the infiltrated and migrated cells were confirmed under a microscope and further analyzed with Image J software.
  • ovarian cancer organoids Malignant ascites-derived cells were used to establish ovarian cancer organoids. Cells were seeded with phenol red-free Matrigel Growth Factor Reduced Basement Membrane Matrix (BD Bioscience, CA, USA) and cultured in culture medium for organoids. Culture media for organoids include Penicillin/Streptomycin (Gibco), HEPES (Gibco), GlutaMax (Gibco), b-Estradiol (Sigma), Nicotinamide (Sigma), recombinant human Noggin (Peprotech), recombinant R-Spondin1 (RSPO1; Peprotech).
  • Culture media for organoids include Penicillin/Streptomycin (Gibco), HEPES (Gibco), GlutaMax (Gibco), b-Estradiol (Sigma), Nicotinamide (Sigma), recombinant human Noggin (Peprotech), recombinant R-Spondin1 (RSPO1; Peprotech
  • B27 Invitrogen
  • EGF Invitrogen
  • FGF10 Peprotech
  • HeregulinB-1 Peprotech
  • Forskolin bio-techne
  • Hydrocortisone Sigma
  • A83-10 bio-techne
  • Y-27632 dihydrochloride Sigma
  • N-acetylcysteine Sigma
  • Priomcin InvivoGen
  • Lipofectamine RNA iMAX (Invitrogen, Carlsbad, CA, USA) was used to transform miRNA mimics or inhibitors, and Lipofectamine 3000TM reagent (Invitrogen, Carlsbad, CA, USA) was used to transform plasmids. converted. The culture medium was replaced 6 hours after transformation. Cells were cultured in culture medium for 24 or 48 hours and then collected for further analysis.
  • pGL-3-ROR ⁇ 3'UTR reporter plasmid (Origene, Rockvile, USA) containing wild-type or mutated miR-1246 or miR-1290 binding sequences and miR-1246 or miR-1290 using Lipofectamine3000 (Invitrogen, USA). Cells were cotransfected with mimics or negative controls. Firefly luciferase was detected using the Luciferase Reporter Gene Detection Kit (MilliporeSigma, Missouri, USA). Firefly luciferase activity was calculated for red fluorescent protein (RFP) intensity.
  • RFP red fluorescent protein
  • Immunohistochemistry (IHC) analysis was performed using 4- ⁇ m-thick tissue microarray (TMA) sections with a Benchmark autostainer (Ventana, Arlington, AZ, USA) according to the manufacturer's instructions. The intensity of the immune response was scored for further analysis.
  • EVs isolated from benign peritoneal fluid were expressed as BA-EV
  • EVs isolated from malignant ascites were expressed as MA-EV
  • EVs isolated from benign plasma were expressed as BP-EV
  • EVs isolated from malignant plasma were expressed as MP-EV.
  • the typical morphology of EVs as nano-sized double-membrane circular particles was confirmed by TEM ( Figure 1C; scale bar 200 nm).
  • Western blotting demonstrated positive expression of EV markers CD9 and CD81 ( Figure 1D).
  • the size distribution of EVs ranging from 30 nm to 200 nm was evaluated by NTA ( Figure 1E; Figures 1ea to 1ed).
  • Figure 1A schematically illustrates the process of sampling ascites, and specifically shows the process of processing malignant ascites obtained from an HGSOC patient into cell fraction and cell-free fraction.
  • Figure 1B schematically illustrates the process of separating EVs from ascites and plasma. It shows the process of filtering the ascites cell-free fraction and plasma and isolating EVs by applying the ExoQuick kit.
  • Figure 1C shows the results of confirming the morphology of BA-EV, MA-EV, BP-EV, and MP-EV through TEM.
  • Figure 1D shows the results confirming that BA-EV, MA-EV, BP-EV, and MP-EV express EV markers through Western blotting.
  • Figure 1E shows the results of confirming the size distribution and concentration of BA-EV, MA-EV, BP-EV, and MP-EV through NTA.
  • BA-EV refers to benign peritoneal fluid-derived EV
  • MA-EV refers to malignant ascites-derived EV
  • BP-EV refers to benign plasma-derived EV
  • MP-EV refers to malignant plasma-derived EV.
  • miRNAs whose P value was less than 0.05 and whose expression differed at least 4-fold between the benign and malignant groups were considered differentially expressed miRNAs (DEmiRs). According to this criterion, 93 miRNAs were upregulated and 117 miRNAs were downregulated in MA-EVs compared to BA-EVs ( Figures 2A and 2B). Likewise, 21 miRNAs were upregulated and 45 miRNAs were downregulated in MP-EVs compared to BP-EVs ( Figure 2C, Figure 2D). Pathway analysis showed that a large portion of DEmiRs were closely involved in oncogenesis, cancer progression, several cancer hallmarks, and EV development-related pathways.
  • Figure 2B Figures 2Ba-2BG) is a heatmap showing the expression patterns of DEmiRs in multiple subsets.
  • Figure 2D Figures 2da-2dd
  • Figure 2F shows the results of univariate logistic regression analysis demonstrating the AUC for whether the 17 DEmiRs can identify cancer patients in multiple training sets.
  • Figure 2G shows the results of univariate logistic regression analysis demonstrating the AUC for whether the 17 DEmiRs can identify cancer patients in the plasma training set.
  • Figure 2H is a heatmap showing the expression of eight miRNAs selected to build the OCEM signature in multiple subsets.
  • Figure 2I is a heatmap showing the expression of eight miRNAs selected to build the OCEM signature in the plasma subset.
  • Figure 2J is an ROC curve showing the diagnostic ability of OCEM signatures on multiple training and validation sets.
  • Figure 2K is a risk probability plot showing predicted risk probabilities in multiple training and validation sets.
  • Figure 2L is an ROC curve showing the diagnostic ability of OCEM signatures on plasma training and validation sets.
  • Figure 2M is a risk probability plot showing predicted risk probabilities in plasma training and validation sets.
  • OCEM signatures were constructed by various combinations of the eight miRNAs selected above, and the ovarian cancer diagnosis effect of each of these signatures was verified.
  • Table 2 lists the OCEM signatures and verification results of various combinations used for verification, and Table 3 below shows the verification results for each of the eight selected miRNAs. Additionally, a graph related to this result is shown in Figure 3.
  • Signature classification Selected miRNAs markers to build signatures Diagnostic effectiveness verification result (AUC) OCEM-3 hsa-miR-1246, hsa-miR-1290, hsa-miR-483-5p 0.884 OCEM-4 hsa-miR-1246, hsa-miR-1290, hsa-miR-483-5p, hsa-miR-429 0.89 OCEM-5 hsa-miR-1246, hsa-miR-1290, hsa-miR-483-5p, hsa-miR-429, hsa-miR-34b-3p 0.964 OCEM-6 hsa-miR-1246, hsa-miR-1290, hsa-miR-483-5p, hsa-miR-429, hsa-miR-34b-3p, hsa-miR-34c-5
  • the OCEM signature was verified.
  • the risk probability plot demonstrated that the OCEM signature could almost perfectly distinguish between cancer and normal tissue (Figure 4F and Figure 4H).
  • the solid line graph inside is the training set AUC graph).
  • ovarian cancer cell lines SKOV3 and KURAMOCHI were treated with MA-EVs. Cancer cell membranes were stained with red PKH26, and MA-EVs were stained with green PKH-67. Uptake of MA-EVs by cancer cells was detected after 6 hours of co-culture (Figure 5D). As a result, MA-EV treatment significantly promoted the invasion and migration of SKOV3 and KURAMOCHI cells, whereas BA-EV showed no significant effect (Figure 5E). Isolated ovarian cancer cells floating in the ascites usually cluster at the metastatic site as either single cells or multicellular spheroids.
  • 3D spheroid invasion assay mimicking tumor micro-metastasis was performed to investigate the effect of MA-EVs on tumor spheroids.
  • 3D spheroids treated with MA-EVs had increased invasion ability compared to spheroids treated with BA-EVs or PBS ( Figure 5F; scale bar 200 ⁇ m).
  • Organoid models derived from human samples have emerged as a unique model that bridges the gap between in vitro and in vivo preclinical cancer models.
  • treatment with MA-EVs significantly increased the number and size of organoids, while organoids treated with BA-EVs maintained similar levels to the PBS control group (Figure 5G).
  • Figure 5A shows the concentrations of BA-EVs and MA-EVs determined by NTA.
  • Figure 5B shows the concentration of MA-EVs (stage I+II) and MA-EVs (stage III+IV).
  • Figure 5C shows the concentration of MA-EVs (primary diagnosis) and MA-EVs (relapse).
  • Figure 5D shows EV uptake by cancer cells. Cancer cell membranes were stained with PKH26 in red, while MA-EVs were stained with PKH-67 in green. Uptake of MA-EVs by SKOV3 and KURAMOCHI was detected by confocal microscopy.
  • Figure 5E Figures 5ea to 5ec shows that ovarian cells were treated with MA-EVs or BA-EVs and their invasion and migration abilities were confirmed by transwell analysis.
  • Figure 5F Figures 5fa-5fc shows the results of 3D invasion analysis. Cancer cells were observed to infiltrate Matrigel under a microscope.
  • Figure 5G Figure 5ga to Figure 5gc; in Figure 5gb, the scale bar is 500 ⁇ m in the upper row and 100 ⁇ m in the lower row
  • an ascites cell-derived organoid model was established and ascites cells were spread on Matrigel.
  • This is a schematic diagram of the process of forming an organoid model. After continuously treating the 14-day-old organoid model with PBS, BA-EVs, or MA-EVs for 2 weeks, the number and size of organoids formed were evaluated. *, P ⁇ 0.05; **, P ⁇ 0.01; ***, P ⁇ 0.001.
  • EV miRNA signatures may not only serve as clinical biomarkers in liquid biopsies but also influence cancer characteristics.
  • MiR-1246 and miR-1290 were selected as target miRNAs for posterior analysis because they are among the most upregulated miRNAs in the malignant group and the absolute expression levels of these two miRNAs were significantly high ( Figures 10A and 10B; The part below -2 on the x axis is Down, and the part above 2 is UP; in Figure 10a, the up arrow is for miR-1246 and the down arrow is for miR-1290; in Figure 10b, the up arrow is for miR-1290 and the down arrow is for miR-1246. lim). The expression of miR-1246 and miR-1290 in ascites and plasma subsets was shown in the heatmap ( Figures 6A and 6B).
  • miR-1246 and miR-1290 As the expression of miR-1246 and miR-1290 increased in malignant biofluids, we investigated whether this trend resulted from differential secretion between cancer cells and normal epithelial cells.
  • miR-1246 or miR-1290 expression were detected between HGSOC and non-HGSOC cell lines or their respective EVs.
  • the expression of miR-1246 and miR-1290 in cells and respective EVs was not correlated, indicating that a complex sorting mechanism may be involved in the secretion process of these two miRNAs.
  • hypoxia is one of the pivotal hallmarks of cancer
  • SKOV3 and KURAMOCHI cells were cultured in medium supplemented with EV-free FBS under normoxic and hypoxic conditions.
  • EVs were isolated after 72 h of incubation and identified as double-membrane particles ranging from 30 nm to 200 nm with CD63 and CD9 expression by TEM, NTA, and Western blotting.
  • the expression of miR-1246 and miR-1290 was dramatically increased in hypoxic EVs (H-EVs) than in normoxic EVs (N-EVs) ( Figures 6I and 6J).
  • Figure 6A is a heatmap showing the expression of miR-1246 and miR-1290 in ascites subsets.
  • Figure 6B is a heatmap showing the expression of miR-1246 and miR-1290 in plasma subsets.
  • Figure 6F shows the results of TEM to confirm the morphology of EVs derived from cancer cell lines.
  • Figure 6G shows the results of confirming whether EV markers CD63 and CD9 are expressed in EVs derived from cancer cell lines through Western blotting.
  • Figure 6H shows the results of confirming the size contribution and concentration of EVs derived from cancer cell lines using NTA.
  • Figure 6I shows the results showing the expression of miR-1246 in oxygenated and normoxic EVs.
  • Figure 6J shows the results showing the expression of miR-1290 in hypoxic and normoxic EVs.
  • Figure 6K shows the results of investigating the effect of treating ovarian cancer cells with a miRNA inhibitor or mimic on ovarian cancer invasion and migration.
  • Figure 6L shows retinal adipose tissue derived from an ovarian cancer patient co-cultured with SKOV3 luc cells treated with an inhibitor or mimic of miRNA for 5 days. The number of SKOV3 luc cells that migrated and colonized the adventitial tissue pieces was determined by luminescence intensity measured with an IVIS 100 imaging system.
  • H-EV hypoxic EV
  • N-EV normoxic EV
  • IN inhibition
  • OV overexpression
  • Figure 7A shows the results of predicting common targets of miR-1246 and miR-1290 using an online tool.
  • Figure 7B shows the results of GEPIA confirming ROR ⁇ expression in ovarian cancer tissues and normal tissues.
  • Figure 7C shows the results of Western blotting measuring changes in ROR ⁇ expression in SKOV3 and KURAMOCHI cells following inhibition of miR-1246 and miR-1290.
  • Figure 7D shows the results of constructing a putative miRNA target region of RORa 3'-UTR wild type (WT) or a mutant with an altered putative binding region (MT).
  • WT 3'-UTR wild type
  • MT putative binding region
  • Figure 7E Figures 7ea to 7eb shows the results of verifying that the putative binding region of miR-1246 and miR-1290 is RORa 3'-UTR through dual luciferase reporter gene analysis.
  • Figure 7F shows the results of measuring the invasion and migration abilities of ovarian cancer cells overexpressed with RORa.
  • Figure 7G Figure 7ga to Figure 7gd shows the results of a rescue experiment to determine whether miR-1246 or miR-1290 can restore the effect of ovarian cancer invasion and migration by ROR ⁇ overexpression.
  • Figure 7H shows the results of analysis of RORa in ovarian cancer tissues and normal tissues.
  • Figure 7I presents the results of examining the relationship between tissue ROR ⁇ expression and overall survival in HGSOC patients through IHC analysis. (OV: overexpression. *, P ⁇ 0.05; **, P ⁇ 0.01; ***, P ⁇ 0.001.)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

본 발명은 난소암 진단용 조성물에 관한 것으로, 보다 상세하게는 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 로 이루어진 군으로부터 선택된 적어도 하나의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제를 포함함으로써 비침습적인 방법으로 보다 더 정확하고 간편하게 난소암을 진단할 수 있다.

Description

세포외 소포체 유래 MIRNA를 검출하는 제제를 포함하는 난소암 진단용 조성물
본 발명은 난소암 진단용 조성물, 난소암 진단용 키트 및 난소암 진단을 위한 정보제공방법에 관한 것이다.
난소암(ovarian cancer)은 부인암 중에서도 가장 사망률이 높은 암으로, 발병 환자 중 50 % 이상이 사망하는 예후가 좋지 않은 암 중의 하나이다. 뿐만 아니라 조기 치료에 성공하였더라도 60 내지 85 %의 환자에서 재발될 수 있다. 난소암의 높은 사망률과 재발률은 조기 진단 바이오 마커와 효과적인 검진 전략이 부족하기 때문이며, 난소암을 조기 진단하고 지속적으로 모니터링 하는 것이 중요하다. 한편 기존의 조직을 이용한 침습적인 암 진단 방법은 반복 검사의 한계를 가지고 있어 지속적인 난소암의 모니터링이 쉽지 않다. 따라서, 이를 대체할 수 있는 비침습적 난소암 진단기법의 개발이 필요한 실정이다.
본 발명은 난소암 진단용 조성물을 제공하는 것을 목적으로 한다.
본 발명은 난소암 진단용 키트를 제공하는 것을 목적으로 한다.
본 발명은 난소암 진단을 위한 정보제공방법을 제공하는 것을 목적으로 한다.
1. miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 로 이루어진 군으로부터 선택된 적어도 하나의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제를 포함하는, 난소암 진단용 조성물.
2. 위 1에 있어서, 상기 miR-1246는 서열번호 1의 서열로 이루어지고, 상기 miR-1290는 서열번호 2의 서열로 이루어지고, 상기 miR-483-5p는 서열번호 3의 서열로 이루어지고, 상기 miR-429는 서열번호 4의 서열로 이루어지고, 상기 miR-34b-3p는 서열번호 5의 서열로 이루어지고, 상기 miR-34c-5p는 서열번호 6의 서열로 이루어지고, 상기 miR-449a는 서열번호 7의 서열로 이루어지고, 상기 miR-145-5p는 서열번호 8의 서열로 이루어진 것인, 난소암 진단용 조성물.
3. 위 1에 있어서, 상기 세포외 소포체는 혈액, 혈청 또는 혈장에서 분리된, 난소암 진단용 조성물.
4. 위 1에 있어서, 상기 제제는 프라이머 또는 프로브를 포함하는, 난소암 진단용 조성물.
5. 위 1에 있어서, 상기 조성물은 miR-1246, miR-1290 및 miR-483-5p의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제; miR-1246, miR-1290, miR-483-5p 및 miR-429의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제; miR-1246, miR-1290, miR-483-5p, miR-429 및 miR-34b-3p의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제; 또는 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p 및 miR-34c-5p의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제를 포함하는 것인, 난소암 진단용 조성물.
6. 위 1에 있어서, 상기 조성물은 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제를 포함하는 것인, 난소암 진단용 조성물.
7. 위 1 내지 6 중 어느 한 항의 조성물을 포함하는 난소암 진단용 키트.
8. (a) 피검체의 시료로부터 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 로 이루어진 군으로부터 선택된 적어도 하나의 세포외 소포체 유래 miRNA의 발현 수준을 대조군 시료의 해당 세포외 소포체 유래 miRNA의 발현 수준과 비교하는 단계;를 포함하는, 난소암 진단을 위한 정보를 제공하는 방법.
9. 위 8에 있어서, 상기 miR-1246, miR-1290, miR-483-5p 및 miR-429 중 적어도 하나의 발현 수준이 대조군 대비 높거나, 상기 miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 중 적어도 하나의 발현 수준이 대조군 대비 낮은 경우 상기 피검체가 난소암을 가지는 것으로 결정하는 단계;를 더 포함하는, 난소암 진단을 위한 정보를 제공하는 방법.
10. 위 8에 있어서, 상기 시료는 혈액, 혈청 또는 혈장인, 난소암 진단을 위한 정보를 제공하는 방법.
11. 위 8에 있어서, 상기 시료는 혈액에서 분리된 세포외 소포체, 혈청에서 분리된 세포외 소포체 또는 혈장에서 분리된 세포외 소포체인, 난소암 진단을 위한 정보를 제공하는 방법.
본 발명의 난소암 진단용 조성물, 난소암 진단용 키트 또는 난소암 진단을 위한 정보제공방법을 이용하면 비침습적인 방법으로 보다 더 정확하고 간편하게 난소암을 진단할 수 있다.
도 1A내지 도 1E는 복수와 혈장에서 세포외 소포체를 분리하는 과정을 도식화한 그림과, 분리된 세포외 소포체를 식별한 결과를 나타낸다.
도 2A 내지 도 2M 은 생체 유체 유래 EV의 miRNA 발현 프로파일링을 기반으로 하는 OCEM(Ovarian cancer EV miRNA) 시그니처 구축 과정 및 OCEM 시그니처의 난소암 진단 효과를 검증한 결과를 나타낸다.
도 3은 다양한 miRNA 조합의 OCEM 시그니처 및 8개의 miRNAs 단독의 난소암 진단 효과를 검증한 결과를 나타낸다.
도 4A 내지 도 4J는 다양한 공개 데이터 세트를 사용하여 OCEM 시그니처의 난소암 진단 효과를 검증한 결과를 나타낸다 (도 4e에서 y축과 더 가까운 얇은 실선 그래프는 validation set AUC, 이보다 안쪽의 두꺼운 실선 그래프는 training set AUC 그래프임).
도 5A 내지 도 5G는 MA-EVs의 처리에 따른 난소암 악성 표현형의 변화를 확인한 결과를 나타낸다.
도 6A 내지 도 6L은 EV miR-1246 및 miR-1290이 난소암 세포의 전이 가능성에 미치는 영향을 확인한 결과를 나타낸다.
도 7A 내지 도 7I는 난소암 전이 및 환자 예후와 관련된 miR-1246 및 miR-1290의 표적을 확인한 결과를 나타낸다.
도 8은 일 실시예에 따라 EV 유래 miRNA를 8 종 선별하고 이들의 발현 프로파일을 통해 난소암을 효과적으로 진단 또는 예측할 수 있음을 확인한 실험 과정을 나타낸 것이다.
도 9A 내지 도 9D는은 난소암 진단 시그니처 구축을 위한 8개의 EV 유래 miRNA를 선택하는 과정을 나타낸 것이다.
도 10A 내지 도 10F는 EV miR-1246 및 miR-1290이 난소암 세포의 침윤 및 이동에 미치는 영향을 확인한 결과를 나타낸다.
이하, 본 발명을 상세하게 설명한다.
본 발명은 난소암 진단 마커를 발견하고, 해당 마커에 특이적으로 결합 가능한 물질을 이용하여 효과적으로 난소암을 진단하는 방법에 관한 것이다. 본 발명의 miRNA 마커를 이용한 방법은 난소암을 조기에 진단 가능하게 하고, 이에 따라 조기 치료 및 예후의 개선을 가능하게 한다. 본 발명에서는 정상군 및 난소암 환자의 시료에서 발현수준이 의미있게 변화하는 miRNA를 8 종 선별하고 이들의 발현 프로파일을 통해 난소암을 효과적으로 진단 또는 예측할 수 있음을 확인하였다.
본 발명은 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 로 이루어진 군으로부터 선택된 적어도 하나의 miRNA의 발현 수준을 검출하는 제제를 포함하는 난소암 진단용 조성물을 제공한다. 검출 대상인 상기 miRNA는 세포외 소포체 유래 miRNA일 수 있다.
용어 "miRNA" 또는 "microRNA" 또는 "miR"은 이의 전구체 RNA 전사체가 작은 줄기-루프(stem-loop)를 형성할 수 있고 이로부터 성숙한 "miRNA"가 엔도뉴클레아제 다이서(Dicer)에 의해 절단되는 내인성의, 비-암호화된 유전자의 생성물을 포함하는 RNA(또는 RNA 유사체)를 말한다. miRNA는, 이들이 이의 발현을 조절하는 mRNA와는 구분되는 유전자내에서 암호화된다.
일 예에서, 용어 "miRNA" 또는 "microRNA"는 함께 공유결합된 적어도 10개의 뉴클레오타이드 및 35개 이하의 뉴클레오타이드의 단일가닥 RNA 분자를 말한다. 상기 miRNA 또는 이들의 상보가닥 분자는 15 내지 50개, 15 내지 30개, 또는 18 내지 25개의 핵산을 포함하나, 이에 한정되는 것은 아니다.
본 명세서의 miRNA는 상기 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a, miR-145-5p의 특정 염기서열(또는 서열번호)로 나타내어지는 miRNA뿐만 아니라, 상기 miRNA의 전구체(pre-miRNA, pri-miRNA), 이들과 생물학적 기능이 동등한 miRNA, 예를 들면 동족체(즉, 호몰로그 또는 오솔로그), 유전자다형 등의 변이체, 및 유도체도 포함한다. 이러한 전구체, 동족체, 변이체 또는 유도체로서는 구체적으로는 miRBase release 20(http://www.mirbase.org/)에 의해 동정할 수 있다.
본 명세서의 miRNA는 miR 유전자의 유전자 산물일 수 있으며, 이러한 유전자 산물은 성숙 miRNA 또는 miRNA 전구체(예를 들면, 상기와 같은 pre-miRNA 또는 pri-miRNA)를 포함할 수 있다.
본 명세서에서 언급되는 miRNA의 염기서열은 서열번호 1 내지 8일 수 있다(아래 표 1 참조).
서열번호 miRNA 명칭 서열 (5'->3')
1 miR-1246 AAUGGAUUUUUGGAGCAGG
2 miR-1290 UGGAUUUUUGGAUCAGGGA
3 miR-483-5p AAGACGGGAGGAAAGAAGGGAG
4 miR-429 UAAUACUGUCUGGUAAAACCGU
5 miR-34b-3p CAAUCACUAACUCCACUGCCAU
6 miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
7 miR-449a UGGCAGUGUAUUGUUAGCUGGU
8 miR-145-5p GUCCAGUUUUCCCAGGAAUCCCU
본 발명은 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 로 이루어진 군으로부터 선택된 적어도 하나의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제를 포함하는 난소암 진단용 조성물을 제공할 수 있다.
용어 “세포외 소포체(extracellular vesicle, EV)”는 세포 간 정보교환을 위해 세포들이 외부 환경으로 분비하는 소포체이다. 세포외 소포체는 엑소좀일 수 있다.
본 발명의 조성물은 피검체의 세포외 소포체(예컨대, 혈액에서 분리된 세포외 소포체, 혈장에서 분리된 세포외 소포체 또는 혈청에서 분리된 세포외 소포체) 유래의 miRNA 발현 수준을 측정하여 난소암을 진단할 수 있다. 세포외 소포체 유래 miRNA의 검출은 통상적으로는 피검체로부터 분리된 시료부터 세포외 소포체를 추출하고 세포외 소포체의 miRNA의 수준을 측정함으로써 실시할 수 있다. 이러한 세포외 소포체 miRNA의 검출은 하이브리드화 반응 및 증폭반응에 의해 측정될 수 있으나, 이에 제한되지 않고 당업계에 공지된 다양한 기술을 이용하여 용이하게 실시될 수 있다.
세포외 소포체는 혈액, 혈청 또는 혈장에서 분리된 것일 수 있다.
본 발명의 조성물은 혈액, 혈청 또는 혈장에서 분리된 세포외 소포체로부터 전술한 종류의 miRNA를 검출하여 비침습적인 방식으로 정확한 난소암 진단 효과를 나타낼 수 있다.
난소암은 고등급 장액성 난소암일 수 있으나, 이에 제한되지 않는다.
본 발명자들은 난소암 진단에 대한 바이오 마커로서 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p의 몇몇 조합이 보다 우수한 효능을 나타내는 것을 확인하였다.
구체적으로 본 발명의 난소암 진단용 조성물은 miR-1246, miR-1290 및 miR-483-5p; miR-1246, miR-1290, miR-483-5p 및 miR-429; miR-1246, miR-1290, miR-483-5p, miR-429 및 miR-34b-3p; miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p 및 miR-34c-5p; 또는 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p ;에 대한 발현 수준을 측정할 수 있는 제제를 포함할 수 있다.
일 실시예에 따르면, 난소암 진단용 조성물은 세포외 소포체 유래 miR-1246, miR-1290 및 miR-483-5p를 검출하는 제제를 포함할 수 있다. 다른 실시예에 따르면, 상기 난소암 진단용 조성물은 세포외 소포체 유래 miR-1246, miR-1290 및 miR-483-5p을 검출하는 제제와 함께 세포외 소포체 유래 miR-429를 검출하는 제제를 더 포함할 수 있다. 다른 실시예에 따르면, 상기 난소암 진단용 조성물은 세포외 소포체 유래 miR-1246, miR-1290 및 miR-483-5p을 검출하는 제제와 함께 세포외 소포체 유래 miR-429 및 miR-34b-3p 를 검출하는 제제를 더 포함할 수 있다. 다른 실시예에 따르면, 상기 난소암 진단용 조성물은 세포외 소포체 유래 miR-1246, miR-1290 및 miR-483-5p을 검출하는 제제와 함께 세포외 소포체 유래 miR-429, miR-34b-3p 및 miR-34c-5p를 검출하는 제제를 더 포함할 수 있다
또 다른 실시예에 따르면, 난소암 진단용 조성물은 세포외 소포체 유래 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p를 검출하는 제제를 포함할 수 있다.
제제는 상기 적어도 하나의 miRNA에 특이적으로 결합하는 물질일 수 있고, 예컨대 프라이머 또는 프로브를 포함할 수 있다.
핵산의 검출은 핵산 분자 또는 상기 핵산 분자의 상보물에 하이브리드화되는 하나 이상의 올리고뉴클레오타이드 프라이머를 사용하는 증폭반응에 의해 수행될 수 있다. 예컨대, 프라이머를 이용한 세포외 소포체 miRNAs의 검출은 PCR과 같은 증폭 방법을 사용하여 유전자 서열을 증폭한 다음 당 분야에 공지된 방법으로 유전자의 증폭 여부를 확인함으로써 수행될 수 있다.
프라이머는 짧은 자유 3말단 수산화기(free 3' hydroxyl group)를 갖는 핵산 서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 템플레이트 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 핵산 서열을 의미한다. 프라이머는 적절한 완충용액 및 온도에서 중합반응(즉, DNA 폴리머레이즈 또는 역전사효소)을 위한 시약 및 상이한 4가지 뉴클레오사이드 트리포스페이트의 존재하에서 DNA 합성이 개시될 수 있다. 본 발명에서는 상기 적어도 하나의 miRNA에 특이적으로 결합하는 센스 및 안티센스 프라이머를 이용하여 PCR 증폭을 실시하여 발현 수준을 확인함으로써 난소암을 진단할 수 있다. PCR 조건, 센스 및 안티센스 프라이머의 길이는 당업계에 공지된 것을 기초로 변형할 수 있다.
프로브는 짧게는 수 염기 내지 길게는 수십 염기에 해당하는 RNA 또는 DNA 등의 핵산 단편을 의미하며 라벨링되어 있다. 프로브는 올리고뉴클로타이드(oligonucleotide) 프로브, 단쇄 DNA(single stranded DNA) 프로브, 이중쇄 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다. 본 발명에서는 위 하나 이상의 miRNA와 상보적인 프로브를 이용하여 혼성화를 실시하여 발현 수준을 확인함으로써 난소암을 진단할 수 있다. 적당한 프로브의 선택 및 혼성화 조건은 당업계에 공지된 것을 기초로 변형할 수 있다.
프라이머 또는 프로브는 공지된 서열을 바탕으로 당업자가 적절히 디자인할 수 있다. 예컨대, 프라이머 또는 프로브는 포스포르아미다이트 고체 지지체 방법, 또는 기타 널리 공지된 방법을 사용하여 화학적으로 합성할 수 있다. 이러한 핵산 서열은 또한 당해 분야에 공지된 많은 수단을 이용하여 변형시킬 수 있다. 이러한 변형의 비-제한적인 예로는 메틸화, 캡화, 천연 뉴클레오타이드 하나 이상의 동족체로의 치환, 및 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로 의 변형이 있다.
miRNA의 발현 수준은 당해 분야에서 통상 사용되는 방법에 따라 측정될 수 있는데, 예컨대 역전사효소 중합효소반응(RT-PCR), 경쟁적 역전사효소 중합효소반응(Competitive RT-PCR), 실시간 역전사효소 중합효소반응 (RealtimeRT-PCR), RNase 보호 분석법(RPA; RNase protection assay), 노던 블랏팅(Northern blotting) 또는 유전자 칩 등이 포함되며 이들로 제한되는 것은 아니다.
또한, 본 발명은 전술한 조성물을 포함하는 난소암 진단용 키트를 제공한다.
키트는 전술한 miRNA 또는 세포외 소포체 유래 miRNA의 발현 수준을 측정하는 제제뿐만 아니라, 난소암 진단 키트로 사용되기에 적합하도록 당 분야에서 일반적으로 사용되는 성분, 도구, 시약 등을 더 포함할 수 있다.
상기 성분, 도구 또는 시약은 담체, 검출 가능한 신호를 생성할 수 있는 표지 물질, 발색단(chromophores), 용해제, 세정제, 완충제, 안정화제 등일 수 있다. 표지물질이 효소인 경우에는 효소 활성을 측정할 수 있는 기질 및 반응 정지제를 포함할 수 있다. 담체는 가용성 담체 또는 불용성 담체일 수 있고, 가용성 담체는 당 분야에서 공지된 생리학적으로 허용되는 완충액, 예를 들어 PBS가 있고, 불용성 담체의 일 예로 폴리스틸렌, 폴리에틸렌, 폴리프로필렌, 폴리에스테르, 폴리아크릴로니트릴, 불소 수지, 가교 덱스트란, 폴리사카라이드, 라텍스에 금속을 도금한 자성 미립자와 같은 고분자, 기타 종이, 유리, 금속, 아가로오스 및 이들의 조합일 수 있다.
또한, 본 발명은 난소암 진단을 위한 정보를 제공하는 방법을 제공한다.
본 발명의 정보를 제공하는 방법은 (a) 피검체의 시료로부터 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 로 이루어진 군으로부터 선택된 적어도 하나의 세포외 소포체 유래 miRNA의 발현 수준을 대조군 시료의 해당 세포외 소포체 유래 miRNA의 발현 수준과 비교하는 단계;를 포함할 수 있다.
“대조군 시료의 해당 세포외 소포체 유래 miRNA 발현 수준과 비교” 한다는 것은 진단의 대상인 개체의 시료로부터 분리된 세포외 소포체에서 유래한 특정 miRNA와 동일한 종류의 대조군 miRNA의 발현 정도를 비교한다는 것이다.
본 발명의 정보를 제공하는 방법은 (b) 상기 miR-1246, miR-1290, miR-483-5p 및 miR-429 중 적어도 하나의 발현 수준이 대조군 대비 높거나, 상기 miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 중 적어도 하나의 발현 수준이 대조군 대비 낮은 경우 상기 피검체가 난소암을 가지는 것으로 결정하는 단계;를 더 포함할 수 있다.
대조군은 정상 대조군일 수 있다.
피검체는 현재 난소암을 보유하고 있거나 난소암을 보유한 경험이 있는 동물 또는 난소암의 보유가 의심되는 동물일 수 있다.
시료는 혈액, 혈청, 혈장, 복수 또는 소변으로 이루어진 군에서 선택될 수 있다.
시료는 혈액에서 분리된 세포외 소포체, 혈청에서 분리된 세포외 소포체 또는 혈장에서 분리된 세포외 소포체로 이루어진 군에서 선택될 수 있다.
상기 (b) 단계는 상기 miR-1246, miR-1290 및 miR-483-5p 의 발현 수준이 대조군 대비 높으면 상기 피검체를 난소암으로 판단하는 것일 수 있다.
상기 (b) 단계는 상기 miR-1246, miR-1290, miR-483-5p 및 miR-429의 발현 수준이 대조군 대비 높으면 상기 피검체를 난소암으로 판단하는 것일 수 있다.
상기 (b) 단계는 상기 miR-1246, miR-1290, miR-483-5p 및 miR-429의 발현 수준이 대조군 대비 높고, 상기 miR-34b-3p의 발현 수준이 대조군 대비 낮으면 상기 피검체를 난소암으로 판단하는 것일 수 있다.
상기 (b) 단계는 상기 miR-1246, miR-1290, miR-483-5p 및 miR-429의 발현 수준이 대조군 대비 높고, 상기 miR-34b-3p 및 miR-34c-5p의 발현 수준이 대조군 대비 높으면 상기 피검체를 난소암으로 판단하는 것일 수 있다.
상기 (b) 단계는 상기 miR-1246, miR-1290, miR-483-5p 및 miR-429의 발현 수준이 대조군 대비 높고, 상기 miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p의 발현 수준이 대조군 대비 높으면 상기 피검체를 난소암으로 판단하는 것일 수 있다.
본 발명의 정보를 제공하는 방법은 상기 (a) 단계를 수행하기 전 피검체의 시료로부터 세포외 소포체를 분리하는 단계;를 더 포함할 수 있다.
추가로, 본 발명은 miR-1246 또는 miR-1290로 이루어진 군으로부터 선택된 적어도 하나의 miRNA의 발현 수준을 검출하는 제제를 포함하는 난소암 전이 예측용 조성물을 제공한다. 검출 대상인 상기 miRNA는 세포외 소포체 유래 miRNA일 수 있다.
세포외 소포체, miRNA, 난소암에 대해서는 전술한 바 있어 구체적인 설명은 생략한다.
또한, 본 발명은 전술한 조성물을 포함하는 난소암 전이 예측용 키트를 제공한다.
또한, 본 발명은 (i) 피검체의 시료로부터 miR-1246 및 miR-1290로 이루어진 군으로부터 선택된 적어도 하나의 세포외 소포체 유래 miRNA의 발현 수준을 대조군 시료의 해당 세포외 소포체 유래 miRNA의 발현 수준과 비교하는 단계;를 포함하는 난소암 전이 예측을 위한 정보를 제공하는 방법을 제공한다.
본 발명의 정보를 제공하는 방법은 (ii) 상기 miR-1246 및 miR-1290 중 적어도 하나의 발현 수준이 대조군 대비 높은 경우 상기 피검체가 난소암을 가지는 것으로 결정하는 단계;를 더 포함할 수 있다.
본 발명의 정보를 제공하는 방법은 상기 (i) 단계를 수행하기 전 피검체의 시료로부터 세포외 소포체를 분리하는 단계;를 더 포함할 수 있다.
대조군, 피검체 및 시료에 대한 내용은 전술한 바 있어 구체적인 설명은 생략한다.
이하, 본 발명을 구체적으로 설명하기 위해 실시예를 들어 상세하게 설명하기로 한다.
실험 방법
1. 임상 샘플 수집
본 연구는 서울대학교병원 의학연구윤리심의위원회 (IRB No. 2004-128-1117)의 승인을 받았으며 헬싱키 선언에 따라 수행되었다. 고등급 장액성 난소암(high-grade serous ovarian cancer, HGSOC) 환자로부터 서면 동의서를 취득 후, 악성 복수(malignant ascites) 시료 (N=28)를 수집하였다. 대조군으로는 양성 부인과 질환(benign gynecologic diseases) 환자의 양성 복막액 (peritoneal fluids)(N=21)이 사용되었다. 또한, HGSOC 환자(N=109) 및 양성 부인과 질환 환자(N=96)로부터 혈장 시료도 확보하였다.
2. 복수 및 혈장 준비
수집된 복수(Ascites)시료 2500 rpm, 4℃에서 10분 동안 원심분리하여 세포 분획과 무세포 분획으로 분리하여 실험에 사용 및 보관하였다. 무세포 상층액은 Falcon 70 μm 필터 (Corning, USA)를 통해 여과하여 향후 사용을 위해 -70℃에 보관하였다. EDTA 처리된 튜브에서 전혈을 채취하고 2500g, 4℃에서 15분간 원심분리하여 세포를 제거하였다. 그런 다음 상층액을 수집하고 다시 원심분리하여 혈소판을 제거시키고 향후 사용을 위해 -70℃에서 보관하였다.
3. 세포외 소포체 분리 및 식별
세포외 소포체 (Extracellular vesicles, EV) 분리 전에 -70℃에서 보관중인 복수, 혈장 및 세포 배양 배지를 해동하고 0.2 μm 주사기 필터(Sartorius, Gottingen, 독일)로 여과하였다. 복수 EV와 혈장 EV를 분리하기 위해 상용 EV isolation kit인 ExoQuick(System Biosciences, 미국)를 이용하였고, 제조업체 프로토콜에 따라 사용하였다.
4. 나노입자 추적 분석
EV 펠렛을 PBS에 현탁시키고 적절한 농도로 희석하였다. NanoSight NS300 system (Malvern Technologies, Malvern, UK)을 사용하여 나노입자 추적 분석(nanoparticle tracking analysis, NTA)으로 EV 농도 및 크기 분포를 측정하였다.
5. 투과전자현미경
PBS에 현탁된EV 10μL을 200메쉬크기인 폼바르가 코팅된 구리 그리드(formvar-coated copper grid)에 분주하고 건조시켰다. 그런 다음 그리드를 10μL의 2% 포스포텅스텐산으로 음성 염색(negatively stained)하였다. 영상 분석은 JEM 1400 투과형 전자 현미경(Jeol Ltd, Peabody, 미국)을 사용하여 EV의 형태를 확인하였다.
6. 웨스턴 블로팅
세포 배양 후 얻어진 세포를 용해 완충액에서 용해시키고 4℃에서 30분 동안 인큐베이션하였다. 용해된 세포를 13,000 rpm, 4℃에서 20분 동안 원심분리하여 상층액에서 단백질을 얻었고BCA Protein Assay kit (Thermo Scientific, Waltham, MA, 미국)를 사용하여 얻은 단백질 농도를 확인하였다. 단백질에 5X loading buffer를 가한 다음 99.9℃에서 5분간 끓여 웨스턴 블로팅 수행을 위해 단백질 구조를 변성시켰다. 단백질을 SDS-PAGE에 로딩하고 전기영동을 통해 단백질의 크기별로 분리한 다음 니트로셀룰로오스 막으로 옮겼다. 단백질이 옮겨진 니트로셀룰로오스막을 1시간 동안 5% 탈지유에서 인큐베이션하고 확인하고자 하는 단백질의 1차 항체 및 2차 항체와 함께 배양하였다. 마지막으로 ECL Western Blotting Detection Reagent(Amersham, UK)를 사용하여 신호를 검출하였다.
7. Small RNA 시퀀싱
NanoDrop 2000 Spectrophotometer 시스템(Thermo Fisher Scientific, Waltham, MA, 미국)을 사용하여 추출된RNA를 정량화하였다. 제조업체의 지침에 따라 NEBNext Multiplex Small RNA Library Prep kit New England Bio Labs, Inc.를 사용하여 라이브러리를 구축하였다. 각 샘플에 대해 total RNA 1μg을 사용하여 어댑터를 결합시키고 어댑터 특이적 프라이머와 함께 역전사효소를 사용하여 cDNA 합성을 수행하였다. 라이브러리 증폭을 위해 PCR을 수행하고 QIAquick PCR Purification Kit (Qiagen, Hilden, 독일) 및 AMPure XP beads (Beckmancoulter, CA, 미국)를 사용하여 정제하였다. 고감도 DNA 분석을 위해 Agilent 2100 Bioanalyzer 기기(Agilent Technologies, Santa Clara, CA, USA)를 이용하여 Small RNA 라이브러리의 수율 및 크기 분포를 측정하였다. 그런 다음 NextSeq500 system (Illumina, SanDiego, CA, 미국)에서 생성된 높은 처리량 시퀀스에 대해 단일 말단(single-end) 75 시퀀싱을 수행하였다.
8. 생물정보분석
자체 데이터 세트를 훈련 데이터 세트와 검증 데이터 세트로 나누었다. EdgeR N+1 정규화를 수행하였고 훈련 데이터에서 EdgeR을 사용하여 8개의 miRNA가 선택되었다. OCEM(Ovarian cancer EV miRNA) 시그니처를 기반으로 로지스틱 회귀 모형을 설정하였다. ROC 곡선(receiver operating characteristic)과 risk-probability plot을 생성하였다. 시그니처는 선정된 복수개의 세포외 소포체 유래 miRNA의 집합을 의미한다.
추가로, OCEM 시그니처의 검증을 위해 다양한 환자 모집단에 걸친 여러 공개 데이터 세트를 사용하였다. 공개 데이터 세트 간의 배치 효과(batch effect)로 인해 각 데이터 세트는 OCEM 시그니처를 사용하여 독립적으로 훈련 및 검증되었다.
9. 세포 배양
본 연구에는 인간 난소암 세포주 SKOV3 및 KURAMOCHI가 사용되었다. 배지 조성은 RPMI1640 (WelGENE, Seoul, Korea)에 10% 소태아 혈청(FBS; Gibco, MD, USA) 및 100㎍/mL의 페니실린-스트렙토마이신 (Invitrogen, Carlsbard, CA, USA)을 보충하여 세포를 배양하였다. 배양 조건은 37℃5% CO2로 맞춰진 인큐베이터에서 진행했다.
10. 난소암 세포의 EV흡수
제조업체의 프로토콜에 따라 PKH67 green fluorescent cell linker mini kit (Sigma, USA)를 이용하여 분리된 EV의 지질막을 염색해 표지하였고, 세포막을 PKH26 red fluorescent cell linker mini kit (Sigma, USA)로 표지하였다. 난소암 세포에 표지된 EV를 처리하여 6시간 동안 공동 배양하였다. 공초점 현미경 LSM800 (EVOS, USA)를 사용하여 난소암에 의한 EV 흡수를 확인하였다.
11. 침윤 및 이동 분석
난소암 세포의 침윤 및 이동 가능성을 조사하기 위해 8 μm 크기의 Transwell inserts(BD Biosciences, CA, USA)를 사용하였다. 침윤 분석을 위해서는 inserts를 Matrigel(BD Biosciences, CA, USA)로 미리 코팅하였다. 난소암 세포를 무혈청 배지 상태로 상부 챔버에 분주하고 24시간 동안 상태를 유지하였다. 그런 다음 10% FBS가 포함된 배지를 하부 챔버에 추가하여 24시간 동안 인큐베이션했다. Transwell inserts를 PBS로 세척하고 0.5% 크리스탈 바이올렛으로 침윤 및 이동된 세포를 염색하였다. 그런 다음 inserts의 상부 표면에 남아있는 세포를 제거하고, 침윤 및 이동된 세포를 현미경으로 확인하고 Image J 소프트웨어로 추가 분석하였다.
12. 오가노이드 확립
난소암 오가노이드를 확립하기 위해 악성 복수 유래 세포를 사용하였다. 세포는 페놀레드가 없는 Matrigel Growth Factor Reduced Basement Membrane Matrix(BD Bioscience, CA, USA)과 함께 분주하고 오가노이드용 배양배지에서 배양하였다. 오가노이드용 배양배지는 Penicillin/Streptomycin (Gibco) HEPES(Gibco), GlutaMax (Gibco), b-Estradiol (Sigma), Nicotinamide (Sigma), recombinant human Noggin (Peprotech), recombinant R-Spondin1 (RSPO1; Peprotech), B27 (Invitrogen), EGF (Invitrogen), FGF10 (Peprotech), HeregulinB-1 (Peprotech), Forskolin (bio-techne), Hydrocortisone (Sigma), A83-10 (bio-techne), Y-27632 dihydrochloride (Sigma), N-acetylcysteine (Sigma), Priomcin (InvivoGen) 가 포함된 고급 DMEM/F12 (Gibco, MD, 미국)을 사용하였다.
13. 3D 침윤 분석
악성 복수의 원발성 암세포(A37)를 종양 스페로이드 형성 및 3D 침윤 분석에 사용하였다. 세포를 Ultra-Low Attachment 96 웰-플레이트(Corning, USA)에 분주하여 스페로이드를 형성하였다. 3일 후, 3D 침윤 분석을 위해 스페로이드에 Matrigel과 함께 EV를 처리하였다. 72시간 후, 3D 침윤된 정도를 이미지화 시키고 ImageJ를 사용하여 침윤된 정도를 분석하였다.
14. RNA 추출 및 정량적 실시간 PCR
RNA extraction kit (Qiagen, Hilden, Germany)를 사용하여 EV에서 RNA를 추출하고, 제조업체의 지침에 따라 spike-in control Unisp6이 추가된 miRCURY LNA RT kit (Qiagen, Hilden, Germany)를 사용하여 cDNA로 전사하였다. Mir-XTM miRNA qRT-PCR TB Green® Kit(Takara, Tokyo, Japan)를 사용하여 정량적 실시간 PCR을 수행하였다. 세포는 배양 배지에서 24시간 또는 48시간 배양된 후 추가 분석을 위해 수집되었다.
15. 형질전환
Lipofectamine RNA iMAX(Invitrogen, Carlsbad, CA, USA)를 사용하여 miRNA 모방체(mimics) 또는 억제제(inhibitors)를 형질전환하였으며, Lipofectamine 3000™시약(Invitrogen, Carlsbad, CA, USA)을 사용하여 플라스미드를 형질전환하였다. 형질전환 6시간 후에 배양 배지를 교체하였다. 세포는 배양 배지에서 24시간 또는 48시간 배양된 후 추가 분석을 위해 수집되었다.
16. 루시퍼라제 리포터 분석
Lipofectamine3000 (Invitrogen, USA)를 사용하여 야생형 또는 돌연변이형 miR-1246 또는 miR-1290 결합 서열을 포함하는 pGL-3-RORα 3'UTR 리포터 플라스미드(Origene, Rockvile, USA) 및 miR-1246 또는 miR-1290 모방체 또는 음성 대조군과 함께 세포를 공동 형질전환시켰다. Luciferase Reporter Gene Detection Kit(MilliporeSigma, Missouri, USA)를 사용하여 Firefly luciferase를 검출하였다. Firefly luciferase 활성은 적색 형광 단백질(RFP) 강도에 대해 계산되었다.
17. 면역조직화학
제조사의 지침에 따라 Benchmark autostainer(Ventana, Tucson, AZ, USA)와 함께 4μm 두께 조직 마이크로어레이(tissue microarray, TMA) 섹션을 사용하여 IHC(Immunohistochemistry) 분석을 수행하였다. 추가 분석을 위해 면역반응의 강도를 점수화하였다.
18. 통계 분석
GraphPad Prism 9를 사용하여 데이터를 평균 ± SEM으로 나타내었다. 통계적 비교는 Bonferroni의 사후 검정과 함께 Student's t-검정 및 ANOVA 분석을 사용하여 수행하였다. 모든 통계 분석은 통계적으로 유의한 것으로 간주되는 p-값 <0.05로 양면 분석이었다.
전술한 실시예의 실험 방법을 요약한 플로우 차트를 도 8에 나타내었다.
실험 결과
1. 복수와 혈장으로부터 EV 분리 및 분리된 EV의 확인
수술 중, 고등급 장액성 난소암 환자 (High-grade serous ovarian cancer; HGSOC)로부터 얻은 악성 복수를 향후 사용을 위해 세포 분획과 무세포 분획으로 분리하여 실험에 사용 전까지 -70℃에서 보관하였다 (도1A). 본 연구에서는 양성 부인과 질환이 있는 여성 환자로부터 채취한 양성 복막액을 대조군으로 사용하였다. 마찬가지로 악성 및 양성 혈장 시료를 HGSOC 또는 양성 질환을 앓고 있는 환자로부터 획득하였다. 상용 키트 ExoQuic을 사용하여 양성 복막액(benign peritoneal fluids, BA), 악성 복수(malignant ascites, MA), 양성 혈장(benign plasma, BP) 및 악성 혈장(malignant plasma, MP)에서 각각 EV를 분리하였다 (도 1B). 양성 복막액에서 분리된 EV는 BA-EV, 악성 복수에서 분리된 EV는 MA-EV, 양성 혈장에서 분리된 EV는 BP-EV, 악성 혈장에서 분리된 EV는 MP-EV로 표현하였다. 나노 크기의 이중막 원형 입자로서의 EV의 전형적인 형태는 TEM으로 확인되었다 (도 1C; 스케일바 200 nm). 웨스턴 블로팅으로 EV 마커 CD9 및 CD81의 양성 발현을 입증하였다 (도 1D). 또한, NTA로 30nm에서 200nm 범위의 EV의 크기 분포를 평가했다(도 1E; 도 1ea 내지 1ed).
도 1A는 복수를 샘플링하는 과정을 도식화한 것으로, 구체적으로 HGSOC 환자로부터 얻은 악성 복수를 세포 분획 및 무세포 분획으로 처리하는 과정을 나타낸다. 도1B는 복수 및 혈장으로부터 EV 분리하는 과정을 도식화한 것으로, 복수 무세포 분획 및 혈장을 여과하고, ExoQuick kit를 적용하여 EV를 분리하는 과정을 나타낸다. 도 1C는 TEM을 통해 BA-EV, MA-EV, BP-EV 및 MP-EV의 형태학을 확인한 결과를 나타낸다. 도 1D는 웨스턴 블롯팅을 통해 BA-EV, MA-EV, BP-EV 및 MP-EV가 EV 마커를 발현하는 것을 확인한 결과를 나타낸다. 도 1E는 NTA를 통해 BA-EV, MA-EV, BP-EV 및 MP-EV의 크기 분포와 농도를 확인한 결과를 나타낸다. BA-EV: 양성 복막액 유래 EV, MA-EV: 악성 복수 유래 EV, BP-EV: 양성 혈장유래 EV, MP-EV: 악성 혈장유래 EV를 의미한다.
2. 난소암 EV miRNA(Ovarian cancer EV miRNA, OCEM) 시그니처 구축 및 검증
(1) 시그니처 구축 및 검증
MP-EVs (N=31) 및 BP-EVs (N=24)뿐만 아니라 MA-EVs(N=10) 및 BA-EVs(N=9)의 miRNA 프로파일링을 조사하기 위해 small RNA 시퀀싱을 수행하였다. 양성 그룹과 악성 그룹 사이에 P 값이 0.05 미만이고 발현이 최소 4배 이상 차이나는 miRNAs를 차등 발현된 miRNA(differentially expressed miRNAs, DEmiRs)로 간주하였다. 이 기준에 따라 BA-EV에 비해 MA-EV에서 93개의 miRNAs가 상향 조절되었고, 117개의 miRNAs가 하향 조절되었다 (도 2A 및 도 2B). 마찬가지로, BP-EV와 비교하여 MP-EV에서 21개의 miRNAs가 상향 조절되었고 45개의 miRNAs가 하향 조절되었다 (도 2C, 도 2D). 경로 분석은 DEmiRs의 많은 부분이 발암, 암 진행, 여러 암 특징 및 EV 발생 관련 경로에 밀접하게 관련되어 있음을 보여주었다.
다음으로 진단 시그니처 구축을 위한 후보 miRNAs를 선정하기 위해, 자체 데이터 세트를 훈련 및 검증 세트로 구분하였다(도 9A). DEmiRs은 훈련 세트에서만 분석되었다(도 9B 및 도 9C). 분석 결과에 따르면 복수 및 혈장 데이터 세트에서 17개의 DEmiRs이 중복되었다 (도 2E). ROC 곡선의 AUC(Area Under the Curve)를 사용하여 각 miRNA의 진단 능력을 확인하기 위해 일변량 로지스틱 회귀 분석을 수행하였다. 복수 및 혈장 훈련 세트에서 난소암 환자를 검출하는 AUC에 따라 상기 17개의 DEmiRs의 순위가 매겨졌다 (도 2F 및 2G). 복수 및 혈장 회귀 분석에서 미세 판별 효과를 보이는 8개의 miRNA(miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a, miR-145-5p)를 선정하였다(도 9D). 복수와 혈장 서브세트에서 상기 8개의 miRNA의 발현을 히트맵으로 나타냈다 (도 2H, 도 2I).
자체 데이터 세트의 검증 세트는 8종의 miRNAs를 모두 포함하는 OCEM 시그니처의 성능을 검증하기 위해 적용되었다. 결과는 OCEM 시그니처가 복수 (훈련 세트: AUC=1, 유효성 검사 세트: AUC=1) 및 혈장(훈련 세트: AUC=0.9762, 유효성 검사 세트: AUC=0.9375) 모두에서 우수한 진단 능력을 나타낸다는 것을 입증하였다 (도 2J, 도 2L; 도 2j의 y축과 더 가까운 두꺼운 실선 그래프 및 도 2l의 점섬과 가까운 진한 실선 그래프는 validation set AUC, 도 2j의 y축과 더 먼 안쪽 얇은 실선 그래프 및 도 2l의 점선과 먼 얇은 실선 그래프는 training set AUC 그래프임). 위험-확률 플롯은 양성 복막액과 악성 복수 (도 2K), 양성 및 악성 혈장 (도 2M)을 구분하였다.
도2A는 복수(ascites) 서브세트에서 DEmiRs를 나타내는 volcano plot이다 (상향 조절: N=93; 하향 조절: N=117). 도 2B(도 2ba 내지 도 2bg)는 복수 서브세트에서 DEmiRs의 발현 패턴을 나타내는 히트맵이다. 도 2C는 혈장 (plasma) 서브세트에서 DEmiRs를 나타내는 volcano plot이다 (상향 조절: N=21; 하향 조절: N=45). 도 2D(도 2da 내지 도 2dd)는 혈장 서브세트에서 DEmiRs의 발현 패턴을 나타내는 히트맵이다. 도 2E는 복수 및 혈장 훈련 세트에서 17개의 DEmiRs가 중복되는 것을 나타내는 벤다이어그램이다 (상향 조절: N=7; 하향 조절: N=10). 도 2F는 복수 훈련 세트에서 상기 17개 DEmiRs가 암 환자를 식별할 수 있는지에 대한 AUC를 입증한 단변량 로지스틱 회귀 분석 결과를 나타낸다. 도 2G는 혈장 훈련 세트에서 상기 17개 DEmiRs가 암 환자를 식별할 수 있는지에 대한 AUC를 입증한 단변량 로지스틱 회귀 분석 결과를 나타낸다. 도 2H는 복수 서브세트에서 OCEM 시그니처를 구축하기 위해 선택된 8개의 miRNA의 발현을 나타내는 히트맵이다. 도 2I는 혈장 서브세트에서 OCEM 시그니처를 구축하기 위해 선택된 8개의 miRNA의 발현을 나타내는 히트맵이다. 도 2J는 복수 훈련 및 검증 세트에서 OCEM 시그니처의 진단 능력을 나타내는 ROC곡선이다. 도 2K는 복수 훈련 및 검증 세트에서 예측 위험 확률을 나타낸 위험 확률 플롯이다. 도 2L은 혈장 훈련 및 검증 세트에서 OCEM 시그니처의 진단 능력을 나타내는 ROC곡선이다. 도 2M은 혈장 훈련 및 검증 세트에서 예측 위험 확률을 나타낸 위험 확률 플롯이다.
추가로, 위에서 선정된 8개의 miRNAs를 다양하게 조합하여, 추가 5가지의 OCEM 시그니처를 구축하였고, 이들 각 시그니처에 대해 난소암 진단 효과를 검증하였다.
아래 표 2에 검증에 사용한 다양한 조합의 OCEM 시그니처와 검증 결과를 기재하였으며, 또한, 아래 표 3에 선정된 8개의 miRNAs 각각에 대한 검증 결과를 기재하였다. 또한, 이 결과에 관련된 그래프를 도 3에 나타내었다.
시그니처 구분 시그니처를 구축하기 위해 선택된 miRNAs 마커 진단 효과 검증 결과(AUC)
OCEM-3 hsa-miR-1246, hsa-miR-1290, hsa-miR-483-5p 0.884
OCEM-4 hsa-miR-1246, hsa-miR-1290, hsa-miR-483-5p, hsa-miR-429 0.89
OCEM-5 hsa-miR-1246, hsa-miR-1290, hsa-miR-483-5p, hsa-miR-429, hsa-miR-34b-3p 0.964
OCEM-6 hsa-miR-1246, hsa-miR-1290, hsa-miR-483-5p, hsa-miR-429, hsa-miR-34b-3p, hsa-miR-34c-5p 0.97
OCEM-8 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a, miR-145-5p 0.976
miRNA 구분 진단 효과 검증 결과(AUC)
miR-429 0.625
miR-34c-5p 0.688
miR-1246 0.688
miR-145-5p 0.688
miR-483-5p 0.75
miR-449a 0.813
miR-34b-3p 0.866
miR-1290 0.884
3. 다양한 모집단에서 OCEM 시그니처의 진단 효과 확인
여러 공개 데이터 세트를 사용하여 8종의 miRNA를 모두 포함하는 OCEM 시그니처의 정확도와 임상적 사용 가능성을 검증하였다.
먼저 검증을 위해 마이크로어레이에 의한 혈청 세포외 miRNA 프로파일링 데이터를 포함하는 GSE106817(암: N=333; 비암: N=2788) 및 GSE113486(암: N=40; 비암: N=100)을 적용했다. miRNA 검출 플랫폼의 이질성과 데이터 세트 간의 배치 효과를 고려하여 각 데이터 세트에서 독립적으로 OCEM 시그니처를 재훈련했다. OCEM 시그니처는 GSE106817 (훈련 세트: AUC=0.9557; 유효성 검사 세트: AUC=0.9515) (도 4A)과 GSE113486 (훈련 세트: AUC=0.904; 유효성 검사 세트: AUC=0.095) (도 4C)에서 모든 단계의 난소암 환자를 검출하는 데 큰 차별적 성능을 보였다. 위험 확률 플롯은 OCEM 시그니처가 암과 비암 혈청을 잘 구별한다는 것을 보여주었다 (도 4B 및 도 4D).
또한 복수와 혈장에서 검출된 EV miRNA 시그니처가 암 조직의 특성을 반영할 수도 있다는 가설에 기초하여 조직 miRNA 프로파일링 데이터 세트 GSE83693 (암: N=80, 비암: N=7) 및 GSE65819 (암: N=16, 비암: N=4)에서 OCEM 시그니처를 검증했다. GSE83693 (훈련 세트: AUC=1, 유효성 검사 세트: AUC=1)과 GSE65819 (훈련 세트: AUC=1, 유효성 검사 세트: AUC=1)에서 OCEM 시그니처는 모두 우수한 진단 능력을 보였다 (도 4G; y축과 더 가까운 실선 그래프는 validation set AUC, 이보다 안쪽인 실선 그래프는 training set AUC 그래프임). 위험 확률 플롯은 OCEM 시그니처가 암과 정상 조직을 거의 완벽하게 구별할 수 있음을 설명했다 (도 4F 및 도 4H).
추가로, 소변 데이터 세트 GSE58517 (암: N=80; 비암: N=7)도 검증에 사용되었다. 흥미롭게도 OCEM 시그니처는 소변 샘플에도 적용할 수 있었다 (훈련 세트: AUC=1, 검증 세트: AUC=1) (도 4I 및 도 4J; 도 4i에서 y축과 더 가까운 실선 그래프는 validation set AUC, 이보다 안쪽인 실선 그래프는 training set AUC 그래프임). 이러한 결과는 여러 샘플 유형에 걸쳐 다양한 환자 모집단에서 8종의 miRNA로 구축된 OCEM 시그니처의 임상 적용 가능성을 강조했다.
진단 시그니처 설정을 위한 후보 miRNA를 선택할 때 다양한 플랫폼에서 miRNA의 높은 검출 가능성을 고려했지만 OCEM 시그니처에서 8개 miRNA를 모두 동시에 검출하는 데 실패한 일부 데이터 세트가 확인되었다. 흥미롭게도, OCEM 시그니처에서 단 7개의 miRNA만 검출되었음에도 불구하고 혈청 데이터 세트 E-MTAB-4667 (암: N=106; 비암: N=24)에서 강력한 진단 효능 (훈련 세트: AUC=0.9633 검증 세트: AUC=0.9003)이 관찰되었다. 또한, I기 장액성 암 조직 (N=22) 및 정상 조직 (N=9)을 포함하는 다른 조직 데이터세트 GSE127873도 검증을 위해 적용되었다. 특히, OCEM 시그니처 중 6개의 miRNA는 I기 난소암 환자를 식별하는 데 높은 AUC 및 정확성을 보였다 (훈련 세트: AUC=1; 검증 세트: AUC = 0.9091).
도 4A 및 도 4B는 혈청 데이터 세트 GSE106817 (암: N=333; 비암: N=2788)을 사용한 OCEM 시그니처 검증 결과를 나타낸다. 도 4C 및 도 4D는 혈청 데이터 세트 GSE113486 (암: N=40, 비암: N=100)을 사용한 OCEM 시그니처 검증 결과를 나타낸다. 도 4G 및 도 4H는 데이터 세트 GSE65819 (Cancer: N=16; Non-cancer: N=4)를 사용한 OCEM 시그니처 검증 결과를 나타낸다. 도 4I 및 도 4J는 소변 데이터 세트 GSE58517 (암: N=80, 비암: N=7)을 사용한 OCEM 시그니처 검증 결과를 나타낸다.
4. 악성 복수유래 EV가 난소암 전이 가능성을 촉진시키는 효과 확인
NTA를 사용하여 입자 수를 계산하여 양성 복막액과 난소암 환자의 악성 복수 사이의 EV 농도를 비교하였다. 그 결과 양성 복막액에 비해 악성 복수에서 EV 농도가 유의미하게 증가했다 (도 5A). 또한 초기 단계 (I+ 단계)보다 말기 환자에서 (III 및 IV 단계) MA-EV 농도가 높아진 것을 관찰했다 (도 5B). 결과는 MA-EV의 농도는 1차 진단받은 환자에 비해서 화학항암제 사용으로 인해 재발을 경험한 재발 환자에서 더 높은 것으로 나타났다 (도 5C). 이러한 데이터는 MA-EVs 농도가 암 진행 상황을 모니터링하는 데 유의미한 도움이 될 수 있음을 시사한다.
MA-EVs가 난소암 악성 표현형에 미치는 영향을 조사하기 위해 난소암 세포주 SKOV3, KURAMOCHI에 MA-EVs를 처리했다. 암세포막은 빨간색의 PKH26으로, MA-EVs는 녹색의 PKH-67로 염색되었다. 6시간 공 배양 후 암세포에 의한 MA-EVs의 흡수를 검출하였다 (도 5D). 그 결과, MA-EV 처리는 SKOV3와 KURAMOCHI 세포의 침윤과 이동을 현저하게 촉진하는 반면, BA-EV는 유의미한 효과를 보이지 않았다 (도 5E). 복수에 떠다니는 분리된 난소암 세포는 보통 단세포나 다세포 스페로이드 중 하나의 전이 부위에 군집한다. 따라서, MA-EVs가 종양 스페로이드에 미치는 영향을 조사하기 위해 종양 미세-전이를 모방한 3D 스페로이드 침윤 분석을 수행하였다. MA-EVs로 처리된 3D 스페로이드는 BA-EVs 또는 PBS로 처리된 스페로이드에 비해 침윤 능력이 증가했다 (도 5F; 스케일바 200 μm).
인간 샘플 유래 오가노이드 모델은 체외 암 모델과 체내 전임상 암 모델 사이의 격차를 메우는 특별한 모델로 부상했다. 우리는 복수 세포 유래 오가노이드를 개발하고 이 생체 내 유사 체외 모델에서 MA-EVs의 효과를 테스트했다. 그 결과, MA-EVs의 처리는 오가노이드의 수와 크기를 크게 증가시킨 반면, BA-EVs로 처리된 오가노이드는 PBS 대조군과 비슷한 수준을 유지했다 (도 5G).
도 5A는 NTA로 확인한 BA-EVs 및 MA-EVs의 농도를 나타낸다. 도 5B는 MA-EVs (단계 I+II) 및 MA-EVs (단계 III+IV)의 농도를 나타낸다. 도 5C는 MA-EVs (일차 진단) 및 MA-EVs (재발)의 농도를 나타낸다. 도 5D는 암세포에 의한 EV 흡수를 나타낸다. 암 세포막은 빨간색으로 PKH26으로 염색된 반면 MA-EV는 녹색으로 PKH-67로 염색되었다. SKOV3 및 KURAMOCHI에 의한 MA-EVs의 흡수는 공초점 현미경으로 감지되었다. 도 5E(도 5ea 내지 5ec)는 난소 세포를 MA-EVs 또는 BA-EVs로 처리하고 침윤 및 이동 능력을 트랜스웰 분석으로 확인하였다. 도 5F(도 5fa 내지 도 5fc)는 3D 침윤 분석 결과를 나타낸다. 암세포가 Matrigel에 침투하는 것을 현미경으로 관찰했다. 도 5G(도 5ga 내지 도 5gc; 도 5gb에서 스케일바는 윗줄 500 μm, 아랫줄 100 μm)는 MA-EVs의 효과를 평가하기 위해 복수 세포 유래 오가노이드 모델을 확립하고 복수 세포를 Matrigel에 분주하여 오가노이드 모델이 형성되는 과정을 도식화한 것이다. 14일 된 오가노이드 모델에 PBS, BA-EVs 또는 MA-EVs로 2주 동안 지속적으로 처리 후 형성된 오가노이드의 수와 크기를 평가했다. *, P<0.05; **, P<0.01; ***, P<0.001.
5. miR-1246 및 miR-1290가 난소암 세포 침윤 및 이동에 미치는 영향 확인
EV miRNA 시그니처는 액체 생검에서 임상 바이오마커 역할을 할 뿐만 아니라 암 특징에 영향을 미칠 수 있다. 난소암 전이 능력을 변경하는 것과 관련된 MA-EVs의 miRNA기능을 확인하기 위해, 복수 및 혈장 유래 EV의 miRNA 시퀀싱 결과를 참조하였다. MiR-1246 및 miR-1290은 악성 그룹에서 가장 상향 조절된 miRNA 중 하나이고 이 두 miRNA의 절대 발현 수준이 현저히 높기 때문에 이면 분석(ulterior analysis)을 위한 표적 miRNA로 선택되었다(도 10A 및 도 10B; x축 -2 이하의 부분은 Down, 2 이상의 부분은 UP임; 도 10a에서 위 화살표는 miR-1246, 아래 화살표는 miR-1290; 도 10b에서 위 화살표는 miR-1290, 아래 화살표는 miR-1246임). 복수 및 혈장 서브세트에서 miR-1246 및 miR-1290의 발현은 히트맵에 나타냈다 (도 6A 및 도 6B). miR-1246 및 miR-1290의 발현 패턴을 더 조사하기 위해 추가적으로 복수 (MA-EV: N=18, BA-EV: N=12) 및 혈장 샘플 (MP-EVs: N=78; BP-EVs: N=72)을 사용하여 RT-qPCR을 수행했다. 이 두 miRNA의 발현 수준은 MA-EVs 및 MP-EVs에서 양성EV에 비해 유의하게 상승했다 (도 6C 및 6D). 특히, miR-1246 및 miR-1290 상향 조절은 초기 (I기+II기) 암 환자에서도 관찰되었다 (도 6E 및 6F). miR-1246 및 miR-1290의 발현과 환자 생존의 상관관계를 공개 데이터 세트를 통해 확인한 결과 miR-1246 및 miR-1290발현이 높을수록 환자의 안 좋은 예후와 관련 있는 것으로 확인되었다(도 10D; 도 10da 내지 10db). 여기에서 우리 연구의 생존 분석은 혈장 EV miR-1290 수준이 환자의 전체 생존 및 무진행 생존과 강하게 연관되어 있는 반면 EV miR-1246 발현은 환자 생존과 상관관계가 없는 것으로 나타났으며(도 10E 및 도 10F; 도 10e에서 진한 선이 Low 그래프, 연한 선이 High 그래프임. 도 10f에서 Low 그래프가 High 그래프보다 원점으로부터 멀리 있음) 이는 miR-1290의 잠재적인 예후 예측 가치를 나타낸다.
miR-1246과 miR-1290의 발현이 악성 생체액에서 증가함에 따라 우리는 이러한 경향이 암세포와 정상 상피 세포 사이의 차이나는 분비에서 비롯된 것인지 궁금했다. 본 발명자들은 GSE103708의 miRNA 프로파일링 데이터를 사용하여 암세포 (N=13) 및 정상 상피 세포 (N=3) 및 각 EV에서 miR-1246 및 miR-1290의 발현을 분석했다. 그러나 세포 수준과 EV 수준 모두 정상군과 암군 간에 유의한 차이가 관찰되지 않았다. 한편 miR-1246 또는 miR-1290 발현의 차이는 HGSOC와 비-HGSOC 세포주 또는 각각의 EV 사이에서 검출되지 않았다. 특히, 세포 및 각 EV에서 miR-1246 및 miR-1290의 발현은 상관관계가 없었으며, 이는 복잡한 분류 메커니즘이 이 두 miRNA의 분비 과정에 관련될 수 있음을 나타낸다.
저산소증은 암의 중추적인 특징 중 하나이므로 우리는 저산소증이 EVs에서 miR-1246 및 miR-1290의 발현에 변화를 일으킬 수 있는지 조사했다. SKOV3 및 KURAMOCHI 세포는 정상 산소 및 저산소 조건에서 EV-free FBS가 보충된 배지에서 배양되었다. EV는 72시간 인큐베이션 후 분리되었고 TEM, NTA 및 웨스턴 블롯팅을 통해 CD63 및 CD9 발현과 함께 30 nm에서 200 nm 범위의 이중 막 입자로 확인되었다. 흥미롭게도 miR-1246 및 miR-1290의 발현은 정상산소(normoxic) EV(N-EV)보다 저산소(hypoxic) EV(H-EV)에서 극적으로 증가했다 (도 6I 및 도 6J). 그 후, 우리는 이 두 miRNA가 난소암 전이 가능성에 미치는 영향을 조사했다. 도 6K(도 6ka 내지 도 6kb; 오른쪽의 그래프는 왼쪽 각 경우의 relative cell number를 순차적으로 나타낸 것임)에 명시된 바와 같이, miR-1246 및 miR-1290의 억제는 SKOV3 및 KURAMOCHI 세포의 침윤 및 이동을 현저하게 억제한 반면, 이들 두 miRNA의 과발현은 반대 효과를 나타내었다. 이러한 결과는 MA-EVs에 캡슐화된 miR-1246 및 miR-1290이 난소암 전이를 촉진하는 데 중요한 역할을 한다는 것을 입증했다. 난소암의 주된 전이 경로는 복막을 따라 복강 내 여러 장기에 전이가 일어나는 transcolomic이다. 따라서, 본 연구에서는 난소암 환자에서 유래된 그물막 지방 조직을 이용하여 miR-1246과 miR-1290의 난소암 세포의 전이성 능력에 영향을 조사할 새로운 vivo 모델을 만들었다.miR-1246 또는 miR-1290 억제제가 투여된 SKOV3luc는 망막 조직 조각으로 이동 및 식민지화된 경우가 대조군보다 감소된반면에 miR-1246 또는 miR-1290 모방체가 투여된 경우 이동이 증가하는 것이 확인되었다 (도 6L).
도 6A는 복수 서브세트에서 miR-1246 및 miR-1290의 발현을 나타내는 히트맵이다. 도 6B는 혈장 서브세트에서 miR-1246 및 miR-1290의 발현을 나타내는 히트맵이다. 도 6C는 RT-qPCR에 의해 MA-EVs (N=18) 및 BA-EVs (N=12)에서 miR-1246 및 miR-1290의 발현을 측정한 결과를 나타낸다. 도 6D는 RT-qPCR에 의해 MP-EVs (N=78) 및 BP-EVs (N=72)에서 miR-1246 및 miR-1290의 발현을 측정한 결과를 나타낸다. 도 6E는 초기 (stage I+II)의 암환자의 MP-EVs (N=16) 및 BP-EVs (N=72)에서의 MiR-1246 및 miR-1290 발현을 비교한 결과를 나타낸다. 도 6F는 암 세포주 유래 EV의 형태를 확인하기 위해 TEM을 수행한 결과를 나타낸다. 도 6G는 웨스턴 블롯팅을 통해 암 세포주 유래 EV에서 EV 마커 CD63 및 CD9 가 발현되는지 확인한 결과를 나타낸다. 도 6H는 NTA를 사용하여 암세포주 유래 EV의 크기 기여도 및 농도를 확인한 결과를 나타낸다. 도 6I는 산소 및 정상 산소 EV에서 miR-1246의 발현을 나타낸 결과이다. 도 6J는 저산소 및 정상 산소 EV에서 miR-1290의 발현을 나타낸 결과이다. 도 6K는 miRNA 억제제 또는 모방체를 난소암 세포에 처리하여 난소암 침윤 및 이동에 미치는 영향을 조사한 결과이다. 도 6L은 난소암 환자 유래 망막 지방조직은 miRNA의 억제제 또는 모방체가 처리된 SKOV3luc 세포와 5일 동안 공동 배양했다. 외막 조직 조각으로 이동 및 콜로니를 이룬 SKOV3luc 세포의 수는 IVIS 100 영상 시스템으로 측정한 발광 강도에 의해 측정되었다. (H-EV: 저산소 EV; N-EV: 정상 산소 EV; IN: 억제; OV: 과발현; *, P<0.05; **, P<0.01; ***, P<0.001).
6. miR-1246/miR-1290-RORα의 난소암 전이 및 난소암 환자의 생존에 미치는 영향 확인
miR-1246과 miR-1290은 유사한 서열을 공유하기 때문에 일부 공통 표적에 결합할 수 있다고 가정하였다. 온라인 도구를 사용하여 miR-1246 및 miR-1290의 공통 표적을 예측했다 (도 7A). 10개의 예측된 표적 중에서 Retinoid orphan receptor alpha (RORα)는 GEPIA에서 정상 조직보다 난소암 조직에서 명백하게 하향 조절되는 유일한 표적이었다 (도 7B). 잠재적인 표적으로 RORα를 선택했다. miR-1246 및 miR-1290의 억제가 SKOV3 및 KURAMOCHI 세포에서 RORα의 발현을 유의하게 증가시킬 수 있음을 확인하였다 (도 7C). 야생형(WT) 또는 추정 결합 영역이 변경된 돌연변이된 형태 (MT)의 추정 miRNA 표적 영역을 포함하는 RORα의 부분 3'-UTR 서열이 구축되었다 (도 7D). 루시퍼라제 활성은 RORα WT 및 miR-1246 또는 miR-1290 모방체로 동시 형질감염된 세포에서만 현저하게 감소하였고, 이는 miR-1246 및 miR-1290이 3'-UTR에 결합하여 RORα를 직접 조절할 수 있음을 나타낸다 (도 7E). 난소암에서 RORα의 기능을 더 조사했다. 난소암 세포에서 RORα의 과발현은 그들의 침윤 및 이동 능력을 현저하게 방해했다 (도 7F; 오른쪽의 그래프는 왼쪽 각 경우의 relative cell number를 순차적으로 나타낸 것임). 또한, 이 억제 효과는 miR-1246 또는 miR-1290 과발현에 의해 길항되는 것이 확인되었다 (도 7G; 오른쪽의 그래프는 왼쪽 각 경우의 relative cell number를 순차적으로 나타낸 것임). 또한, RORα의 임상적 의미를 알아보기 위해 IHC 분석 (HGSOC 조직: N=58)을 수행했다. RORα의 더 높은 발현은 더 긴 전체생존과 관련이 있는 반면, 더 낮은 발현은 HGSOC 환자에서 더 짧은 전체 생존과 관련이 있었다 (도 7H 및 7I; 도 7i에서 원점과 가까운 진한 선 그래프는 RORα Low, 원점과 먼 연한 선 그래프는 RORα High 그래프임). 이러한 결과는 RORα가 난소암에서 종양 억제 유전자로 작용할 수 있음을 시사한다.
도 7A는 온라인 도구를 사용하여 miR-1246 및 miR-1290의 공통 표적을 예측한 결과를 나타낸다. 도 7B는 GEPIA에서 난소암 조직 및 정상 조직에서의 RORα 발현을 확인한 결과이다. 도 7C는 miR-1246 및 miR-1290 억제에 따른 SKOV3 및 KURAMOCHI 세포의 RORα 발현 변화를 웨스턴 블롯팅으로 측정한 결과를 나타낸다. 도 7D는 RORα 3'-UTR 야생형(WT) 또는 추정 결합 영역이 변경된 돌연변이(MT)의 추정 miRNA 표적 영역을 구축한 결과를 나타낸다. 도 7E(도 7ea 내지 도 7eb)는 이중 루시퍼라제 리포터 유전자 분석을 통해 miR-1246 및 miR-1290의 추정 결합 영역이 RORα 3'-UTR인 것을 검증한 결과를 나타낸다. 도 7F는 RORα로 과발현된 난소암 세포의 침윤 및 이동 능력을 측정한 결과를 나타낸다. 도 7G(도 7ga 내지 도 7gd)는 miR-1246 또는 miR-1290이 RORα 과발현에 의한 난소암 침윤 및 이동의 효과를 회복할 수 있는지 알아보기 위해 구조 실험을 수행한 결과를 나타낸다. 도 7H는 난소암 조직 및 정상 조직에서의 RORα를 분석한 결과를 나타낸다. 도 7I는 IHC 분석을 통해 HGSOC 환자에서 조직 RORα 발현과 전체 생존 사이의 관계를 조사한 결과를 나타낸다. (OV: 과발현. *, P<0.05; **, P<0.01; ***, P<0.001.)
전술한 실험 결과처럼, 본 발명자들은 복수 및 혈장 유래 EV의 miRNA 프로파일링을 조사하고 난소암 액체 생검에서 8 개의 miRNA 진단 시그니처를 확립했다. 이 시그니처는 자체 및 공개 데이터세트의 다양한 샘플에서 강력한 진단 능력을 보여 주었다. 추가로, 상기 8 개 miRNAs를 다양하게 조합한 시그니처를 확립하고 그들의 진단 능력을 확인하였다. 또한, 악성 복수 유래 EV가 miR-1246 및 miR-1290과 같은 기능성 miRNA를 전달함으로써 난소암 전이를 촉진할 수 있다는 것도 확인하였다.

Claims (11)

  1. miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 로 이루어진 군으로부터 선택된 적어도 하나의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제를 포함하는, 난소암 진단용 조성물.
  2. 청구항 1에 있어서, 상기 miR-1246는 서열번호 1의 서열로 이루어지고, 상기 miR-1290는 서열번호 2의 서열로 이루어지고, 상기 miR-483-5p는 서열번호 3의 서열로 이루어지고, 상기 miR-429는 서열번호 4의 서열로 이루어지고, 상기 miR-34b-3p는 서열번호 5의 서열로 이루어지고, 상기 miR-34c-5p는 서열번호 6의 서열로 이루어지고, 상기 miR-449a는 서열번호 7의 서열로 이루어지고, 상기 miR-145-5p는 서열번호 8의 서열로 이루어진 것인, 난소암 진단용 조성물.
  3. 청구항 1에 있어서, 상기 세포외 소포체는 혈액, 혈청 또는 혈장에서 분리된, 난소암 진단용 조성물.
  4. 청구항 1에 있어서, 상기 제제는 프라이머 또는 프로브를 포함하는, 난소암 진단용 조성물.
  5. 청구항 1에 있어서, 상기 조성물은 miR-1246, miR-1290 및 miR-483-5p의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제; miR-1246, miR-1290, miR-483-5p 및 miR-429의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제; miR-1246, miR-1290, miR-483-5p, miR-429 및 miR-34b-3p의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제; 또는 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p 및 miR-34c-5p의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제를 포함하는 것인, 난소암 진단용 조성물.
  6. 청구항 1에 있어서, 상기 조성물은 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p의 세포외 소포체 유래 miRNA의 발현 수준을 검출하는 제제를 포함하는 것인, 난소암 진단용 조성물.
  7. 청구항 1 내지 6 중 어느 한 항의 조성물을 포함하는 난소암 진단용 키트.
  8. (a) 피검체의 시료로부터 miR-1246, miR-1290, miR-483-5p, miR-429, miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 로 이루어진 군으로부터 선택된 적어도 하나의 세포외 소포체 유래 miRNA의 발현 수준을 대조군 시료의 해당 세포외 소포체 유래 miRNA의 발현 수준과 비교하는 단계;를 포함하는, 난소암 진단을 위한 정보를 제공하는 방법.
  9. 청구항 8에 있어서, 상기 miR-1246, miR-1290, miR-483-5p 및 miR-429 중 적어도 하나의 발현 수준이 대조군 대비 높거나, 상기 miR-34b-3p, miR-34c-5p, miR-449a 및 miR-145-5p 중 적어도 하나의 발현 수준이 대조군 대비 낮은 경우 상기 피검체가 난소암을 가지는 것으로 예측하는 단계;를 더 포함하는, 난소암 진단을 위한 정보를 제공하는 방법.
  10. 청구항 8에 있어서, 상기 시료는 혈액, 혈청 또는 혈장인, 난소암 진단을 위한 정보를 제공하는 방법.
  11. 청구항 8에 있어서, 상기 시료는 혈액에서 분리된 세포외 소포체, 혈청에서 분리된 세포외 소포체 또는 혈장에서 분리된 세포외 소포체인, 난소암 진단을 위한 정보를 제공하는 방법.
PCT/KR2023/006436 2022-05-12 2023-05-11 세포외 소포체 유래 mirna를 검출하는 제제를 포함하는 난소암 진단용 조성물 Ceased WO2023219447A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2022-0058468 2022-05-12
KR20220058468 2022-05-12
KR10-2022-0147284 2022-11-07
KR1020220147284A KR20230159796A (ko) 2022-05-12 2022-11-07 세포외 소포체 유래 miRNA를 검출하는 제제를 포함하는 난소암 진단용 조성물

Publications (1)

Publication Number Publication Date
WO2023219447A1 true WO2023219447A1 (ko) 2023-11-16

Family

ID=88730752

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/006436 Ceased WO2023219447A1 (ko) 2022-05-12 2023-05-11 세포외 소포체 유래 mirna를 검출하는 제제를 포함하는 난소암 진단용 조성물

Country Status (1)

Country Link
WO (1) WO2023219447A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120309645A1 (en) * 2010-02-05 2012-12-06 Febit Holding Gmbh miRNA IN THE DIAGNOSIS OF OVARIAN CANCER
KR20200002809A (ko) * 2017-04-28 2020-01-08 도레이 카부시키가이샤 난소 종양의 검출을 위한 키트, 디바이스, 및 방법
KR20210110073A (ko) * 2020-02-28 2021-09-07 차의과학대학교 산학협력단 난소 예비력 바이오마커 및 이의 용도
KR20220052461A (ko) * 2020-10-21 2022-04-28 순천향대학교 산학협력단 난소암 진단 또는 감별진단을 위한 마이크로rna-1246 및 이의 용도

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120309645A1 (en) * 2010-02-05 2012-12-06 Febit Holding Gmbh miRNA IN THE DIAGNOSIS OF OVARIAN CANCER
KR20200002809A (ko) * 2017-04-28 2020-01-08 도레이 카부시키가이샤 난소 종양의 검출을 위한 키트, 디바이스, 및 방법
KR20210110073A (ko) * 2020-02-28 2021-09-07 차의과학대학교 산학협력단 난소 예비력 바이오마커 및 이의 용도
KR20220052461A (ko) * 2020-10-21 2022-04-28 순천향대학교 산학협력단 난소암 진단 또는 감별진단을 위한 마이크로rna-1246 및 이의 용도

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
AZIZ NAHIAN BINTE, MAHMUDUNNABI RABBEE G., UMER MUHAMMAD, SHARMA SHAYNA, RASHID MD ABDUR, ALHAMHOOM YAHYA, SHIM YOON-BO, SALOMON C: "MicroRNAs in ovarian cancer and recent advances in the development of microRNA-based biosensors", ANALYST, ROYAL SOCIETY OF CHEMISTRY, UK, vol. 145, no. 6, 16 March 2020 (2020-03-16), UK , pages 2038 - 2057, XP093109137, ISSN: 0003-2654, DOI: 10.1039/C9AN02263E *

Similar Documents

Publication Publication Date Title
Cohen et al. A fibroblast-dependent TGF-β1/sFRP2 noncanonical Wnt signaling axis promotes epithelial metaplasia in idiopathic pulmonary fibrosis
Chung et al. Dysregulation of microRNA‐204 mediates migration and invasion of endometrial cancer by regulating FOXC1
WO2018199589A1 (ko) 위암의 생물학적 특성에 기반한 군 구분 및 예후 예측 시스템
WO2014163444A1 (ko) 국소 진행형 위암에 대한 예후 예측 시스템
WO2015156519A1 (ko) 유전자 다형성을 이용한 소라페닙 치료에 대한 반응성 예측방법
WO2021241980A1 (ko) 암 예후 예측을 위한 조성물 및 이를 포함하는 키트
WO2021086014A1 (ko) 폐암 환자의 면역치료 반응성 예측용 cxcl13 마커 및 이의 용도
WO2018169145A1 (ko) 진행성 위암 환자의 수술 후 예후 또는 항암제 적합성 예측 시스템
WO2019245135A1 (ko) 탁산계 항암제 내성 암의 진단 및 치료를 위한 조성물, 키트 및 방법
KR20140123437A (ko) 피부 자극 물질 스크리닝용 조성물 및 이를 이용한 피부 자극 물질의 스크리닝 방법
WO2009149166A2 (en) Methods and compositions for the diagnosis and treatment of proliferative disorders
Song et al. Functional variant in the 3’-untranslated region of toll-like receptor 4 is associated with nasopharyngeal carcinoma risk
WO2017026843A1 (ko) 만성골수성백혈병에 관한 정보 제공 방법
Westin et al. DNA methylation changes and increased mRNA expression of coagulation proteins, factor V and thrombomodulin in Fuchs endothelial corneal dystrophy
CN107267616B (zh) 一种非编码基因生物标记物在肝癌中的应用
WO2018026190A1 (ko) 암 예후 예측용 바이오마커
WO2023219447A1 (ko) 세포외 소포체 유래 mirna를 검출하는 제제를 포함하는 난소암 진단용 조성물
WO2016200246A1 (ko) 담도암의 항암제 내성 진단용 신규 바이오마커 및 이의 용도
WO2024085608A1 (ko) 혈액 내 rna의 엑손-접합 정보를 이용한 암 진단 방법
US10787711B2 (en) Method for differentiating between lung squamous cell carcinoma and lung adenocarcinoma
WO2014038890A1 (ko) Axl을 포함하는 융합 단백질 및 이를 포함하는 암 진단용 조성물
WO2024091020A1 (ko) 유방암 진단 또는 재발 예측을 위한 세포외 소포체 유래 miRNA 유전자 바이오마커 및 이의 용도
WO2017164568A1 (ko) V-ATPase subunit V1E1의 단백질 발현 수준을 측정하여 식도암 환자의 생존율과 예후를 예측하는 방법
WO2020117002A1 (ko) 식도편평상피암의 예후를 예측하는 방법
WO2024101823A1 (ko) 공간 전사체 분석 기반의 면역 치료 반응성 예측용 바이오마커 및 이의 용도

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23803870

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 23803870

Country of ref document: EP

Kind code of ref document: A1