WO2023121427A1 - 당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법 - Google Patents

당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법 Download PDF

Info

Publication number
WO2023121427A1
WO2023121427A1 PCT/KR2022/021327 KR2022021327W WO2023121427A1 WO 2023121427 A1 WO2023121427 A1 WO 2023121427A1 KR 2022021327 W KR2022021327 W KR 2022021327W WO 2023121427 A1 WO2023121427 A1 WO 2023121427A1
Authority
WO
WIPO (PCT)
Prior art keywords
enzyme
reb
udp
rebaudioside
enzyme protein
Prior art date
Application number
PCT/KR2022/021327
Other languages
English (en)
French (fr)
Inventor
김정민
고혁진
문준호
최은수
Original Assignee
주식회사 삼양사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 삼양사 filed Critical 주식회사 삼양사
Priority to CN202280089101.3A priority Critical patent/CN118489006A/zh
Publication of WO2023121427A1 publication Critical patent/WO2023121427A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/62—DNA sequences coding for fusion proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C12N9/1062—Sucrose synthase (2.4.1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/18—Preparation of compounds containing saccharide radicals produced by the action of a glycosyl transferase, e.g. alpha-, beta- or gamma-cyclodextrins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C12P19/56—Preparation of O-glycosides, e.g. glucosides having an oxygen atom of the saccharide radical directly bound to a condensed ring system having three or more carbocyclic rings, e.g. daunomycin, adriamycin
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a glycosyltransferase and a composition and method for producing steviol glycosides using the same, and more particularly, to a glycosyltransferase of rebaudioside that transfers glucose to steviol glycosides, and a recombinant strain expressing the enzyme , and a method for producing rebaudioside, a steviol glycoside, using the same.
  • Sweeteners are known to be the most commonly used ingredients in the food, beverage, or confectionery industry.
  • the sweetener can be incorporated into the final food product during production or, when properly diluted for stand-alone use, can be used as a table sweetener or a household substitute for sugar in baking.
  • Sweeteners include natural sweeteners such as sucrose, high fructose corn syrup, molasses, maple syrup, and honey, and artificial sweeteners such as aspartame, saccharin, and sucralose.
  • Stevia extract is a natural sweetener that can be extracted from the perennial shrub, Stevia rebaudiana .
  • Stevia extract purified to varying degrees, is used as a potent seasoning in foods and blends, or sold alone as a table sweetener.
  • composition of the stevia extract may vary greatly depending on the soil and climate in which the plant grows. Depending on the source plant, climatic conditions, and extraction process, the amount of Rebaudioside A in commercial manufacture is reported to vary from 20 to 97% of the total steviol glycoside content. Other steviol glycosides are present in varying amounts in stevia extract.
  • steviols such as Reb D and Reb M are desired in high yield.
  • steviols such as Reb D and Reb M are desired in high yield.
  • One example of the present invention relates to a glycosyltransferase that transfers glucose to a steviol glycoside, a nucleic acid molecule encoding the enzyme protein, a recombinant vector containing the nucleic acid molecule, and a transformed microorganism.
  • An example of the present invention is a glycosyltransferase protein that transfers glucose to the steviol glycoside, a recombinant microorganism expressing the enzyme protein, cells of the microorganisms, cell lysates of the microorganisms, cultures of the microorganisms, and extracts thereof. It relates to a composition for production of steviol glycosides comprising at least one selected from the group consisting of
  • An example of the present invention is a glycosyltransferase protein that transfers glucose to the steviol glycoside, a recombinant microorganism expressing the enzyme protein, cells of the microorganisms, cell lysates of the microorganisms, cultures of the microorganisms, and extracts thereof. It relates to a method for producing steviol glycosides comprising the step of reacting at least one selected from the group consisting of a substrate of the enzyme.
  • One example of the present invention relates to a method for producing steviol glycosides through glucose transfer by supplying UDP_Glucose, which is an active form of glucose, as a cofactor required when glucose is transferred to the steviol glycosides.
  • a further example of the present invention provides UDP and sucrose as cofactors necessary for transferring glucose to the steviol glycoside to provide active glucose, and further includes sucrose synthase to produce steviol glycoside through glucose transfer It's about how to do it.
  • One example of the present invention relates to a glycosyltransferase that transfers glucose to steviol glycosides, and more specifically, UDP-glucosyltransferase (ie, uridine diphosphate glucosyltransferase, abbreviated as UGT).
  • UDP-glucosyltransferase ie, uridine diphosphate glucosyltransferase, abbreviated as UGT.
  • At least one amino acid selected from the group consisting of the 201st and 202nd amino acids from the N-terminus in the amino acid sequence of SEQ ID NO: 1 is selected from the group consisting of serine and valine. It may be a mutant enzyme substituted with one or more amino acids.
  • the 201st threoin from the N-terminus is substituted with serine, the 202nd valine is substituted with leucine, or the 201st threoin is substituted with serine and the 202nd valine
  • This may include substitution with leucine, and more specifically, may include the amino acid sequence of SEQ ID NO: 3.
  • Valine at position 202 may include a substitution with leucine, and more specifically, may include a polynucleotide sequence encoded by the amino acid sequence of SEQ ID NO: 3.
  • a mutant enzyme comprising the amino acid sequence of SEQ ID NO: 3 or a polynucleotide sequence encoding the amino acid sequence.
  • TaUGTm (T201S) according to the present invention
  • Thr located at position 201 from the N-terminus in the wild-type enzyme amino acid sequence of SEQ ID NO: 1 is substituted with Ser, for example, ACC is substituted with TCA
  • TaUGTm (V202L) is Val at position 201 is substituted with Leu
  • GTA is substituted with TTA
  • TaUGTm (T201SV202L) is located at amino acids 201 and 202 from the N-terminus in the wild-type enzyme amino acid sequence of SEQ ID NO: 1.
  • Thr-Val is substituted with Ser-Leu, and more specifically, ACCGTA may be substituted with TCATTA in the polynucleotide sequence of SEQ ID NO: 2.
  • the variant UDP-glucosyl transferase may include an amino acid sequence having a sequence identity of 92% or more, 95% or more, 97% or more or 99% or more, and corresponding to the enzyme protein As long as it is an amino acid sequence that exhibits efficacy, a mutant enzyme protein including an amino acid sequence in which some sequences have been deleted, modified, substituted or added is also included. However, the mutant UDP-glucosyl transferase does not include the wild-type enzyme consisting of the amino acid sequence of SEQ ID NO: 1.
  • the mutant UDP-glucosyl transferase does not include the wild-type enzyme consisting of the polynucleotide sequence of SEQ ID NO: 2.
  • homology refers to the degree of agreement with a given amino acid sequence or polynucleotide sequence and may be expressed as a percentage.
  • a homologous sequence having the same or similar activity as a given amino acid sequence or polynucleotide sequence is indicated by "% homology” or "% identity”.
  • the mutant enzyme has an activity of 101% or more based on 100% of the activity of converting Rebaudioside A (Reb A) substrate of the wild-type enzyme comprising the amino acid sequence of SEQ ID NO: 1 to Rebaudioside D (Reb D). , For example, it may have an activity of 101% to 200%. That is, in order to improve the activity of the enzyme, enzyme improvement through mutation is performed to improve the production rate of Reb D and Reb E, and to react with the second UDP-glucosyl transferase, for example, UGT76G1 derived from stevia, to rebaudio. Side M (Reb M) can be produced. Accordingly, the productivity of Reb D and Reb E can be increased through the enzymatic conversion reaction, and a highly functional steviol glycoside called Reb M can be produced with high productivity.
  • the UDP-glucosyl transferase according to the present invention is a steviol glycoside from at least one substrate selected from the group consisting of stevioside and Reb A in the presence of a glucose donor, for example, selected from the group consisting of Reb D and Reb E In more detail, it can convert Reb A to Reb D and convert stevioside to Reb E (see Reaction Scheme 1 below), either as a single substrate or a mixture of Reb A and stevioside. All substrates have conversion activity.
  • the conversion of Reb A to Reb D is the transfer of glucose through the beta 1-2 glycoside bond in the steviol ring, mainly at position 19 of the steviol ring. generated steviol glycosides.
  • Steviol glycosides may be those in which 1 to 3 glucoses are linked by ⁇ bonds.
  • Steviol glycosides are a class of compounds found in the leaves of Stevia rebaudiana Bertoni, which are structurally composed of a single base, steviol, that differs by the presence of carbohydrate moieties at positions C13 and C19.
  • distinguished Steviol glycosides generally include, but are not limited to, stevioside, rebaudioside A (Reb A), rebaudioside B, C, D, E, F and M, and the like.
  • the conversion of Reb A to Reb D occurs by the UGT enzyme by adding one more molecule of glucose.
  • Glucose required for this reaction requires the active form of UDP-glucose, and UGT enzyme converts glucose from UDP-glucose to produce steviol glycosides. Accordingly, it relates to a fusion protein in which a UDP-glucosyl transferase according to the present invention is fused with a sucrose synthase (SUS) enzyme capable of generating UDP-glucose.
  • SUS sucrose synthase
  • UDP-glucose is an expensive co-substrate that requires a cheaper supply.
  • Sucrose Synthase SUS is an enzyme that breaks down sucrose to produce fructose and UDP-glucose. Therefore, if UDP-Glucose is supplied to the UGT enzyme by adding SUS enzyme to the reaction of converting Reb A to Reb D or the reaction of converting stevioside to Reb E, UDP-Glucose is supplied to the UGT enzyme. can be supplied and the reaction can proceed.
  • the SUS enzyme may be provided in the composition for producing steviol glycosides containing the UDP-glucosyl transferase according to the present invention as such or in the form of a fusion protein with the UDP-glucosyl transferase according to the present invention.
  • the sucrose synthase may be sucrose synthase derived from one or more microorganisms selected from the group consisting of Arabidopsis thaliana , Solanum lycopersicum , Glycine max , Nicotiana tabacum , and Thermosynechococcus elongatus , but is not limited thereto.
  • sucrose synthase may be SUS1 enzyme derived from Arabidopsis thaliana , and may include, for example, the amino acid sequence of SEQ ID NO: 4, and the polynucleotide sequence encoded by the amino acid sequence of SEQ ID NO: 4 or the polynucleotide sequence of SEQ ID NO: 5 It may have a nucleotide sequence.
  • the UDP-glucosyl transferase according to the present invention may be fused with sucrose synthase directly or through a linker.
  • the linker may be a peptide composed of 4 to 15 amino acids, and more specifically, one or more amino acids selected from the group consisting of G (Gly), S (Ser) and P (Pro) to include 4 to 15 amino acids It may be GGGS (SEQ ID NO: 7), GGGGS (SEQ ID NO: 8), GGGSGGGGS (SEQ ID NO: 9), GGGGSGGGGSGGGGS (SEQ ID NO: 10), or GGGGPSPGGGGS (SEQ ID NO: 11).
  • it may be a fusion protein linked to the UDP-glucosyl transferase according to the present invention and the SUS1 enzyme derived from Arabidopsis thaliana through a linker (GGGGSG), specifically comprising the amino acid sequence of SEQ ID NO: 7 or , or the polynucleotide sequence encoded by the amino acid sequence of SEQ ID NO: 7 or the polynucleotide sequence of SEQ ID NO: 8.
  • GGGGSG linker
  • the mutant UDP-glucosyl transferase according to the present invention has an activity that converts 45% by weight or more of Reb A to Reb D in an enzymatic reaction of 2 to 24 hours, specifically, 45% by weight or more of Reb A, At least 50% by weight, at least 70% by weight, at least 75% by weight, at least 80% by weight, at least 85% by weight or at least 95% by weight has an activity that converts to Reb D, preferably at least 70% by weight and 75% by weight More than 80% by weight, more than 85% by weight or more than 95% by weight has an activity that converts to Reb D. More specifically, the conversion activity of the enzyme may be measured under conditions of a temperature of 30 °C, pH of 7.2 and 150 rpm.
  • the Reb D conversion rate (%) is calculated by Equation 1 below, and details are described in Example 4.
  • the mutant UDP-glucosyl transferase according to the present invention is an activity that converts Reb A substrate to Reb D in an enzymatic reaction for 2 to 24 hours, and the relative activity of Reb D 101% or more, 103% or more, 105% or more, 107% or more, 108% or more, 109% or more, or 110% or more, more preferably 105% or more, 107% or more, 108% or more, 109 % or more, 110% or more, 115% or more, 120% or more or 125% or more.
  • the conversion activity of the enzyme may be measured under conditions of 30°C, pH 7.2 and 150 rpm.
  • the Reb D conversion rate of the enzyme, which converts the enzyme's Reb A alone substrate to Red D is calculated according to Equation 1 above. Detailed measurement criteria are described in Example 4 below.
  • the mutant UDP-glucosyl transferase is 50% by weight or more, 60% by weight of the mixed substrate containing stevioside and Reb A in the enzymatic reaction for 2 hours to 24 hours in the mixed substrate containing stevioside and Reb A. At least 70%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 85%, or at least 87% Reb D and Reb E It has a conversion activity (Reb D/E sum conversion rate). More specifically, the conversion activity of the enzyme may be measured under conditions of 30°C, pH 7.2 and 150 rpm.
  • the mutant UDP-glucosyl transferase according to the present invention in a 2 to 24 hour enzymatic reaction in a mixed substrate containing stevioside and Reb A, Reb A and
  • the activity of converting 50% by weight or more of the mixed substrate containing stevioside to Reb D and Reb E (reb D/E total conversion rate), the activity to convert Reb A substrate to Reb D and the conversion of stevioside to Reb E has a relative conversion of Reb D/E of 103 wt% or more, 105 wt% or more, 106 wt% or more, 108 wt% or more, 109 wt% or more, or 110 wt% or more.
  • the total relative conversion of Reb D/E of the enzyme means the Reb D/E conversion of the wild-type enzyme converted to 100% by weight of the Reb D/E conversion of the wild-type enzyme. That is, the total conversion rate of Reb D/E of the enzyme converting to Reb D/E for the mixed substrate is calculated according to Equation 2 below, and the relative total conversion rate of Reb D/E of the enzyme is Reb D/E of the wild-type enzyme. It means the total conversion rate of Reb D/E of the mutant TaUGT enzyme converted to 100% by weight of the total conversion rate.
  • the wild-type enzyme of UDP-glucosyl transferase relates to an enzyme derived from Triticum aestivum obtained by searching for enzymes derived from plants.
  • the function of the protein was revealed to confirm the UGT enzyme activity, and the enzyme activity to convert stevioside or Reb A to Reb E or Reb D, respectively, was confirmed.
  • Reb D which has high sweetness, is produced from Reb A as a sugar present in a small amount in stevia plants, and a known enzyme involved in this production process is UGT91D2 of stevia.
  • UGT91D2 An enzyme with similar activity is the EUGT11 enzyme present in rice.
  • stevia UGT91D2 although it has an activity to convert Reb A, a steviol glycoside, to Reb D, it is difficult to produce a high concentration of Reb M in high yield due to its low conversion activity.
  • UGT11 UGT derived from stevia ( Stevia rebaudiana ), UGT derived from rice ( Oryza sativa ) (hereinafter referred to as EUGT11), and UGT derived from barley ( Hordeum vulgare ) (hereinafter referred to as HvUGT) ) is there.
  • EUGT11 and HvUGT known in the art, it has substrate specificity acting on various substrates of steviol glycosides and has the advantage of not producing reaction by-products.
  • the amino acid sequence of the EUGT11 enzyme is shown in SEQ ID NO: 12, and the polynucleotide sequence is shown in SEQ ID NO: 13.
  • the amino acid sequence of the HvUGT enzyme is shown in SEQ ID NO: 14, and the polynucleotide sequence is shown in SEQ ID NO: 15.
  • UDP-glucosyl transferase according to the present invention can be carried out in an aqueous system at a reaction temperature of 10 to 50 ° C and a pH of 5.0 to 9.0.
  • the reaction may be carried out in an aqueous system at a temperature of 25 to 40°C and a pH of 6.0 to 8.0, more preferably in an aqueous system at a temperature of 30°C and a pH of 7.2.
  • the reaction may be carried out in a phosphate buffer at pH 7.2.
  • One example of the present invention relates to a nucleic acid molecule encoding a glycosyltransferase protein that transfers glucose to a steviol glycoside, a recombinant vector containing the nucleic acid molecule, and a transformed microorganism.
  • the glycosyltransferase protein that transfers glucose to the steviol glycoside can be expressed as a fusion protein fused with Sucrose Synthase (SUS) enzyme capable of generating UDP-glucose, so that it can be provided as a nucleic acid molecule encoding a fusion protein. And, it can be connected directly or through a linker with the UDP-glycosyl transferase.
  • SUS Sucrose Synthase
  • the glycosyltransferase protein, SUS enzyme, and fusion protein thereof that transfer glucose are as described above.
  • the recombinant microorganism or cell may be a microbial cell, preferably Escherichia coli, a strain of the genus Saccharomyces, for example, a strain of the genus Saccharomyces cerevisiae or Pichia. Not limited to this.
  • the term "transformation” means introducing a vector containing a nucleic acid encoding a target protein into a host cell so that the protein encoded by the nucleic acid can be expressed in the host cell.
  • the transformed nucleic acid can be expressed in the host cell, it may be inserted into and located in the chromosome of the host cell or located outside the chromosome.
  • the nucleic acid includes DNA and RNA encoding the target protein.
  • the nucleic acid may be introduced in any form as long as it can be introduced into a host cell and expressed.
  • the nucleic acid may be introduced into a host cell in the form of an expression cassette, which is a genetic construct containing all elements required for self-expression.
  • the expression cassette may include a promoter operably linked to the nucleic acid, a transcription termination signal, a ribosome binding site, and a translation termination signal.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the nucleic acid may be introduced into a host cell in its own form and operably linked to a sequence necessary for expression in the host cell, but is not limited thereto.
  • Vectors used in the present application are not particularly limited, and any vectors known in the art may be used. Examples of commonly used vectors include natural or recombinant plasmids, cosmids, viruses and bacteriophages.
  • a polynucleotide encoding a target polypeptide can be inserted into a chromosome through a vector for intracellular chromosomal insertion. Insertion of the polynucleotide into the chromosome may be performed by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • a selection marker for determining whether the chromosome is inserted may be further included.
  • operably linked means that a promoter sequence that initiates and mediates transcription of a nucleic acid encoding a target protein of the present invention and the gene sequence are functionally linked.
  • a recombinant vector including a nucleic acid molecule encoding a glycosyltransferase protein that transfers glucose to a steviol glycoside is shown in the cleavage map of FIG. 1 .
  • it may include a nucleic acid molecule encoding the enzyme according to the present invention, and a GAL10 promoter and a CYC1 terminator as transcription control sequences operable by being linked to the nucleic acid molecule.
  • the transcriptional promoters may include GAL10, GAL1, GAL2, TEF1, GPD1, and TDH3 promoters, and the transcriptional terminators may include CYC1, TEF1, and PGK1.
  • the method of transforming the vector of the present invention includes any method of introducing a nucleic acid into a cell, and can be performed by selecting an appropriate standard technique as known in the art according to the host cell. For example, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl 2 ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and acetic acid Lithium-DMSO method, etc., but is not limited thereto.
  • An example of the present invention is a glycosyltransferase protein that transfers glucose to the steviol glycoside, a recombinant microorganism expressing the enzyme protein, cells of the microorganisms, cell lysates of the microorganisms, cultures of the microorganisms, and extracts thereof. It relates to a composition for production of steviol glycosides comprising at least one selected from the group consisting of
  • the composition for producing the steviol glycoside may further include a substrate comprising at least one selected from the group consisting of stevioside and Reb A, for example, stevioside or Reb A alone substrate, or a substrate thereof. It can be a mixed substrate.
  • the mixed substrate may be a mixture of stevioside or Reb A, or a stevia extract (or stevia) containing stevioside or Reb A.
  • the substrate or reaction raw material specifically, 50 to 70 (v / v)%, 50 to 65 (v / v)%, 50 to 62 (v / v)% of Rebaudioside A based on the total volume of the stevia extract , 55 to 70 (v / v)%, 55 to 65 (v / v)%, 55 to 62 (v / v)%, 58 to 70 (v / v)%, 58 to 65 (v / v)% Or 58 to 62 (v / v)%, for example, 60 (v / v)% may be included, and stevioside is 30 to 50 (v / v)%, 30 to 45 (based on the total volume of the stevia extract) v/v)%, 30 to 42 (v/v)%, 35 to 50 (v/v)%, 35 to 45 (v/v)%, 35 to 42 (v/v)%, 38 to 50 ( v/v)%, 38 to 45 (v
  • composition for producing steviol glycosides may further include an enzyme that converts Reb D or Reb E to Reb M, for example, a second UDP-glycosyl transferase, specifically UGT76G1 derived from stevia. Include etc.
  • the composition may further include a glucose donor, for example, UDP-glucose or a saccharide capable of generating UDP-glucose.
  • a glucose donor for example, UDP-glucose or a saccharide capable of generating UDP-glucose.
  • the composition may further include a sucrose synthase (SUS) enzyme capable of generating UDP-glucose, which is an example of a glucose donor, and sucrose as its substrate.
  • SUS sucrose synthase
  • the glycosyltransferase protein that transfers glucose to the steviol glycoside may be provided as a fusion protein with the SUS enzyme protein, in which case the steviol glycoside can be produced without the need for the SUS enzyme protein and sugar. there is.
  • the culture includes an enzyme produced from a microorganism that produces UDP-glucosyl transferase, and may be in a cell-free form including or not including the strain.
  • the lysate refers to a lysate obtained by crushing the cells of a microorganism producing UDP-glucosyl transferase or a supernatant obtained by centrifuging the lysate, and includes an enzyme produced from a microorganism that produces the UDP-glucosyl transferase is to do
  • the culture of the strain includes an enzyme produced from a microorganism producing the UDP-glucosyl transferase, and may be in a cell-free form with or without the microbial cells.
  • the microorganisms producing the UDP-glucosyl transferase used are the cells of the strain, the culture of the strain, the lysate of the microbial body, the supernatant of the lysate, and extracts thereof It means including one or more selected from the group consisting of.
  • reaction temperature and reaction pH conditions using UDP-glucosyl transferase or microorganisms producing the enzyme are the same as those described above in the reaction temperature and reaction pH conditions of the enzyme. same as bar
  • An example of the present invention is a glycosyltransferase protein that transfers glucose to the steviol glycoside, a recombinant microorganism expressing the enzyme protein, cells of the microorganisms, cell lysates of the microorganisms, cultures of the microorganisms, and extracts thereof. It relates to a method for producing steviol glycosides comprising the step of reacting at least one selected from the group consisting of a substrate of the enzyme.
  • the prepared steviol glycoside may be at least one selected from the group consisting of Reb D and Reb E, or Reb M.
  • One example of the present invention is a case where the prepared steviol glycoside is at least one selected from the group consisting of Reb D and Reb E, specifically expressing the UDP-glucosyl transferase protein and the enzyme protein according to the present invention.
  • At least one substrate selected from the group consisting of recombinant microorganisms, cells of the microorganisms, cell lysates of the microorganisms, cultures of the microorganisms, and extracts thereof, and at least one substrate selected from the group consisting of stevioside and Reb A is used as a glucose donor It relates to a method for preparing at least one steviol glycoside selected from the group consisting of Reb D and Reb E, comprising reacting in the presence of.
  • a further example of the present invention is the case where the prepared steviol glycoside is Reb M, and specifically, the UDP-glucosyl transferase protein according to the present invention, a recombinant microorganism expressing the enzyme protein, a cell of the microorganism, the above Reb D and Reb are reacted with at least one substrate selected from the group consisting of cell lysates of microorganisms, cultures of the microorganisms, and extracts thereof, and at least one substrate selected from the group consisting of stevioside and Reb A in the presence of a glucose donor.
  • the prepared steviol glycoside In the group consisting of the prepared steviol glycoside, the second UDP-glucosyl transferase protein, the recombinant microorganism expressing the enzyme protein, the cell body of the microorganism, the cell lysate of the microorganism, the culture of the microorganism and extracts thereof It relates to a method for producing Reb M, a steviol glycoside, comprising the step of reacting with one or more selected species in the presence of a glucose donor.
  • the second UDP-glucosyl transferase protein used in the preparation step of Reb M may be UGT76G1 or the like.
  • the glucose donor provided in the step of preparing the steviol glycoside may be UDP-glucose, which may be provided as a compound or as sucrose and sucrose synthase (SUS) enzyme.
  • SUS enzyme is an enzyme that breaks down sugar to produce fructose and UDP-glucose. Therefore, if UDP-glucose is supplied to the UGT enzyme by introducing the SUS enzyme into the reaction of converting Reb A to Reb D or the reaction of converting stevioside to Reb E, the reaction can proceed with more economical supply of UDP-glucose. .
  • UGT and SUS are prepared as a fusion protein and the above conversion reaction is performed, two reactions form one channel and an enzymatic reaction can occur as one, so that an effective conversion reaction can be caused.
  • the SUS enzyme and the fusion protein of UGT and SUS are as described above.
  • the method for producing steviol glycosides according to the present invention can significantly shorten the production cycle, improve production capacity, and provide a product with lower cost and higher purity, it can be used economically by the food and beverage industries. .
  • the substrate of the UDP-glucosyl transferase protein according to the present invention may be a stevia extract containing 50% of Reb A and a substrate of 90% of steviol polysaccharide in the extract.
  • a stevia extract containing 50% of Reb A and a substrate of 90% of steviol polysaccharide in the extract For example, Stevia from SINOCHEM (China) Enzymatic conversion can be performed using a substrate containing 50% of Reb A as an extract and 90% of steviol polysaccharide in the extract.
  • the UDP-glucosyl transferase protein according to the present invention and steviol glycosides prepared using a recombinant microorganism expressing the enzyme protein are used as high-intensity sweeteners in addition to various foods and beverages, or are sold alone as table sweeteners.
  • the UDP-glucosyl transferase protein according to the present invention has substrate specificity acting on various substrates of steviol glycosides compared to conventionally known UGT and UGT, and has the advantage of not producing reaction by-products, and the enzyme protein and the enzyme protein At least one substrate selected from the group consisting of recombinant microorganisms to express, cells of the microorganisms, cell lysates of the microorganisms, cultures of the microorganisms and extracts thereof, and stevioside and Reb A
  • At least one substrate selected from the group consisting of Steviol glycosides can be prepared by reacting in the presence of a glucose donor, and steviol glycosides can be added and used as a high-intensity sweetener in various foods and beverages.
  • FIG. 1 is a cleavage map of a vector for preparing a yeast strain producing an enzyme converting to Reb D according to an embodiment of the present invention.
  • Figure 2 shows a graph of the results obtained by analyzing the reaction product of the enzyme converting to Reb D according to an embodiment of the present invention by HPLC analysis.
  • Example 1 Production of microorganisms expressing wild-type enzymes
  • a gene encoding a wild-type enzyme protein having the amino acid sequence of SEQ ID NO: 1 derived from Triticum aestivum was synthesized (Gblock synthesis), and the polynucleotide sequence of the synthesized gene is shown in SEQ ID NO: 2.
  • the synthesized gene was subcloned into a plasmid expressed in S. cerevisiae to create a form capable of expression.
  • the vector prepared to confirm the activity of the protein used the pRS426 vector including the Ura auxotrophic marker (selective marker) that can be selected in S. cerevisiae , and the GAL10 promoter was used as the promoter and CYC1 was used as the terminator.
  • the newly synthesized (IDT, gBlock)_SEQ ID NO: 2 gene was cloned into this plasmid.
  • a primer pair (SEQ ID NO: 19 and SEQ ID NO: 19) was prepared to overlap the GAL10 promoter (SEQ ID NO: 16) and the cyc1 terminator (SEQ ID NO: 17), and the enzyme gene was amplified through PCR amplification to perform Gibson assembly Genes were subcloned using (HIFi DNA master mix, NEW ENGLAND BIOLABS).
  • the gene in the form of the subcloned plasmid was transformed into Escherichia coli (DH5a), selected and amplified, and the sequence of the amplified plasmid was analyzed to confirm that the expression gene of the enzyme was correctly subcloned.
  • the transformation method of introducing the gene into S. cerevisiae CENPK2-1c was introduced through heat shock after treatment with 0.1 M LiAc (Lithium Acetate).
  • the introduced strain was selected in SC_Ura medium, and the enzyme activity of the selected colony was confirmed through culture.
  • the prepared recombinant plasmid was transformed into S. cerevisiae CENPK2-1c (Euroscarf) strain.
  • Recombinant strains in which the gene cassette was inserted were selected through a selectable marker in SC-Ura solid medium (SC_Ura medium + 2% agar).
  • SC_Ura medium + 2% agar The composition of the SC-Ura solid medium included 6.7 g/L of YNB, 0.7 g/L of Drop out mix, 50 g/L of Glucose and 20 g/L of agar, and the pH was adjusted to 6.0.
  • Yeast transformed with the plasmid prepared in Example 1-1 was selected in a synthetic complete (SC) medium using a URA-drop out mix, and enzyme expression was induced in the selected yeast through liquid culture.
  • SC synthetic complete
  • colonies selected from the SC_Ura solid medium were inoculated into a test tube containing 3 mL of SC_Ura liquid medium and cultured overnight.
  • the concentration of the cultured cells was confirmed by measuring the OD 600 absorbance, and inoculated into a 250 mL flask containing 25 mL of SC-Ura liquid medium so that the OD 600 absorbance finally reached 0.1 (final) and cultured for 24 hours (30 °C , 240 rpm).
  • an equal amount of YPG medium was added and secondary culture was performed for 24 hours.
  • the secondary cultured cells were collected by centrifugation (4,000 rpm, 10 min).
  • the composition of the SC_Ura liquid medium included YNB (yeast nitrogene base) 6.7 g/L, Drop-out mix g/L, Glucose g/L, and MES mM, and the pH of the medium was adjusted to 6.0 using NaOH.
  • the composition of the YPG medium included Bacto peptone 20g/L, Yeast Extract 10g/L, Galactose 20g/L, and Phosphate buffer (sodium salt) 100 mM, and the pH of the medium was adjusted to 6.0.
  • Oryza sativa- derived EUGT11 gene (SEQ ID NO: 13) and Hordeum vulgare-derived HvUGT gene (SEQ ID NO: 15) were synthesized (Gblock synthesis), and the gene was amplified in the same way as the TaUGT gene, and cloned into pRS426 vector .
  • the GAL10 promoter was used as the promoter and CYC1 was used as the terminator.
  • EUGT11 forward primer linked to the GAL10 promoter SEQ ID NO: 20
  • EUGT11 reverse primer linked to the CYC1 terminator SEQ ID NO: 21
  • HvUGT forward primer linked to the GAL10 promoter SEQ ID NO: 22
  • CYC1 HvUGT reverse primer SEQ ID NO: 23
  • S. cerevisiae CENPK2-1c (Euroscarf) was transformed in substantially the same manner as in Examples 1-1 and 1-2, and strain selection and microbial culture were performed.
  • Cells were collected from the cultures of the recombinant strains obtained in Examples 1-2 and 1-3 by centrifugation (4,000 rpm, 10 min). 10 mL of the recovered cells were collected and washed twice with the same amount of water. After resuspending the washed cells in 100 mM phosphate buffer (pH 7.2) so that the OD600 value is 100, 100 mg of glass beads (Sigma) having a diameter of 0.4 to 0.6 mm are placed in a cap tube, and 100 mM 1 ml of phosphate buffer (pH 7.2) was added. Cells were repeatedly disrupted 5 times for 30 seconds in a bead beater. The cell disruption solution was centrifuged (13,000 rpm, 15 min) in a refrigerated state to obtain a supernatant as a crude enzyme solution.
  • 100 mM phosphate buffer pH 7.2
  • the reaction solution for enzyme activity evaluation includes substrate Reb A (95%, Sinochem), MgCl2 and UDP-Glucose, and 0.1 mL of the crude enzyme solution is added thereto to prepare a total reaction volume of 0.5 mL, and in the final reaction solution
  • the substrate Reb A (95%, Sinochem) was 2 g/L, MgCl2 3 mM, and UDP-Glucose 4 mM.
  • An enzyme reaction was performed on the prepared reaction solution at a temperature of 30 ° C., pH 7.2 and 150 rpm, and samples were taken at 3 hours and 18 hours after the start of the reaction, respectively, to confirm the degree of reaction according to the rebound time.
  • the enzyme reaction solution was boiled for 5 minutes to terminate the enzyme reaction, centrifuged (13,000 rpm, 10 min), and the obtained supernatant was analyzed to confirm the enzyme reaction product. Specifically, the analysis of the enzymatic reaction product was analyzed using HPLC-Chromatography to confirm the conversion rate of the product. Since the crude enzyme solution obtained from the lysate of the recombinant strain shows an activity of converting Reb A substrate to Reb D, the activity was measured by checking the production rate of Reb D.
  • the column used for HPLC analysis of the conversion product was UG120 (C 18 250 mm X 46 mm, 5 um 110 A particle, Shideido), and the analysis was confirmed at 210 nm.
  • the mobile phase was analyzed by gradient using water containing 0.01% TFA (Trifluoroacetic acid, Sigma) and acetonitrile, respectively, and the mobile phase was flowed at 1 mL/min and analyzed for a total of 40 minutes.
  • TFA Trifluoroacetic acid, Sigma
  • acetonitrile Trifluoroacetic acid
  • a graph of HPLC analysis of the conversion product is shown in Table 3.
  • the Reb D conversion rate of the enzyme shown in Table 3, which converts the Reb A alone substrate to Red D, is calculated according to Equation 1 below, and the Reb D relative conversion rate of the enzyme is converted based on the 100% Reb D conversion rate of EUGT11.
  • Reb D conversion rate of TaUGT or HvUGT enzyme is calculated according to Equation 1 below.
  • TaUGT converted 40 to 45% of Reb A to Reb D conversion, similar to EUGT11, and about 30% more than HvUGT (30 to 35% conversion). It was confirmed that it is an enzyme with an activity enhancement of
  • the polynucleotide sequence of the TaUGT enzyme was analyzed through the polynucleotide sequence analysis service of Macrogen, and the amino acid sequence was analyzed based on the polynucleotide sequence.
  • the amino acid sequence is shown in SEQ ID NO: 1, and the polynucleotide sequence is sequence It is shown in number 2.
  • primers were synthesized (SEQ ID NOs: 24 and 25) at the corresponding site of TaUGT, PCR was performed to change the polynucleotide sequence at the corresponding site, and the amplified gene fragment was cloned into pRS426 vector through Gibson assembly. did
  • the resulting pRS426 vector was cloned and named TaUGT T201S/V202L .
  • the sequences of the primers used in this Example are shown in Table 4 below.
  • Polynucleotide sequence (5'->3') sequence number TaUGT's T201S or V202L Mutant Forward Primer CAGGTATGtcwbTAGCAGAGCGTTATTTCCTG 24 TaUGT's T201S or V202L mutation reverse primer CGCTCTGCTAvwgaCATACCTGATGCATTCTGAG 25
  • TaUGT T201S/V202L cloned into a pRS426 vector was transformed into a yeast strain using the LiAc method and selected.
  • the transformed strain was cultured in substantially the same manner as in Example 1-2.
  • Yeast transformed with the plasmid prepared in Example 2-1 was selected in a synthetic complete (SC) medium using a URA-drop out mix, and enzyme expression was induced in the selected yeast through liquid culture.
  • Cells from the culture of the recombinant strain obtained in Example 2-2 were recovered by centrifugation (4,000 rpm, 10 min). 10 mL of the recovered cells were collected and washed twice with the same amount of water. After resuspending the washed cells in 100 mM phosphate buffer (pH 7.2) so that the OD600 value is 100, 100 mg of glass beads (Sigma) having a diameter of 0.4 to 0.6 mm are placed in a cap tube, and 100 mM 1 ml of phosphate buffer (pH 7.2) was added. Cells were repeatedly disrupted 5 times for 30 seconds in a bead beater. The cell disruption solution was centrifuged (13,000 rpm, 15 min) in a refrigerated state to obtain a supernatant as a crude enzyme solution.
  • 100 mM phosphate buffer pH 7.2
  • the reaction solution for enzyme activity evaluation includes substrate Reb A (95%, Sinochem), MgCl2 and UDP-Glucose, and 0.1 mL of the crude enzyme solution is added thereto to prepare a total reaction volume of 0.5 mL, and in the final reaction solution
  • the substrate Reb A (95%, Sinochem) was 2 g/L, MgCl2 3 mM, and UDP-Glucose 4 mM.
  • An enzyme reaction was performed on the prepared reaction solution at a temperature of 30 ° C., pH 7.2 and 150 rpm, and samples were taken at 3 hours and 18 hours after the start of the reaction, respectively, to confirm the degree of reaction according to the rebound time.
  • the enzyme reaction solution was boiled for 5 minutes to terminate the enzyme reaction, centrifuged (13,000 rpm, 10 min), and the obtained supernatant was analyzed to confirm the enzyme reaction product. Specifically, the analysis of the enzymatic reaction product was analyzed using HPLC-Chromatography to confirm the conversion rate of the product. Since the crude enzyme solution obtained from the lysate of the recombinant strain shows an activity of converting Reb A substrate to Reb D, the activity was measured by checking the production rate of Reb D.
  • the column used for HPLC analysis of the conversion product was UG120 (C 18 250 mm X 46 mm, 5 um 110 A particle, Shiseido), and the analysis was confirmed at 210 nm.
  • the mobile phase was analyzed by gradient using water containing 0.01% TFA (Trifluoroacetic acid, Sigma) and acetonitrile, respectively. The mobile phase was flowed at 1 mL/min and analyzed for a total of 40 minutes.
  • the HPLC analysis conditions are shown in Table 4 below.
  • a graph of HPLC analysis of the conversion product is shown in FIG. 2 .
  • the Reb D conversion rate of the enzyme shown in Table 4, which converts the Reb A alone substrate to Red D, is calculated according to Equation 1 below, and the Reb D relative conversion rate of the enzyme is converted based on the Reb D conversion rate of 100% of the wild-type enzyme. It means the Reb D conversion rate of one TaUGT mutant enzyme.
  • FIG. 2 is an HPLC graph analyzing the reaction product of the Reb D conversion reaction using the TaUGT mutant enzyme.
  • Reb D's Conversion rate (%) Reb D's Relative Conversion Rate (%) TaUGT (wild type) 68.0 100% T201S 75.5 110.3% T201S/V202L 86.3 129.1%
  • Enzymatic reaction was performed on the prepared reaction solution at a temperature of 30 ° C., pH 7.2 and 150 rpm, and the degree of reaction was confirmed 18 hours after the start of the reaction. In substantially the same way as in Example 3, the conversion The product was analyzed by HPLC analysis.
  • the total conversion rate of Reb D/E of the enzyme to Reb D/E for the RA40 mixed substrate shown in Table 6 below is calculated according to Equation 2 below, and the relative total conversion rate of Reb D/E of the enzyme is the total conversion rate of EUGT11 It means the total conversion rate of Reb D/E of the TaUGT enzyme converted to 100% of the total conversion rate of Reb D/E.
  • Reb D/E's Total Conversion Rate (%) Reb D/E's Relative Total Conversion Rate (%) TaUGT (wild type) 18 78.0 100 TaUGT (T201S) 18 83.0 106 TaUGT (T201SV202L) 18 89.2 114
  • sucrose synthase SUS1, derived from Arabidopsis thaliana
  • the nucleic acid sequence encoding the TaUGT_T201SV202L (TaUGTm) mutant enzyme was the nucleic acid sequence of SEQ ID NO: 30 in Table 7 below, and the nucleic acid sequence of SEQ ID NO: 5 in Table 7 was used for the sucrose synthase (SUS1, derived from Arabidopsis thaliana).
  • a primer was synthesized and a linker (GGGGSG, SEQ ID NO: 8) was used to connect the amino acid sequence between TaUGTm and SUS, and each gene synthesized a primer at the corresponding position (SEQ ID NO: 26, SEQ ID NO: 27) to correspond Base sequence amplification (PCR) of the site was performed.
  • PCR gene amplification reaction
  • SUS enzyme protein used is shown in SEQ ID NO: 4
  • nucleotide sequence encoding the enzyme protein is shown in SEQ ID NO: 5
  • amino acid sequence of the fusion enzyme protein is shown in SEQ ID NO: 6.
  • linker sequence used to prepare the fusion protein has GGGGSG (SEQ ID NO: 8), and the amino acid and nucleotide sequences of the SUS1 enzyme protein and primer information used are shown in Table 8 below.
  • the prepared fusion enzyme expression vector was obtained by transforming yeast and then screening.
  • a crude enzyme solution was prepared using a lysate of the cultured cells in substantially the same manner as in Example 1-3. Specifically, in substantially the same manner as in Example 3, cells recovered from the culture of the recombinant strain by centrifugation were recovered, and the cells were disrupted with a glass bead and used as a crude enzyme solution.
  • the reaction solution was a mixture of substrate RA40 reaction substrate (90% by weight purity), MgCl 2 , UDP, and sucrose, and 0.1 mL of each of the crude enzyme solution of TaUGTm_SUS fusion enzyme was added thereto to prepare a total reaction volume of 0.5 mL , 10 g/L of RA40 reactive substrate, 1 mM of MgCl 2 , 1 mM of UDP, and 125 mM of sucrose in the final reaction solution.
  • An enzyme reaction was performed on the prepared reaction solution at a temperature of 30° C., pH 7.2, and 150 rpm, and the reaction was performed for 20 hours to confirm enzymatic conversion.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Mycology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 생산용 조성물 및 제조방법에 관한 것으로서, 더욱 자세하게는 스테비올 배당체에 글루코오스를 전이하는 레바우디오사이드의 당전이 효소 및 돌연변이 효소, 상기 효소를 발현하는 재조합 균주, 및 이들을 이용한 스테비올 배당체인 레바우디오사이드 생산방법에 관한 것이다.

Description

당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법
본 발명은 당전이 효소 및 이를 이용한 스테비올 배당체의 생산용 조성물 및 제조방법에 관한 것으로서, 더욱 자세하게는 스테비올 배당체에 글루코오스를 전이하는 레바우디오사이드의 당전이 효소, 상기 효소를 발현하는 재조합 균주, 및 이들을 이용한 스테비올 배당체인 레바우디오사이드 생산방법에 관한 것이다.
감미료는 식품, 음료, 또는 과자 산업에서 가장 흔히 이용되는 성분들로 알려져 있다. 감미료는 생산 동안 최종 식품 산물에 통합될 수 있거나 또는 단독 용도로 적절하게 희석시켰을 때, 식탁 감미료 또는 베이킹에서 설탕을 대체하는 가정용 대체물로 이용할 수 있다. 감미료는 예를 들어 수크로오스, 고과당 옥수수 시럽, 당밀, 메이플 시럽, 및 꿀과 같은 천연 감미료들, 그리고 예를 들어 아스파르탐, 사카린 및 수크랄로오스(sucralose)와 같은 인공 감미료를 포함한다.
스테비아(Stevia) 추출물은 다년생 관목, 스테비아 레바우디아나(Stevia rebaudiana)로부터 추출할 수 있는 천연 감미료이다. 다양한 수준으로 정제된 스테비아 추출물은 식품 및 블렌드에서 고감도 조미료 사용되거나 단독으로 식탁 감미료로 시판된다.
스테비아 식물의 추출물들은 레바우디오사이드 및 단맛에 기여하는 기타 스테비올 배당체들을 함유하지만, 기존의 시판 제품들은 주로 레바우디오사이드 A이며, 적은 양의 레바우디오사이드 C, D, 및 F와 같은 기타 글리코사이드들이 있다. 식물에서 추출한 스테비아 추출물은 이취(off-flavors)의 원인이 되는 유도된 화합물과 같은 오염물질을 함유할 수 있다. 이러한 이취는 선택된 식품 시스템 또는 용도에 따라 대체로 문제가 될 수 있다.
그리고, 스테비아 추출물의 조성물은 식물이 성장하는 토양 및 기후에 따라 매우 다양할 수 있다. 원료 식물, 기후 조건, 및 추출 공정에 따라, 상업적 제조 과정에서 레바우디오사이드 A의 양은 총 스테비올 글리코사이드 함량의 20 내지 97%로 다양하다고 보고된다. 또 다른 스테비올 글리코사이드들이 스테비아 추출물 내에 다양한 양으로 존재한다.
스테비아 식물로부터의 생산된 스테비아 추출물은 여러 스테비올 배당체들과 이취의 원인이 되는 화합물을 함유하고 있으며 회수 및 정제가 노동 집약적이고 비효율적이기 때문에, Reb D 및 Reb M과 같은 고수율로 요망되는 스테비올 글리코사이드를 축적할 수 있는 재조합 생산 시스템이 여전히 요구되고 있다. 이를 위하여 효율성이 좋은 효소의 개발은 여전히 필요한 것이다. 또한, 상업적 용도를 위한 재조합 숙주에서 스테비올 글리코사이드(steviol glycoside)인 Reb M의 생산을 위한 Reb D의 개선된 생산에 대한 요구가 여전히 존재한다.
본 발명의 일 예는 스테비올 배당체에 글루코오스를 전이하는 당전이 효소, 상기 효소 단백질을 암호화하는 핵산 분자, 상기 핵산 분자를 포함하는 재조합 벡터 및 형질전환 미생물에 관한 것이다.
본 발명의 일 예는 상기 스테비올 배당체에 글루코오스를 전이하는 당전이 효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상을 포함하는, 스테비올 배당체의 생산용 조성물에 관한 것이다.
본 발명의 일 예는 상기 스테비올 배당체에 글루코오스를 전이하는 당전이 효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상을, 상기 효소의 기질과 반응하는 단계를 포함하는 스테비올 배당체의 생산방법에 관한 것이다.
본 발명의 일 예는 상기 스테비올 배당체에 글루코오스를 전이할 때 필요한 보조인자가 활성형의 글루코오스인 UDP_Glucose 를 공급하며 글루코오스 전이를 통한 스테비올 배당체를 생산하는 방법에 관한 것이다.
본 발명의 추가 일 예는 상기 스테비올 배당체에 글루코오스를 전이할 때 필요한 보조인자가 활성형의 글루코오스를 제공하고자 UDP와 sucrose를 제공하고 sucrose synthase를 추가로 포함하여, 글루코오스 전이를 통한 스테비올 배당체를 생산하는 방법에 관한 것이다.
이하, 본 발명을 더욱 자세히 설명할 것이다.
본 발명의 일 예는 스테비올 배당체에 글루코오스를 전이하는 당전이 효소에 관한 것으로서, 더욱 자세하게는 UDP-글루코실 전이효소(즉, 우리딘 이인산 글루코실 전이효소, UGT로 약칭한다)이다.
구체적으로, 본 발명에 따른 UDP-글루코실 전이효소는 서열번호 1의 아미노산 서열에서 N-말단으로부터 201번째 및 202번째 아미노산으로 이루어지는 군에서 선택된 적어도 하나 이상의 아미노산이, 세린 및 발린으로 이루어지는 군에서 선택된 1종 이상의 아미노산으로 치환된 변이 효소일 수 있다. 자세하게는, 상기 변이 효소는 서열번호 1의 아미노산 서열에서 N-말단으로부터 201번째의 트레오인이 세린으로 치환, 202번째 발린이 류신으로 치환, 또는 201번째의 트레오인이 세린으로 치환과 202번째 발린이 류신으로 치환을 포함하는 것일 수 있으며, 더욱 자세하게는 서열번호 3의 아미노산 서열을 포함할 수 있다.
또한 상기 변이 효소를 암호화하는 폴리뉴클레오티드 서열은 서열번호 1의 아미노산 서열에서 N-말단으로부터 201번째의 트레오인이 세린으로 치환, 202번째 발린이 류신으로 치환 또는 201번째의 트레오인이 세린으로 치환과 202번째 발린이 류신으로 치환을 포함하는 것일 수 있으며, 더욱 자세하게는 서열번호 3의 아미노산 서열에 의해 암호화되는 폴리뉴클레오티드 서열을 포함할 수 있다. 서열번호 3의 아미노산 서열 또는 상기 아미노산 서열을 암호화하는 폴리뉴클레오티드 서열을 포함하는 변이효소이다.
본 발명에 따른 변이효소 TaUGTm(T201S)은 서열번호 1의 야생형 효소 아미노산 서열에서 N-말단으로부터 201번 위치하는 Thr 이 Ser로 치환된 것이며 예를 들면 ACC이 TCA으로 치환되고, TaUGTm(V202L)는 201번 위치하는 Val 이 Leu으로 치환된 것이며 예를 들면 GTA이 TTA으로 치환된 것이고, 또는 TaUGTm(T201SV202L)는, 서열번호 1의 야생형 효소 아미노산 서열에서 N-말단으로 부터201번 및 202번 아미노산에 해당하는 Thr-Val이 Ser-Leu으로 치환된 것이며, 더욱 자세하게는 서열번호 2의 폴리뉴클레오티드 서열에서 ACCGTA가 TCATTA로 치환될 것일 수 있다.
본 발명의 또 다른 예에 따르면, 상기 변이형 UDP-글루코실 전이효소는 서열 동일성이 92% 이상, 95% 이상, 97% 이상 또는 99% 이상인 아미노산 서열을 포함할 수 있으며, 효소 단백질과 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 포함하는 변이형 효소 단백질도 포함한다. 다만, 상기 변이형 UDP-글루코실 전이효소는 서열번호 1의 아미노산 서열로 이루어지는 야생형 효소를 포함하지 않는다.
상기 변이형 UDP-글루코실 전이효소를 암호화하는 폴리뉴클레오티드 서열과 서열 동일성이 40% 이상, 50%이상, 60%이상, 70%이상, 80%이상, 90%이상, 95%이상, 97% 이상 또는 99% 이상인 폴리뉴클레오티드 서열에 의해 암호화되는 것일 수 있다. 다만, 상기 변이형 UDP-글루코실 전이효소는 서열번호 2의 폴리뉴클레오티드 서열로 이루어지는 야생형 효소를 포함하지 않는다.
상기에서 용어 "상동성" 또는 "일치성"은 주어진 아미노산 서열 또는 폴리뉴클레오티드 서열과 일치하는 정도를 의미하며 백분율로 표시될 수 있다. 본 명세서에서, 주어진 아미노산 서열 또는 폴리뉴클레오티드 서열과 동일하거나 유사한 활성을 가지는 그의 상동성 서열이 "% 상동성" 또는 "% 동일성"으로 표시된다.
상기 변이형 효소는 서열번호 1의 아미노산 서열을 포함하는 야생형 효소의 레바우디오사이드 A(Reb A) 기질을 레바우디오사이드 D(Reb D)로 전환하는 활성 100%를 기준으로, 101% 이상, 예를 들면 101% 내지 200%의 활성을 갖는 것일 수 있다. 즉, 효소의 활성 향상을 위하여 돌연변이를 통한 효소 개량을 실시하여 Reb D와 Reb E의 생산속도를 향상시키고, 제2 UDP-글루코실 전이효소, 예를 들면 스테비아 유래의 UGT76G1과 반응하여 레바우디오사이드 M(Reb M)를 생산할 수 있다. 이에, 효소 전환 반응을 통한 Reb D와 Reb E의 생산성을 증가시키고, 이를 이용하여 Reb M라는 고기능성 스테비올 배당체를 높은 생산성으로 생산할 수 있다.
본 발명에 따른 UDP-글루코실 전이효소는, 글루코오스 공여자의 존재 하에서 스테비오사이드 및 Reb A로 이루어지는 군에서 선택되는 1종 이상의 기질로부터 스테비올 배당체, 예를 들면 Reb D 및 Reb E로 이루어지는 군에서 선택되는 1종 이상으로 전환하는 활성을 가지며, 더욱 자세하게는 Reb A를 Reb D로 전환하고, 스테비오사이드를 Reb E로 전환할 수 있으며(하기 반응식 1 참조), Reb A 및 스테비오사이드의 단독 기질 또는 혼합 기질에 대해서는 모두 전환활성을 가진다.
[반응식 1]
Figure PCTKR2022021327-appb-img-000001
상기 반응식 1에 나타낸 바와 같이, Reb A에서 Reb D로 전환하는 것은 스테비올 고리(Steviol ring)에서 beta 1-2 glycoside bond룰 통하여 글루코오스를 전이하는 것으로, 주로 스테비올 고리의 19번 위치에서 당화가 일어난 스테비올 배당체를 생성한다. 스테비올 배당체는 글루코오스(Glucose)이 β결합으로 1개 내지 3개가 결합된 것일 수 있다. 스테비올 배당체는 스테비아 레바우디아나 베르토니(Stevia rebaudiana Bertoni)의 잎에서 발견되는 화합물 부류이며, 이들은 C13 및 C19 위치에 탄수화물 잔기의 존재에 의해 상이한 단일 염기(single base)인 스테비올에 의해 구조적으로 구별된다. 스테비올 배당체는 일반적으로 스테비오사이드, 레바우디오사이드 A (Reb A), 레바우디오사이드 B, C, D, E, F 및 M 등을 포함하나 이에 한정되지 않는다.
Reb A에서 Reb D로 전환반응은 글루코오스 한 분자 더 첨가되는 반응으로 UGT 효소에 의해 일어난다. 이 반응에 필요한 글루코오스는 활성형태인 UDP-글루코오스가 필요하며, UGT효소가 UDP-글루코오스에서 글루코오스를 전이하여 스테비올 배당체를 제조한다. 따라서, 본 발명에 따른 UDP-글루코실 전이효소와 UDP-글루코오스를 생성할 수 있는 Sucrose Synthase(SUS)효소와 융합된 융합 단백질에 관한 것이다.
바람직하게는, UDP-글루코오스는 고가의 보조 기질로서 보다 저렴한 공급을 필요로 한다. Sucrose Synthase(SUS)효소는 sucrose를 분해하여 과당과 UDP-글루코오스를 만드는 효소이다. 따라서 Reb A에서 Reb D로 전환하는 반응, 혹은 스테비오사이드에서 Reb E 로 전환하는 반응에 SUS효소를 추가하여, UDP와 sucrose를 공급하여 결국 UGT 효소에 UDP-Glucose를 공급하면 보다 경제적으로 UDP-Glucose를 공급하고 반응을 진행할 수 있다. 상기 SUS 효소는, 본 발명에 따른 UDP-글루코실 전이효소를 포함하는 스테비올 배당체 생산용 조성물에 그 자체로 또는 본 발명에 따른 UDP-글루코실 전이효소와 융합 단백질 형태로 제공될 수 있다.
예를 들면, UGT와 SUS를 융합단백질로 제조하여 상기 전환반응을 수행하면, 2개의 반응이 하나의 채널을 형성하여 효소반응이 일괄하여 일어날 수 있으므로 효과적인 전환반응을 일으킬 수 있다. 또한, TaUGT_SUS 융합효소를 이용하는 경우 기질대비 1/10의 UDP를 사용하여 전환이 가능하고 UDP의 경우 RA40 대비 1/100보다 낮은 양을 이용한 반응이 가능하다. 상기 융합효소를 이용한 전환반응을 통하여 경제적인 기질 전환이 가능하였고, 고농도 기질 반응을 통한 스테비올 배당체를 생성할 수 있다.
상기 sucrose synthase는 Arabidopsis thaliana, Solanum lycopersicum, Glycine max, Nicotiana tabacum, 및 Thermosynechococcus elongatus 로 이루어지는 군에서 선택된 1종 이상의 미생물 유래 sucrose synthase일 수 있으나 이에 한정되지 않는다. 더욱 자세하게는 상기 sucrose synthase는 Arabidopsis thaliana 유래 SUS1 효소일 수 있으며, 예를 들면 서열번호 4의 아미노산 서열을 포함할 수 있으며, 서열번호 4의 아미노산 서열에 의해 암호화되는 폴리뉴클레오티드 서열 또는 서열번호 5의 폴리뉴클레오티드 서열을 가진 것일 수 있다.
본 발명에 따른 UDP-글루코실 전이효소는 직접 또는 링커를 통해 sucrose synthase와 융합될 수 있다. 상기 링커는 아미노산 4개 내지 15개로 구성된 펩타이드일 수 있으며, 더욱 자세하게는 G (Gly), S (Ser) 및 P(Pro)로 이루어지는 군에서 선택된 1종 이상의 아미노산을 4 개 내지 15개로 포함하는 것일 수 있으며, 구체적으로 GGGS(서열번호 7), GGGGS(서열번호 8), GGGSGGGGS(서열번호 9), GGGGSGGGGSGGGGS(서열번호 10), 또는 GGGGPSPGGGGS (서열번호 11)일 수 있다.
본 발명의 구체적 일 예에서, 본 발명에 따른 UDP-글루코실 전이효소와, 링커(GGGGSG)을 통해 Arabidopsis thaliana 유래 SUS1 효소와 연결된 융합 단백질 일 수 있으며, 구체적으로 서열번호 7의 아미노산 서열을 포함하거나, 또는 서열번호 7의 아미노산 서열에 의해 암호화되는 폴리뉴클레오티드 서열 또는 서열번호 8의 폴리뉴클레오티드 서열을 가질 수 있다.
본 발명에 따른 변이형 UDP-글루코실 전이효소는, 2 시간 내지 24시간 효소 반응에서, Reb A의 45중량% 이상이 Reb D로 전환하는 활성을 가지며, 구체적으로 Reb A의 45중량% 이상, 50 중량%이상, 70 중량% 이상, 75 중량%이상, 80중량% 이상, 85 중량% 이상 또는 95 중량%이상이 Reb D로 전환하는 활성을 가지며, 바람직하게는 70 중량% 이상, 75 중량%이상, 80중량% 이상, 85 중량% 이상 또는 95 중량%이상이 Reb D로 전환하는 활성을 가진다. 더욱 자세하게는 상기 효소의 전환 활성은, 온도 30℃, pH 7.2 및 150 rpm 조건에서 측정된 것일 수 있다. 상기 Reb D 전환율(%)은 하기 수학식 1에 의해 계산되며, 자세한 사항은 실시예 4에 기재되어 있다.
Figure PCTKR2022021327-appb-img-000002
본 발명에 따른 변이형 UDP-글루코실 전이효소는, 서열번호 1의 아미노산 서열을 갖는 야생형 효소에 비해, 2 시간 내지 24시간 효소 반응에서 Reb A 기질을 Reb D로 전환하는 활성으로서 Reb D의 상대 전환율이 101% 이상, 103% 이상, 105% 이상, 107% 이상, 108% 이상, 109% 이상, 또는 110% 이상을 가지며, 더욱 바람직하게는 105% 이상, 107% 이상, 108% 이상, 109% 이상, 110% 이상, 115%이상, 120%이상 또는 125%이상을 가진다. 상기 효소의 전환 활성은 30℃, pH 7.2 및 150 rpm 조건에서 측정된 것일 수 있다. 상기 효소의 Reb A 단독 기질로부터 Red D로 전환하는 상기 효소의 Reb D 전환율은 상기 수학식 1에 따라 계산한다. 자세한 측정 기준은 하기 실시예 4에 기재되어 있다.
또한, 변이형 UDP-글루코실 전이효소는, 스테비오사이드 및 Reb A을 포함하는 혼합 기질에서 2시간 내지 24 시간 효소 반응에서, 스테비오사이드 및 Reb A을 포함하는 혼합 기질의 50 중량%이상, 60 중량%이상, 70 중량%이상, 79중량%이상, 80중량%이상, 81중량%이상, 82중량%이상, 83중량%이상, 85중량%이상, 또는 87중량%이상이 Reb D 및 Reb E로 전환하는 활성(Reb D/E 합계 전환율)을 가진다. 더욱 자세하게는 상기 효소의 전환 활성은 30℃, pH 7.2 및 150 rpm 조건에서 측정된 것일 수 있다.
본 발명에 따른 변이형 UDP-글루코실 전이효소는, 서열번호 1의 아미노산 서열을 갖는 야생형 효소에 비해, 스테비오사이드 및 Reb A을 포함하는 혼합 기질에서 2 시간 내지 24시간 효소 반응에서, Reb A 및 스테비오사이드를 포함하는 혼합 기질의 50 중량%이상이 Reb D 및 Reb E로 전환하는 활성 (Reb D/E 합계 전환율)을, Reb A 기질을 Reb D 로 전환하는 활성과 스테비오사이드를 Reb E로 전환하는 활성의 합계 활성으로서 Reb D/E의 상대 전환율이 103중량% 이상, 105중량%이상, 106중량% 이상, 108중량% 이상, 109중량%이상, 또는 110중량% 이상을 가진다. 더욱 자세하게는 상기 효소의 전환 활성은 30℃, pH 7.2 및 150 rpm 조건 및 rebaudioside A: STE(stevioside) = 40:60을 갖는 혼합기질을 사용하여 측정된 것일 수 있다. 상기 효소의 Reb D/E 합계 상대 전환율은 야생형 효소의 Reb D/E 전환율 100 중량%를 기준으로 환산한 야생형 효소의 Reb D/E 전환율을 의미한다. 즉, 혼합 기질에 대한 Reb D/E로 전환하는 상기 효소의 Reb D/E 합계 전환율은 하기 수학식 2에 따라 계산하며, 효소의 Reb D/E의 상대적 합계 전환율은 야생형 효소의 Reb D/E 합계 전환율 100중량%를 기준으로 환산한 변이형 TaUGT 효소의 Reb D/E 합계 전환율을 의미한다.
Figure PCTKR2022021327-appb-img-000003
본 발명에 따른 UDP-글루코실 전이효소의 야생형 효소는 식물 유래의 효소를 탐색하여 얻어진, Triticum aestivum 유래의 효소에 관한 것이다. 상기 단백질의 기능을 밝혀 UGT효소 활성을 확인하였고, 스테비오사이드 또는 Reb A를, 각각 Reb E 또는 Reb D로 전환하는 효소 활성을 확인하였다.
고감미도를 갖는 Reb D는 스테비아 식물체에 소량 존재하는 당으로 Reb A로에서부터 생성되며, 이 생성과정에 관여하는 알려진 효소는 스테비아의 UGT91D2이다. 이와 유사한 활성을 가진 효소가 쌀에 존재하는 EUGT11효소이다. 스테비아의 UGT91D2의 경우 스테비올 글리코사이드인 Reb A를 Reb D로 전환하는 활성을 가지기는 하지만, 전환 활성이 낮아서 고농도의 Reb M을 고수율로 생산하기에는 어려움이 있다.
또한, 종래에 알려진 UGT 효소는 스테비아(Stevia rebaudiana)에서 유래하는 UGT, 벼(Oryza sativa)에서 유래하는 UGT (이하, EUGT11라 함), 겉보리 (Hordeum vulgare)에서 유래하는 UGT (이하, HvUGT 라 함)가 있다. 본 발명에 따른 UDP-글루코실 전이효소, 종래에 알려진 EUGT11 및 HvUGT에 비해 스테비올 배당체의 여러 기질에 작용하는 기질 특이성을 가지며, 반응 부산물을 만들지 않는 장점이 있다. 상기 EUGT11 효소의 아미노산 서열을 서열번호 12에 나타내고, 폴리뉴클레오타이드 서열은 서열번호 13에 나타낸다. 상기 HvUGT 효소의 아미노산 서열을 서열번호 14에 나타내고, 폴리뉴클레오타이드 서열은 서열번호 15에 나타내고 있다.
상기 서열번호 1의 아미노산 서열을 갖는 야생형 효소는 HvUGT 및 EUGT11와 아미노산 서열과 서열 동일성을 분석한 결과, HvUGT와는 91%, EUGT와는 66%의 아미노산 서열 동일성을 가지며, 폴리뉴클레오타이드 서열 동일성을 분석한 결과 HvUGT와는 36%, EUGT11와는 37%의 폴리뉴클레오타이드 서열 동일성을 갖는 것으로 분석되었다.
본 발명에 따른 UDP-글루코실 전이효소는 반응온도 10 내지 50℃ 및 pH 5.0 내지 9.0의 수계 중에서 수행하게 할 수 있다. 바람직하게는, 반응을 온도 25 내지 40℃ 및 pH 6.0 내지 8.0의 수계 (aqueous system) 중에서, 더욱 바람직하게는 반응을 온도 30℃ 및 pH 7.2의 수계 중에서 수행할 수 있다. 발명의 바람직한 일 예에 따르면, 반응을 pH 7.2의 인산 완충액 중에서 수행할 수 있다.
본 발명의 일 예는 스테비올 배당체에 글루코오스를 전이하는 당전이 효소 단백질을 암호화하는 핵산 분자, 상기 핵산 분자를 포함하는 재조합 벡터 및 형질전환 미생물에 관한 것이다.
상기 스테비올 배당체에 글루코오스를 전이하는 당전이 효소 단백질은 UDP-글루코오스를 생성할 수 있는 Sucrose Synthase(SUS)효소와 융합된 융합 단백질로 발현될 수 있도록, 융합 단백질을 암호화하는 핵산 분자로 제공될 수 있으며, 상기 UDP-글리코실 전이효소와 직접 또는 링커를 통해 연결될 수 있다. 상기 글루코오스를 전이하는 당전이 효소 단백질, SUS 효소, 이들의 융합 단백질에 대해서는 상술한 바와 같다.
본 발명에 따르면 재조합 미생물 또는 세포는 미생물 세포일 수 있고, 바람직하게는 대장균, 사카로마이세스 속 균주, 예를 들면 사카로마이세스 세레비지애 (Saccharomyces cerevisiae) 또는 피키아 속 균주 등을 포함하나 이에 한정되지 않는다.
본 명세서에서 용어 "형질전환"은 표적 단백질을 암호화하는 핵산 포함하는 벡터를 숙주세포 내에 도입하여 숙주세포 내에서 상기 핵산이 암호화하는 단백질이 발현할 수 있도록 하는 것을 의미한다. 형질전환 된 핵산은 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 핵산은 표적 단백질을 암호화하는 DNA 및 RNA를 포함한다. 상기 핵산은 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로 도입되는 것이든 상관없다. 예를 들면, 상기 핵산은 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트 (expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 핵산에 작동 가능하게 연결되어 있는 프로모터 (promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 핵산은 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 한정되지 않는다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 발명의 목적 단백질을 암호화하는 핵산의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 유전자 서열이 기능적으로 연결되어 있는 것을 의미한다.
본 발명의 일 예에 따른 스테비올 배당체에 글루코스를 전이하는 당전이 효소 단백질을 암호화하는 핵산 분자를 포함하는 재조합 벡터의 일 예는 도 1의 개열지도에 나타나 있다. 예를 들면, 본 발명에 따른 효소를 암호화하는 핵산 분자와, 상기 핵산분자에 연결되어 작동 가능한 전사 조절서열로서 GAL10 프로모터 및 CYC1터미네이터 등을 포함할 수 있다. 상기 전사 프로모터는 GAL10, GAL1, GAL2, TEF1, GPD1, 및 TDH3 프로모터 등을 포함할 수 있으며, 상기 전사 터미네이터는 CYC1, TEF1 및 PGK1 등을 포함할 수 있다.
본 발명의 벡터를 형질전환 시키는 방법은 핵산을 세포 내로 도입하는 어떤 방법도 포함되며, 숙주세포에 따라 당 분야에서 공지된 바와 같이 적합한 표준 기술을 선택하여 수행할 수 있다. 예를 들어, 전기천공법(electroporation), 인산칼슘(CaPO4) 침전, 염화칼슘(CaCl2) 침전, 미세주입법(microinjection), 폴리에틸렌 글리콜(PEG)법, DEAE-덱스트란법, 양이온 리포좀법, 및 초산 리튬-DMSO법 등이 있으나, 이에 제한되지 않는다.
본 발명의 일 예는 상기 스테비올 배당체에 글루코오스를 전이하는 당전이 효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상을 포함하는, 스테비올 배당체의 생산용 조성물에 관한 것이다.
상기 스테비올 배당체의 생산용 조성물은, 스테비오사이드 및 Reb A로 이루어지는 군에서 선택되는 1종 이상을 포함하는 기질을 추가로 포함할 수 있으며, 예를 들면 스테비오사이드 또는 Reb A 단독 기질, 또는 이들의 혼합 기질일 수 있다. 상기 혼합 기질은 스테비오사이드 또는 Reb A를 혼합하거나, 스테비오사이드 또는 Reb A를 포함하는 스테비아 추출물 (또는 스테비아)일 수 있다. 상기 기질 또는 반응 원료는, 구체적으로 레바우디오사이드 A가 스테비아 추출물 전체 부피 기준으로 50 내지 70 (v/v)%, 50 내지 65 (v/v)%, 50 내지 62 (v/v)%, 55 내지 70 (v/v)%, 55 내지 65 (v/v)%, 55 내지 62 (v/v)%, 58 내지 70 (v/v)%, 58 내지 65 (v/v)% 또는 58 내지 62 (v/v)%, 예컨대, 60 (v/v)%의 함량을 포함될 수 있고, 스테비오사이드가 스테비아 추출물 전체 부피 기준으로 30 내지 50 (v/v)%, 30 내지 45 (v/v)%, 30 내지 42 (v/v)%, 35 내지 50 (v/v)%, 35 내지 45 (v/v)%, 35 내지 42 (v/v)%, 38 내지 50 (v/v)%, 38 내지 45 (v/v)% 또는 38 내지 42 (v/v)%, 예컨대, 40 (v/v)%의 함량으로 포함될 수 있으나, 이에 제한되는 것은 아니다.
상기 스테비올 배당체의 생산용 조성물은, Reb D 또는 Reb E를, Reb M으로 전환하는 효소를 추가로 포함할 수 있으며, 예를 들면 제2 UDP-글리코실 전이효소이며, 구체적으로 스테비아 유래의 UGT76G1 등을 포함한다.
상기 조성물은 글루코오스 공여자를 추가로 포함할 수 있으며, 예를 들면 UDP-글루코오스 또는 UDP-글루코오스를 생성할 수 있는 당류를 포함한다.
상기 조성물은 글루코오스 공여자의 일 예인 UDP-글루코오스를 생성할 수 있는 Sucrose Synthase(SUS)효소와 이의 기질은 설탕(sucrose)를 추가로 포함할 수 있다. 본 발명의 일예에서, 상기 스테비올 배당체에 글루코오스를 전이하는 당전이 효소 단백질이 SUS 효소 단백질과 융합 단백질로 제공될 수 있으며, 이 경우 SUS 효소 단백질과 설탕을 필요하지 않고 스테비올 배당체를 제조할 수 있다.
상기 배양물은 UDP-글루코실 전이효소를 생산하는 미생물로부터 생산된 효소를 포함하는 것으로, 상기 균주를 포함하거나, 균주를 포함하지 않는 무세포 (cell-free) 형태일 수 있다. 상기 파쇄물은 UDP-글루코실 전이효소를 생산하는 미생물의 균체를 파쇄한 파쇄물 또는 상기 파쇄물을 원심분리하여 얻어진 상등액을 의미하는 것으로, 상기 UDP-글루코실 전이효소를 생산하는 미생물로부터 생산된 효소를 포함하는 것이다.
상기 균주의 배양물은 상기 UDP-글루코실 전이효소를 생산하는 미생물로부터 생산된 효소를 포함하는 것으로, 상기 미생물 균체를 포함하거나 포함하지 않는 무세포 (cell-free) 형태일 수 있다. 본 명세서에 있어서, 별도의 언급이 없는 한, 사용되는 UDP-글루코실 전이효소를 생산하는 미생물은 상기 균주의 균체, 상기 균주의 배양물, 상기 균체의 파쇄물, 상기 파쇄물의 상등액, 및 이들의 추출물로 이루어진 군에서 선택된 1종 이상을 포함하는 것을 의미한다.
상기 스테비올 배당체 생산용 조성물을 이용하여 스테비올 배당체를 생산하는 경우 UDP-글루코실 전이효소 또는 효소를 생산하는 미생물을 이용한 반응 온도 및 반응 pH 조건은 상기 효소의 반응온도 및 반응 pH 조건에서 상술한 바와 같다.
본 발명의 일 예는 상기 스테비올 배당체에 글루코오스를 전이하는 당전이 효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상을, 상기 효소의 기질과 반응하는 단계를 포함하는 스테비올 배당체의 생산방법에 관한 것이다.
상기 제조된 스테비올 배당체는 Reb D 및 Reb E로 이루어지는 군에서 선택된 1종 이상이거나, 또는 Reb M일 수 있다.
본 발명의 일 예는, 상기 제조된 스테비올 배당체는 Reb D 및 Reb E로 이루어지는 군에서 선택된 1종 이상인 경우로서, 구체적으로 본 발명에 따른 UDP-글루코실 전이효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상과, 스테비오사이드 및 Reb A로 이루어지는 군에서 선택된 1종 이상의 기질을 글루코오스 공여자의 존재 하에 반응하는 단계를 포함하는, Reb D 및 Reb E로 이루어지는 군에서 선택된 1종 이상의 스테비올 배당체를 제조하는 방법에 관한 것이다.
본 발명의 추가적인 일 예는, 상기 제조된 스테비올 배당체는 Reb M인 경우로서, 구체적으로 본 발명에 따른 UDP-글루코실 전이효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상과, 스테비오사이드 및 Reb A로 이루어지는 군에서 선택된 1종 이상의 기질을 글루코오스 공여자의 존재 하에 반응하여 Reb D 및 Reb E로 이루어지는 군에서 선택된 1종 이상의 스테비올 배당체를 제조하는 단계, 및
상기 제조된 스테비올 배당체, 제2 UDP-글루코실 전이효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상과, 글루코오스 공여자의 존재하에 반응하는 단계를 포함하는, 스테비올 배당체인 Reb M의 제조방법에 관한 것이다.
상기 Reb M의 제조단계에서 사용된 제2 UDP-글루코실 전이효소 단백질은 UGT76G1 등일 수 있다.
상기 스테비올 배당체를 제조하는 단계에서 제공되는 글루코오스 공여자는 UDP-글루코오스일 수 있으며, 이는 화합물로 제공되거나, 설탕과Sucrose Synthase(SUS)효소로 제공될 수 있다. SUS효소는 설탕을 분해하여 과당과 UDP-글루코오스를 만드는 효소이다. 따라서 Reb A에서 Reb D로 전환하는 반응, 혹은 스테비오사이드에서 Reb E 로 전환하는 반응에 SUS효소를 도입하여 UGT 효소에 UDP-글루코오스를 공급하면 보다 경제적으로 UDP-글루코오스를 공급하고 반응을 진행할 수 있다. 또한 UGT에 SUS를 융합단백질로 제조하여 상기 전환반응을 수행하면, 2개의 반응이 하나의 채널을 형성하여 효소반응이 하나로 일어날 수 있으므로 효과적인 전환반응을 일으킬 수 있다. 상기 SUS 효소 및 UGT와 SUS의 융합단백질에 대해서는 상술한 바와 같다.
본 발명에 따른 스테비올 배당체의 제조 방법은 생산 주기를 현저히 단축하고, 생산 능력을 향상시키고 비용이 낮고 또한 순도의 더욱 높은 제품을 제공할 수 있기 때문에, 식품, 음료 산업에 의해 경제적으로 이용할 수 있다.
본 발명에 따른 UDP-글루코실 전이효소 단백질의 기질은 스테비아 추출물로 Reb A를 50% 포함하며 추출물의 스테비올 다당체의 비율은 90%를 차지한 기질일 수 있으며, 예를 들면 SINOCHEM(중국)사의 스테비아 추출물로 Reb A를 50% 포함하며 추출물의 스테비올 다당체의 비율은 90%를 차지한 기질을 이용하여 효소 전환을 할 수 있다.
본 발명에 따른 UDP-글루코실 전이효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물을 이용하여 제조된 스테비올 배당체는 고감미도 감미료로서 다양한 식품, 음료 등에 첨가하여 사용되거나 단독으로 식탁 감미료로 시판된다.
본 발명에 따른 UDP-글루코실 전이효소 단백질은 종래 알려진 UGT에UGT에 비해 스테비올 배당체의 여러 기질에 작용하는 기질 특이성을 가지며, 반응 부산물을 만들지 않는 장점이 있으며, 상기 효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상과, 스테비오사이드 및 Reb A로 이루어지는 군에서 선택된 1종 이상의 기질을 글루코오스 공여자의 존재 하에 반응하여 스테비올 배당체를 제조할 수 있으며, 스테비올 배당체는 고감미도 감미료로서 다양한 식품, 음료 등에 첨가하여 사용될 수 있다.
도 1은 본 발명의 일 예에 따른 Reb D로 전환하는 효소를 생산하는 효모 균주의 제조를 위한 벡터의 개열지도(cleavage map)이다.
도 2는 본 발명의 일 예에 따른 Reb D로 전환하는 효소의 반응생성물을 HPLC 분석으로 분석하여 얻은 결과 그래프를 나타낸다.
본 발명을 하기 실시예를 들어 더욱 자세히 설명할 것이나, 본 발명의 범위가 하기 예시적인 실시예 범위로 한정되는 의도는 아니다.
실시예 1. 야생형 효소를 발현하는 미생물 제작
1-1: 야생형 효소를 발현하는 벡터 제작
Triticum aestivum 유래 서열번호 1의 아미노산 서열을 갖는 야생형 효소 단백질을 코딩하는 유전자를 합성(Gblock synthesis)하였으며 합성된 유전자의 폴리뉴클레오타이드 서열은 서열번호 2에 나타낸다. 합성된 유전자는 발현이 가능한 형태를 만들기 위하여 S. cerevisiae 에서 발현되는 plasmid에 subcloning하였다.
구체적으로, 단백질의 활성을 확인하기 위하여 제조한 vector는 S. cerevisiae 에서 선별이 가능한 Ura auxotrophic marker (선별마커)를 포함한 pRS426 vector를 사용하였고, promoter는 GAL10 promoter를 사용하였으며 terminator는 CYC1을 사용하였다. 이 plasmid에 새로 합성한(IDT, gBlock)_서열번호 2의 유전자를 클로닝하였다. TaUGT유전자의 클로닝을 위해 GAL10 promoter(서열번호 16)와 cyc1 terminator(서열번호 17) 와 겹치도록 프라이머 쌍(서열번호 19 및 서열번호 19)를 제작하였고, PCR 증폭을 통하여 효소유전자를 증폭하여 Gibson assembly (HIFi DNA master mix, NEW ENGLAND BIOLABS)를 통하여 유전자를 서브클로닝 하였다. 서브클로닝한 플라스미드 형태의 유전자는 대장균(DH5a)에 형질전환하여 선별 및 증폭하였고, 증폭된 플라스미드의 서열을 분석하여 해당 효소의 발현유전자가 정확하게 서브클로닝된 것을 확인하였다.
명명 폴리뉴클레오티드 서열 (5’->3’) 서열번호
GAL10 promoter의 역방향 프라이머 catCAATTCttactttttttttggatgg 16
CYC1 terminator의 정방향 프라이머 TGATTGTCGATATCATGTAATTAGTTATGTC 17
GAL10 promoter와 연결하는 TaUGT의 정방향 프라이머 catccaaaaaaaaagtaaGAATTGATGGACGACGGGTCTTCTAG 18
CYC1 terminator 연결되는 TaUGT의 역방향 프라이머 CTAATTACATGATATCGACAATCATTCTTTATAGGACCTTAGCTGttg 19
GAL10 promoter와 연결하는 EUGT11의 정방향 프라이머 catccaaaaaaaaagtaaGAATTGATGGACTCCGGCTACAGTTC 20
CYC1 terminator와 연결하는 EUGT11의 역방향 프라이머 CTAATTACATGATATCGACAATTAGTCCTTATAAGAACGTAGCTG 21
GAL10 promoter와 연결하는 HvUGT의 정방향 프라이머 catccaaaaaaaaagtaaGAATTGATGGACGGCGACGGAAAC 22
CYC1 terminator와 연결하는 HvUGT의 역방향 프라이머 CTAATTACATGATATCGACAAtcaAGCTTTGTAGGAACGCAGTTG 23
S. cerevisiae CENPK2-1c(Euroscarf)에 유전자를 도입하는 형질전환 방법은 LiAc(Lithium Acetate)를 0.1M 처리하여 열충격을 통하여 도입하였다. 도입된 균주는 SC_Ura 배지에서 선별하였고, 선별된 콜로니는 배양을 통하여 효소의 활성을 확인하였다.
제조된 재조합 플라스미드를 S. cerevisiae CENPK2-1c(Euroscarf) 균주에 형질전환하였다. SC-Ura 고체배지(SC_Ura 배지 + 2% agar)에서 선별마커를 통해 유전자 카세트 삽입된 재조합 균주들을 선별하였다. SC-Ura 고체배지의 조성은 YNB 6.7 g/L, Drop out mix 0.7 g/L, Glucose 50 g/L 및 agar 20g/L을 포함하며, pH를 6.0으로 조정하였다.
1-2: 재조합 미생물의 배양
실시예 1-1에서 제조된 Plasmid가 형질전환된 효모를 URA-drop out mix를 이용한 SC(synthetic complete) 배지에서 선별하였고, 선별된 효모는 액체 배양을 통하여 효소 발현을 유도하였다.
구체적으로, SC_Ura 고체배지에서 선별된 콜로니를 3 mL SC_Ura 액체배지가 포함된 시험관에 접종하여 밤새 배양하였다. 배양된 균체의 농도를 OD600 흡광도를 측정하여 확인하고, 25 mL의 SC-Ura 액체배지를 담은 250 mL 플라스크에 OD600 흡광도가 최종적으로 0.1(final)이 되게 접종하여 24시간동안 배양(30℃, 240 rpm)하였다. 1차 배양한 균체의 효소 발현을 유도하기 위하여 YPG 배지를 동량 첨가하여 24시간 동안 2차로 배양하였다. 상기 2차 배양한 균체는 원심분리(4,000 rpm, 10 min)를 수행하여 모았다. SC_Ura 액체 배지의 조성은 YNB (yeast nitrogene base) 6.7 g/L, Drop-out mix g/L, Glucose g/L 및 MES mM을 포함하고, NaOH를 이용하여 배지 pH를 6.0으로 조정하였다. 상기 YPG 배지 조성은 Bacto peptone 20g/L, Yeast Extract 10g/L, Galactose 20g/L 및 Phosphate buffer (sodium salt) 100 mM을 포함하며, 배지의 pH를 6.0으로 조정하였다.
1-3: EUGT11 및 HvUGT을 발현하는 미생물 제조
기존의 활성이 알려진 Oryza sativa 유래 EUGT11 유전자(서열번호 13)과 Hordeum vulgare 유래 HvUGT의 유전자 (서열번호 15)를 합성(Gblock synthesis)하였고, TaUGT유전자와 동일하게 유전자를 증폭하여, pRS426 vector에 클로닝하였다. 동일한 조건으로 효소 발현을 유도하기 위하여 promoter는 GAL10 promoter를 사용하였으며 terminator는 CYC1을 사용하였다. 구체적으로, GAL10 promoter와 연결하는 EUGT11의 정방향 프라이머 (서열번호 20), CYC1 terminator와 연결하는 EUGT11의 역방향 프라이머 (서열번호 21), GAL10 promoter와 연결하는 HvUGT의 정방향 프라이머 (서열번호 22), 및 CYC1 terminator와 연결하는 HvUGT의 역방향 프라이머 (서열번호 23)를 사용하였다. 상기 생산된 효소 생산 유전자 카세트를 상기 표 1에서 Sc는 Saccharomyces cerevisiae를 의미한다.
이후, 실시예 1-1 및 1-2의 방법과 실질적으로 동일한 방법으로 S. cerevisiae CENPK2-1c(Euroscarf)에 형질전환하고, 균주 선별 및 미생물 배양을 수행하였다.
1-4: 효소 활성 평가
실시예 1-2 및 실시예 1-3에서 얻은 재조합 균주의 배양물에서 균체를 원심분리(4,000rpm, 10 min)하여 회수하였다. 상기 회수한 균체를 10mL 모아 동량의 물로 2회 세척하였다. 상기 세척된 균체를 100 mM phosphate buffer (pH 7.2)에 재현탁하여 OD600 값이 100이 되도록 한 후, 0.4~0.6 mm입경을 갖는 glass bead(Sigma)을 100 mg 양을 cap tube에 넣고, 100 mM phosphate buffer(pH 7.2)를 1 ml 첨가하였다. 균체를 bead beater에서 30초 동안 5회 반복하여 파쇄하였다. 상기 균체 파쇄액을 냉장상태에서 원심분리(13,000 rpm, 15 min)하여 상등액을 조효소액으로 얻었다.
효소 활성 평가를 위한 반응액은 기질 Reb A(95%, Sinochem), MgCl2 및 UDP-Glucose을 포함하며 여기에 상기 조효소액 0.1mL을 첨가하여 전체 반응 부피 0.5 mL를 제조하고, 상기 최종 반응액에서 기질 Reb A(95%, Sinochem) 2 g/L, MgCl2 3 mM, 및 UDP-Glucose 4 mM 가 되도록 하였다. 상기 제조된 반응액에 대해 온도 30℃, pH 7.2 및 150 rpm 조건에서 효소 반응을 수행하고, 반응 시작 후 3시간과 18시간에 각각 시료를 채취하여 반등시간에 따른 반응 정도를 확인하였다.
상기 효소 반응액을 5 분간 끓여 효소 반응을 종료하고, 원심분리(13,000 rpm, 10 min)하고 얻어진 상등액을 분석하여 효소반응 생성물을 확인하였다. 구체적으로 효소반응 생성물의 분석은 HPLC-Chromatography를 이용하여 분석하여 생성물의 전환 비율을 확인하였다. 상기 재조합 균주의 균체 파쇄물에서 얻은 조효소액은 Reb A 기질을 Reb D로 전환하는 활성을 보이므로 Reb D의 생성 비율을 확인하여 활성을 측정하였다.
구체적으로 전환 생성물의 HPLC 분석에 사용된 column은 UG120 (C18 250 mm X 46 mm, 5 um 110 A particle, Shideido)을 이용하였고, 분석은 210 nm에서 확인하였다. 이동상은 0.01% TFA (Trifluoroacetic acid, Sigma)를 포함한 물과 아세토나이트릴을 각각 이용하여 Gradient로 분석하였으며, 이동상은 1 mL/min으로 흘려주고 총 40분 분석을 통하여 확인하였다. 상기 HPLC 분석 조건을 하기 표 2에 나타냈다.
Time (min) Eluent A(%) Eluent B(%)
0 80 20
10 80 20
12 65 35
30 0 100
32 80 20
40 80 20
상기 전환 생성물의 HPLC 분석 그래프는 표 3에 나타낸다. 하기 표 3에 나타난 Reb A 단독 기질로부터 Red D로 전환하는 상기 효소의 Reb D 전환율은 하기 수학식 1에 따라 계산하며, 효소의 Reb D 상대 전환율은 EUGT11의 Reb D 전환율 100%를 기준으로 환산한 TaUGT 또는 HvUGT 효소의 Reb D 전환율을 의미한다.
[수학식 1]
Figure PCTKR2022021327-appb-img-000004
효소명 반응시간(hour) Reb D의
전환율 (%)		 Reb D의
상대 전환율 (%)
EUGT11 3 45.8 100%
TaUGT 3 43.4 94.8%
HvUGT 3 32.5 71.0%
EUGT11 18 70.6 100%
TaUGT 18 68.0 96.3%
HvUGT 18 62.2 88.1%
표 3에 나타낸 바와 같이, 효소 반응을 통한 전환율은 초기 3시간 반응 결과 TaUGT는 EUGT11과 유사하게 Reb A의 Reb D 전환을 40~45% 전환하였고, HvUGT(30~35% 전환) 보다 30% 정도의 활성 향상을 가진 효소임을 확인하였다.
또한, 18시간의 효소 반응액의 생성된 Reb D 함량 분석 결과, 세가지 효소의 전환율 크기 순서가 3 시간 반응과 유사한 경향성을 나타내었다.
상기 TaUGT 효소의 폴리뉴클레오티드 서열을 ㈜마크로젠의 폴리뉴클레오티드 서열 분석서비스를 통하여 분석하였고, 폴리뉴클레오티드 서열을 기초로 하여 아미노산 서열을 분석하였으며, 그 결과 아미노산 서열은 서열번호 1에 나타내고, 폴리뉴클레오티드 서열은 서열번호 2에 나타낸다.
실시예 2. 효소 변이체를 발현하는 미생물 제작
2-1: 효소 변이체 발현을 위한 벡터 제작
실시예 1의 TaUGT 효소의 돌연변이를 개발하기 위하여 기존의 EUGT11 유전자를 기본으로 하여 돌연변이를 탐색하였다. Alignment를 통하여 conserved region을 확인하였고, UGT의 N-term의 sugar acceptor와 C-term의 sugar donor 기능을 하는 domain 사이의 위치에 아미노산의 차이를 비교하였다. 그 중 201번 잔기의 트레오닌과 202번 잔기 발린의 경우 (EUGT11 에서는 세린과, 류이신 아미노산이 위치) 트레오닌은 세린으로, 발린은 알라닌 또는 류이신으로 바꾸었다. 돌연변이 방법은 TaUGT의 해당 위치의 primer를 합성(서열번호 24 및 25) 하여 해당부위의 폴리뉴클레오티드 서열을 바꾸는 돌연변이 유전자 증폭(PCR)을 실시하였고, 증폭된 유전자 조각을 Gibson assembly를 통하여 pRS426 vector에 클로닝하였다.
결과로 얻은 pRS426 vector에 클로닝된 TaUGTT201S/V202L 라 명명하였다. 본 실시예에서 사용한 프라이머의 서열은 하기 표 4에 기재하였다.
명명 폴리뉴클레오티드 서열 (5’->3’) 서열번호
TaUGT의 T201S or V202L 변이 정방향 프라이머 CAGGTATGtcwbTAGCAGAGCGTTATTTCCTG 24
TaUGT의 T201S or V202L 변이 역방향 프라이머 CGCTCTGCTAvwgaCATACCTGATGCATTCTGAG 25
2-2: 효소 변이체 발현 균주 제작
실시예 1-2와 실질적으로 동일한 방법으로, 효소의 발현을 확인하기 위하여 pRS426 vector에 클로닝된 TaUGTT201S/V202L는 LiAc 방법으로 동일하게 효모 균주에 형질전환하여 선별하였다. 형질전환된 균주는 실시예 1-2의 방법과 실질적으로 동일한 방법으로 배양하였다. 상기 실시예 2-1에서 제조된 Plasmid가 형질전환된 효모를 URA-drop out mix를 이용한 SC(synthetic complete) 배지에서 선별하였고, 선별된 효모는 액체 배양을 통하여 효소 발현을 유도하였다.
실시예 3: 효소 변이체의 효소 활성 평가
실시예 2-2에서 얻은 재조합 균주의 배양물에서 균체를 원심분리(4,000rpm, 10 min)하여 회수하였다. 상기 회수한 균체를 10mL 모아 동량의 물로 2회 세척하였다. 상기 세척된 균체를 100 mM phosphate buffer (pH 7.2)에 재현탁하여 OD600 값이 100이 되도록 한 후, 0.4~0.6 mm입경을 갖는 glass bead(Sigma) 을 100 mg 양을 cap tube에 넣고, 100 mM phosphate buffer(pH 7.2)를 1 ml 첨가하였다. 균체를 bead beater에서 30초 동안 5회 반복하여 파쇄하였다. 상기 균체 파쇄액을 냉장상태에서 원심분리(13,000 rpm, 15 min)하여 상등액을 조효소액으로 얻었다.
효소 활성 평가를 위한 반응액은 기질 Reb A(95%, Sinochem), MgCl2 및 UDP-Glucose을 포함하며 여기에 상기 조효소액 0.1mL을 첨가하여 전체 반응 부피 0.5 mL를 제조하고, 상기 최종 반응액에서 기질 Reb A(95%, Sinochem) 2 g/L, MgCl2 3 mM, 및 UDP-Glucose 4 mM 가 되도록 하였다. 상기 제조된 반응액에 대해 온도 30℃, pH 7.2 및 150 rpm 조건에서 효소 반응을 수행하고, 반응 시작 후 3시간과 18시간에 각각 시료를 채취하여 반등시간에 따른 반응 정도를 확인하였다.
상기 효소 반응액을 5 분간 끓여 효소 반응을 종료하고, 원심분리(13,000 rpm, 10 min)하고 얻어진 상등액을 분석하여 효소반응 생성물을 확인하였다. 구체적으로 효소반응 생성물의 분석은 HPLC-Chromatography를 이용하여 분석하여 생성물의 전환 비율을 확인하였다. 상기 재조합 균주의 균체 파쇄물에서 얻은 조효소액은 Reb A 기질을 Reb D로 전환하는 활성을 보이므로 Reb D의 생성 비율을 확인하여 활성을 측정하였다.
구체적으로 전환 생성물의 HPLC 분석에 사용된 column은 UG120 (C18 250 mm X 46 mm, 5 um 110 A particle, Shiseido)을 이용하였고, 분석은 210 nm에서 확인하였다. 이동상은 0.01% TFA (Trifluoroacetic acid, Sigma)를 포함한 물과 아세토나이트릴을 각각 이용하여 Gradient로 분석하였으며, 이동상은 1 mL/min으로 흘려주고 총 40분 분석을 통하여 확인하였다. 상기 HPLC 분석 조건을 하기 표 4에 나타냈다. 상기 전환 생성물의 HPLC 분석 그래프는 도 2에 나타낸다. 하기 표 4에 나타난 Reb A 단독 기질로부터 Red D로 전환하는 상기 효소의 Reb D 전환율은 하기 수학식 1에 따라 계산하며, 효소의 Reb D 상대 전환율은 야생형 효소의 Reb D 전환율 100%를 기준으로 환산한 TaUGT 변이형 효소의 Reb D 전환율을 의미한다.
[수학식 1]
Figure PCTKR2022021327-appb-img-000005
상기 TaUGT의 변이 효소와 Reb A 기질을 포함하는 반응액를 이용하여 효소반응을 18시간 동안 수행하고, 얻어진 전환 생성물을 HPLC 분석법으로 분석하였다. 상기 HPLC분석법으로 이용한 TaUGT의 변이 효소의 활성 분석 결과는 하기 표 5 및 도 2에 나타낸다. 도 2는 TaUGT의 변이 효소의 이용한 Reb D 전환 반응의 반응생성물을 분석한 HPLC 그래프이다.
효소 Reb D의
전환율(%)		 Reb D의
상대전환율 (%)
TaUGT (야생형) 68.0 100%
T201S 75.5 110.3%
T201S/V202L 86.3 129.1%
실시예 4. 혼합기질을 이용한 효소 전환
균체를 100 mM phosphate buffer (pH 7.2)에 재현탁하여 OD600 값이 100이 되도록 한 후, 0.4~0.6 mm입경을 갖는 glass bead(Sigma)을 100 mg 양을 cap tube에 넣고, 100 mM phosphate buffer(pH 7.2)를 1 ml 첨가하였다. 균체를 bead beater에서 30초 동안 5회 반복하여 파쇄하였다. 상기 균체 파쇄액을 냉장상태에서 원심분리(13,000 rpm, 15 min)하여 상등액을 조효소액으로 얻었다.
효소 활성 평가를 위한 반응액은 기질 RA40(Reb A(rebaudioside A: STE(stevioside) = 40:60, Sinochem), MgCl2 및 UDP-Glucose을 포함하며 여기에 여기에 실시예 3에 따른 조효소액 0.2mL을 첨가하여 전체 반응 부피 0.5 mL를 제조하고, 상기 최종 반응액에서 기질 RA40(Reb A: STE = 40:60, Sinochem) 2 g/L, MgCl2 3 mM, 및 UDP-Glucose 4 mM 가 되도록 하였다. 상기 제조된 반응액에 대해 온도 30℃, pH 7.2 및 150 rpm 조건에서 효소 반응을 수행하고, 반응 시작 후18시간에 반응 정도를 확인하였다. 실시예 3의 방법과 실질적으로 동일한 방법으로, 상기 전환 생성물은 HPLC 분석법으로 분석하였다.
하기 표 6에 나타난 RA40 혼합 기질에 대한 Reb D/E로 전환하는 상기 효소의 Reb D/E 합계 전환율은 하기 수학식 2에 따라 계산하며, 효소의 Reb D/E의 상대적 합계 전환율은 EUGT11의 전Reb D/E 합계 전환율 100%를 기준으로 환산한 TaUGT 효소의 Reb D/E 합계 전환율을 의미한다.
[수학식 2]
Figure PCTKR2022021327-appb-img-000006
효소 반응시간
(hour)		 Reb D/E의
합계 전환율(%)		 Reb D/E의
상대적 합계 전환율(%)
TaUGT (야생형) 18 78.0 100
TaUGT (T201S) 18 83.0 106
TaUGT (T201SV202L) 18 89.2 114
상기 실험 결과 Threonine 201번을 Serine으로 바꾼 돌연변이 효소의 경우, 야생형 효소를 기준으로 상대 전환율이 106%이고, Threonine 201번을 Serine으로, Valine 202번을 Leucine으로 변형을 모두 포함하는 2중 돌연변이 효소는, 야생형 효소를 기준으로 상대 전환율이 114%로 증가하였으며, 이에 돌연변이를 통하여 활성이 향상되는 잔기를 확인하였고 활성이 증가된 변이효소를 확보하였다.
실시예 5. TaUGT_SUS 융합효소 제작 및 활성 확인
실시예 3에서 활성 향상이 확인된 TaUGT_T201SV202L (TaUGTm) 변이효소를 이용한 스테비올 배당체의 당전이 반응을 위해, 필요한 글루코오스 공여자 (UDP-Glucose)를 공급하고자, sucrose synthase (SUS1, Arabidopsis thaliana 유래) 효소와 융합 단백질을 제조하였다.
상기 TaUGT_T201SV202L (TaUGTm) 변이효소를 암호화하는 핵산 서열을 하기 표 7의 서열번호 30의 핵산서열이고, sucrose synthase (SUS1, Arabidopsis thaliana 유래)는 하기 표 7의 서열번호 5의 핵산서열을 사용하였다.
종류 서열 (5' -> 3') 서열번호
TaUGTm_Protein MDDGSSSSSSPLRVVICPWLAFGHLLPCLDIAERLASRGHRVSFVSTPRNIARLPPVRPAVAPLVDYVALPLPRVDGLPEGAESTNDVPHDKFELLRKAFDGLAAPFSEFLHAACAEGTGKRPDWLIVDSFHHWAAAAAVENKVPCVMLLLGAANVIATWARGVSEHAAAAVGKERSAAEAPSFETERRKLMITQNASGMSLAERYFLTLMRSNLVAIRSCAEWEPESVAALTTLAGKPVVTLGLLPPSPEGGRGISKQDAAVRWLDAQRDKSVVYVALGSEVPLRVEQVHELALGLELSGASFLWALRKPPGMPDAAVLPPGFEERTRGRGLVVTGWVPQISVLAHGAVAAFLTHCGWNSTIEGLLFGQPLIMLPISSDQGPNARLMEGRKVGMQVPRNESDGSFTREDVAATVQAVAMEEDGSRVFTANAKTMQEIVADSACHERCIDGFIQQLRSYKE 3
TaUGTm_DNA AAATCAGCGTCTTAGCACATGGCGCCGTTGCCGCTTTTCTGACACATTGCGGCTGGAATAGTACAATCGAAGGCTTGCTGTTCGGACAACCGTTAATCATGCTGCCAATCAGTAGCGATCAGGGCCCGAATGCCCGTCTTATGGAGGGAAGAAAAGTTGGAATGCAGGTGCCTCGTAATGAGTCCGATGGATCATTCACAAGAGAGGATGTCGCTGCCACAGTACAAGCAGTAGCGATGGAGGAGGATGGGAGCCGTGTTTTTACGGCTAATGCAAAGACCATGCAAGAAATAGTTGCTGACTCCGCGTGTCACGAAAGGTGCATCGATGGATTTATCCAACAGCTAAGGTCCTATAAAGAA 30
Sucrose_synthase_ProteinArabidopsis thaliana 유래 MANAERMITRVHSQRERLNETLVSERNEVLALLSRVEAKGKGILQQNQIIAEFEALPEQTRKKLEGGPFFDLLKSTQEAIVLPPWVALAVRPRPGVWEYLRVNLHALVVEELQPAEFLHFKEELVDGVKNGNFTLELDFEPFNASIPRPTLHKYIGNGVDFLNRHLSAKLFHDKESLLPLLKFLRLHSHQGKNLMLSEKIQNLNTLQHTLRKAEEYLAELKSETLYEEFEAKFEEIGLERGWGDNAERVLDMIRLLLDLLEAPDPCTLETFLGRVPMVFNVVILSPHGYFAQDNVLGYPDTGGQVVYILDQVRALEIEMLQRIKQQGLNIKPRILILTRLLPDAVGTTCGERLERVYDSEYCDILRVPFRTEKGIVRKWISRFEVWPYLETYTEDAAVELSKELNGKPDLIIGNYSDGNLVASLLAHKLGVTQCTIAHALEKTKYPDSDIYWKKLDDKYHFSCQFTADIFAMNHTDFIITSTFQEIAGSKETVGQYESHTAFTLPGLYRVVHGIDVFDPKFNIVSPGADMSIYFPYTEEKRRLTKFHSEIEELLYSDVENKEHLCVLKDKKKPILFTMARLDRVKNLSGLVEWYGKNTRLRELANLVVVGGDRRKESKDNEEKAEMKKMYDLIEEYKLNGQFRWISSQMDRVRNGELYRYICDTKGAFVQPALYEAFGLTVVEAMTCGLPTFATCKGGPAEIIVHGKSGFHIDPYHGDQAADTLADFFTKCKEDPSHWDEISKGGLQRIEEKYTWQIYSQRLLTLTGVYGFWKHVSNLDRLEARRYLEMFYALKYRPLAQAVPLAQDD 4
Sucrose_synthase_핵산서열Arabidopsis thaliana 유래 cgtcgaggccatgacctgcggccttcctacattcgcgacctgcaaaggtggtccagctgagattattgtccatgggaaatctggattccacatagacccatatcatggtgaccaggccgctgatacacttgcagatttttttactaagtgtaaggaggacccttcacattgggatgaaatatccaaagggggactgcagcgtatcgaggagaaatatacctggcaaatatatagccaaaggctgttgaccctaacgggcgtttacgggttctggaagcacgtttccaatctagataggctagaggcgaggcgttacctggaaatgttttacgcgttgaaatacaggcctctagcacaagcagtaccactggcgcaggacgat 5
융합효소의 제작은 primer를 합성하여 TaUGTm과 SUS 사이에 연결 아미노산 서열을 링커 (GGGGSG, 서열번호 8)를 사용하였고 각각의 유전자는 해당 위치의 primer를 합성 (서열번호 26, 서열번호 27)하여 해당부위의 염기서열 증폭 (PCR)을 실시하였다.
유전자 증폭 반응(PCR)을 실시하고 증폭된 유전자 조각을 Gibson assembly를 통하여 pRS426 vector에 클로닝하여 pRS426 TaUGTm_SUS를 제작하였다. 상기 사용된 SUS 효소 단백질의 아미노산 서열은 서열번호 4에 나타내고, 상기 효소 단백질을 암호화하는 뉴클레오타이드 서열은 서열번호 5에 나타내고, 상기 융합 효소 단백질의 아미노산 서열을 서열번호 6에 나타낸다. 또한, 상기 융합 단백질 제조에 사용된 링커 서열은 GGGGSG (서열번호 8)을 가지며, 상기 SUS1 효소 단백질의 아미노산 및 뉴클레오타이드 서열 및 사용된 프라이머 정보는 하기 표 8에 나타낸다.
명명 폴리뉴클레오티드 서열 (5’->3’) 서열번호
TaUGT(변이형)의 정방향 프라이머 catccaaaaaaaaagtaaGAATTGATGGACGACGGGTCTTCTAG 26
TaUGT(변이형)_linker의 역방향 프라이머 tccactaccaccgccaccttctttataggaccttagctgttgg 27
Linker_SUS의 정방향 프라이머 GGTGGCGGTGGTAGTGGAATGGCTAACGCCGAACGTATG 28
SUS의 역방향 프라이머 CTAATTACATGATATCGACAAttaCTCGGCAGCCAGAGGGAC 29
실시예 1-2와 동일한 방법으로, 상기 제작된 융합효소 발현 벡터는 효모에 형질전환한 다음 선별하여 확보하였다.
실시예 1-3과 실질적으로 동일한 방법으로 상기 배양한 균체의 파쇄액을 이용하여 조효소액을 제조하였다. 구체적으로, 실시예 3과 실질적으로 동일한 방법으로, 재조합 균주의 배양물에서 원심 분리를 이용하여 회수한 균체를 회수하고, glass bead로 균체를 파쇄하여 조효소액으로 사용하였다.
구체적으로, 반응액은 기질 RA40 반응기질 (90중량% 순도), MgCl2 및 UDP, sucrose 를 혼합하고, 여기에 TaUGTm_SUS 융합효소의 조효소액을 각각 0.1mL을 첨가하여 전체 반응 부피 0.5 mL를 제조하고, 상기 최종 반응액에서 RA40 반응기질 10 g/L, MgCl2 1 mM, 및 UDP 1 mM, Sucrose 125 mM이 되도록 하였다. 상기 제조된 반응액에 대해 온도 30℃, pH 7.2 및 150 rpm 조건에서 효소 반응을 수행하고, 20시간 반응하여 효소전환을 확인하였다.
상기 실시예 1-4와 실질적으로 동일한 방법으로, 반응액의 전환 생성물은 HPLC 분석법으로 분석하여 확인하였으며, 융합효소의 경우 UDP를 이용한 UDP_Glucose 공급을 통하여 RA40(Reb A: STE =40:60)를 Reb D/E로 전환되는 것을 확인하였다. STE는 스테비오사이드를 나타낸다.
반응전 기질 100중량%에 대하여 초기 융합효소의 전환반응으로 33 중량%정도의 기질이 Reb D/E로 전환되었다. 혼합기질(RA40(Reb A: STE = 40:60))의 전환반응을 통하여 Reb D(D유도체 포함)와 Reb E는 각각 21.7% 와 12.1%의 전환되었다. 융합효소의 설탕을 이용한 UDP_Glucose생성과 이를 이용한 기질의 당화를 통하여 스테비올 배당체 전환을 확인하였으며, 기질의 양과 반응 조건 최적화를 통하여 효소의 전환반응을 증가시키는 것이 가능함을 확인하였다.
융합효소를 이용한 전환의 경우 RA40(Reb A: STE = 40:60)의 전환을 위해 10 g/L기질의 경우 약 10 mM에 해당하는 기질로 전환 반응할 경우 10~20 mM 이상의 UDP_Glucose가 필요하다. 그러므로 고농도 다량의 전환을 할 경우 고가의 UDP_Glucose의 과량이 필요하다. 고농도 기질을 이용한 효소 반응하는 경우 UDP_Glucose를 과량 사용해야 하며, UDP_Glucose 과량에 의해 효소 활성을 저해하므로 바람직하지 않다.
본 실험에 의하면, TaUGT_SUS 융합효소를 이용하는 경우, 기질대비 1/10의 UDP를 사용하여 전환이 가능하고 UDP의 경우 RA40 대비 1/100보다 낮은 양을 이용한 반응이 가능하다. 융합효소를 이용한 전환반응을 통하여 경제적인 효소전환이 가능하였고, 고농도 기질 반응을 통한 스테비올 배당체의 생성을 유도됨을 확인하였다.

Claims (17)

  1. 서열번호 1의 아미노산 서열에서 N-말단으로부터 201번째 및 202번째 아미노산으로 이루어지는 군에서 선택된 적어도 하나 이상의 아미노산이, 세린 및 발린으로 이루어지는 군에서 선택된 1종 이상의 아미노산으로 치환된 것인, 스테비올 배당체 기질에 글루코스를 전이하는 uridine diphosphate-glucosyltransferase(UDP-glucoslyl transferase)활성을 갖는 효소 단백질.
  2. 제1항에 있어서, 상기 스테비올 배당체 기질은 스테비오사이드 및 레바우디오사이드 A로 이루어지는 군에서 선택되는 1종 이상인 효소 단백질.
  3. 제1항에 있어서, 상기 효소 단백질은 2시간 내지 24시간 효소 반응에서 레바우디오사이드 A의 45 중량%이상이 레바우디오사이드 D로 전환하는 활성을 갖는 것인 효소 단백질.
  4. 제1항에 있어서, 상기 효소 단백질은 2시간 내지 24시간 효소 반응에서, 서열번호 1의 아미노산 서열을 포함하는 야생형 효소의 레바우디오사이드 A 기질을 레바우디오사이드 D로 전환하는 활성 100%를 기준으로, 101%이상인 효소 단백질.
  5. 제1항에 따른 UDP-glucoslyl transferase 효소 단백질과 sucrose synthase 효소 단백질이 연결된 융합 단백질.
  6. 제5항에 있어서, 상기 sucrose synthase는 Arabidopsis thaliana, Solanum lycopersicum, Glycine max, Nicotiana tabacum, 및 Thermosynechococcus elongatus 로 이루어지는 군에서 선택된 1종 이상의 미생물 유래 sucrose synthase인 융합 단백질.
  7. 제1항 내지 제6항 중 어느 한 항에 따른 효소 단백질을 암호화하는 유전자를 포함하는 재조합 미생물.
  8. 제7항에 있어서, 상기 미생물은 대장균, 사카로미세스 속 미생물 및 피키아 속 미생물로 이루어지는 군에서 선택되는 것인 재조합 미생물.
  9. 제1항 내지 제4항 중 어느 한 항에 따른 UDP-glucoslyl transferase 효소 단백질, 상기 효소 단백질을 발현하는 재조합 미생물, 상기 미생물의 균체, 상기 미생물의 균체 파쇄물, 상기 미생물의 배양물 및 이들의 추출물로 이루어지는 군에서 선택된 1종 이상을 포함하는 스테비올 배당체 생산용 조성물.
  10. 제9항에 있어서, 상기 조성물은, 스테비오사이드 및 레바우디오사이드 A로 이루어지는 군에서 선택되는 1종 이상을 포함하는 기질을 추가로 포함하는 것인 조성물.
  11. 제10항에 있어서, 상기 조성물은, 스테비오사이드 및 레바우디오사이드 A를 포함하는 혼합 기질인 조성물.
  12. 제9항에 있어서, 상기 조성물은, 레바우디오사이드 D 또는 레바우디오사이드 E를 레바우디오사이드 M(Reb)으로 전환하는 효소를 추가로 포함하는 것인 조성물.
  13. 제12항에 있어서, 상기 Reb M으로 전환하는 효소는 스테비아 유래의 UGT76G1인 조성물.
  14. 제9항에 있어서, 상기 UDP-glucoslyl transferase 효소 단백질은 sucrose synthase 효소 단백질이 연결된 융합 단백질인 조성물.
  15. 제9항에 있어서, 상기 조성물은 글루코오스 공여자(glycosyl donor)를 포함하는 것인 조성물.
  16. 제9항에 있어서, 상기 조성물은 글루코오스 공여자는 UDP-글루코오스인 조성물.
  17. 제9항에 있어서, sucrose synthase 효소 단백질을 추가로 포함하거나, sucrose synthase 효소 단백질이 UDP-glucoslyl transferase 효소 단백질과 융합 단백질로 제공되는 경우, 상기 조성물은 sucrose과 UDP를 포함하는 것인 조성물.
PCT/KR2022/021327 2021-12-24 2022-12-26 당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법 WO2023121427A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202280089101.3A CN118489006A (zh) 2021-12-24 2022-12-26 糖基转移酶变体和使用其制备甜菊糖苷的方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0187435 2021-12-24
KR20210187435 2021-12-24

Publications (1)

Publication Number Publication Date
WO2023121427A1 true WO2023121427A1 (ko) 2023-06-29

Family

ID=86903233

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/KR2022/021326 WO2023121426A1 (ko) 2021-12-24 2022-12-26 레바우디오사이드의 생산
PCT/KR2022/021327 WO2023121427A1 (ko) 2021-12-24 2022-12-26 당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/021326 WO2023121426A1 (ko) 2021-12-24 2022-12-26 레바우디오사이드의 생산

Country Status (3)

Country Link
KR (3) KR20230098493A (ko)
CN (1) CN118489006A (ko)
WO (2) WO2023121426A1 (ko)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024121721A1 (en) 2022-12-05 2024-06-13 Tate & Lyle Solutions Usa Llc Methods for obtaining steviol glycosides

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130122603A (ko) * 2010-06-02 2013-11-07 에볼바 뉴트리션, 인코포레이티드 스테비올 글리코시드의 재조합 생산
US20180223264A1 (en) * 2017-02-03 2018-08-09 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
US20210009968A1 (en) * 2019-06-25 2021-01-14 Manus Bio, Inc. Uridine diphosphate-dependent glycosyltransferase enzyme
KR20210153670A (ko) * 2018-03-12 2021-12-17 코나겐 인크. 변이체 효소를 통한 스테비올 글리코사이드 레바우디오사이드 i의 생합성 생산

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101559478B1 (ko) * 2013-06-24 2015-10-13 한국생명공학연구원 효소전환법을 이용한 천연 고감미료의 제조방법
EP3508584A1 (en) * 2014-01-28 2019-07-10 PepsiCo, Inc. Method for preparing rebaudioside m by using enzyme method
KR101669041B1 (ko) * 2015-03-31 2016-10-25 아주대학교산학협력단 스테비오사이드 생산능을 가지는 재조합 미생물 및 이를 이용한 스테비오사이드의 생산 방법
ES2906310T3 (es) * 2016-08-12 2022-04-18 Amyris Inc Glicosiltransferasa dependiente de UDP para la producción de alta eficiencia de rebaudiósidos
EP3824093A4 (en) * 2018-07-16 2022-06-01 Manus Bio, Inc. PRODUCTION OF STEVIOL GLYCOSIDES BY WHOLE-CELL BIOTRANSFORMATION

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130122603A (ko) * 2010-06-02 2013-11-07 에볼바 뉴트리션, 인코포레이티드 스테비올 글리코시드의 재조합 생산
US20180223264A1 (en) * 2017-02-03 2018-08-09 Codexis, Inc. Engineered glycosyltransferases and steviol glycoside glucosylation methods
KR20210153670A (ko) * 2018-03-12 2021-12-17 코나겐 인크. 변이체 효소를 통한 스테비올 글리코사이드 레바우디오사이드 i의 생합성 생산
US20210009968A1 (en) * 2019-06-25 2021-01-14 Manus Bio, Inc. Uridine diphosphate-dependent glycosyltransferase enzyme

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein 25 October 2021 (2021-10-25), ANONYMOUS : "putative UDP-rhamnose:rhamnosyltransferase 1 [Triticum aestivum].", XP093073983, retrieved from NCBI Database accession no. XP_044372292.1 *

Also Published As

Publication number Publication date
WO2023121426A1 (ko) 2023-06-29
KR20230098493A (ko) 2023-07-04
KR20230098495A (ko) 2023-07-04
KR20230098494A (ko) 2023-07-04
CN118489006A (zh) 2024-08-13

Similar Documents

Publication Publication Date Title
US20220235335A1 (en) Glycosyltransferase Mutant and Use Therefor
WO2014133248A1 (ko) 스테비오사이드로부터 리바우디오사이드 a를 제조하는 방법
Hueck et al. Cloning, expression and functional analyses of the catabolite control protein CcpA from Bacillus megaterium
WO2011049418A2 (ko) 테라박터 속 유래의 신규한 진세노시드 글리코시다제 및 이의 용도
WO2023121427A1 (ko) 당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법
WO2011034406A2 (ko) 로다노박터 진세노시디뮤탄스 k c t c 2 2 2 3 1 t 유래의 진세노시드 글리코시다제 및 이의 용도
US7655449B2 (en) β-fructofuranosidase variants
JPH07250693A (ja) 非齲蝕性の糖代用物の製法
WO2023068472A1 (ko) 신규한 당전이효소 및 이의 용도
US7781189B2 (en) Catalyzing transglycosylation using a recombinant host cell overexpressing uridine phosphorylase and purine nucleoside phosphorylase
WO2012070724A1 (ko) 로다노박터 진세노시디뮤탄스 유래의 알파-ｎ-아라비노퓨라노시다제 및 이의 용도
WO2013157887A1 (ko) 카우린, 카우린산 또는 스테비올 생성능을 가지는 재조합 미생물 및 이를 이용한 카우린, 카우린산 또는 스테비올의 제조 방법
CN108359652B (zh) 糖基转移酶及其应用
WO2022139522A1 (ko) 당전이 효소 및 이를 이용한 스테비올 배당체의 제조방법
US20220275351A1 (en) Preparation of Glycosyltransferase UGT76G1 Mutant and Use Thereof
WO2016182273A1 (ko) 사카로마이세스 세레비지애 효모의 만노스 인산화 활성에 핵심적인 유전자 mnn14 및 그 결손 변이주를 활용한 재조합 당단백질 생산 방법
KR102167849B1 (ko) 알파-1,6 당전이 효소를 활용한 글루코실 스테비오사이드 제조방법
WO2020050659A1 (ko) 한천으로부터 당 알코올의 생물학적 신규 제조방법
WO2018012644A1 (ko) 스테비올 배당체 생산용 재조합 미생물
WO2023068722A1 (ko) 리바우디오사이드 d 및 리바우디오사이드 m을 제조하는 방법
CN115478060B (zh) 一种糖基转移酶及其应用
KR102303661B1 (ko) 포도당 전이 효소를 포함하는 포도당 전이 스테비올 배당체 생산용 조성물 및 이를 이용한 포도당 전이 스테비올 배당체 제조방법
JPH09252789A (ja) アカルビオシルトランスフエラーゼの製造方法並びにアカルボース同族体のアカルボースへの転化に際し、そしてアカルボース同族体の調製のためのその使用方法
WO2015046848A1 (ko) 싸이클로덱스트린 글루카노트랜스퍼라제 돌연변이 효소 및 이를 이용한 l-아스코르빈산 유도체의 제조방법
KR100625100B1 (ko) 말토펜타오스 생성 아밀라아제 및 말토펜타오스의 생산방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22912060

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022912060

Country of ref document: EP

Effective date: 20240724