WO2018012644A1 - 스테비올 배당체 생산용 재조합 미생물 - Google Patents

스테비올 배당체 생산용 재조합 미생물 Download PDF

Info

Publication number
WO2018012644A1
WO2018012644A1 PCT/KR2016/007527 KR2016007527W WO2018012644A1 WO 2018012644 A1 WO2018012644 A1 WO 2018012644A1 KR 2016007527 W KR2016007527 W KR 2016007527W WO 2018012644 A1 WO2018012644 A1 WO 2018012644A1
Authority
WO
WIPO (PCT)
Prior art keywords
gene
gene encoding
seq
nucleotide sequence
sequence represented
Prior art date
Application number
PCT/KR2016/007527
Other languages
English (en)
French (fr)
Inventor
이평천
공민경
Original Assignee
아주대학교산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 아주대학교산학협력단 filed Critical 아주대학교산학협력단
Priority to PCT/KR2016/007527 priority Critical patent/WO2018012644A1/ko
Publication of WO2018012644A1 publication Critical patent/WO2018012644A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00—Preparation of compounds containing saccharide radicals
    • C12P19/44—Preparation of O-glycosides, e.g. glucosides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P33/00—Preparation of steroids
    • C12P33/12—Acting on D ring
    • C12P33/16—Acting at 17 position

Definitions

  • the present invention relates to a recombinant microorganism for producing steviol glycosides and a method for producing steviol glycosides.
  • Stevia rebaudiana Bertoni is a perennial plant of the Asteraceae family, originating from the alpine region adjacent to the border between Brazil and Paraguay in South America. Stevia grows around rivers or wetlands and contains sweet substances in its leaves.
  • the sweeteners of stevia include Steviolmonoside, Steviolbioside, Stevioside, and Rebaudioside-A which are steviol glycosides. .
  • research related to the production of steviosides has been the main topic of extraction directly from the leaves of stevia.
  • stevioside is a natural sweetener that is about 300 times sweeter than sugar and is used as a low-calorie sweetener in many countries such as Paraguay and Brazil.
  • the inventors of the present invention while studying a gene capable of synthesizing steviol monosides, rubisosides, steviol biosides or steviosides from steviol, the recombinant microorganism into which the selected gene is introduced is steviol monoside, ru It was confirmed that the compound had a production capacity for busoside, steviol bioside or stevioside. In addition, mutant microorganisms generated by inducing mutations in the recombinant microorganisms overproduced steviosides, thus completing the present invention.
  • the present invention (a) gene coding for GGPPS (geranylgeranyl diphosphate synthase, crtE) consisting of the nucleotide sequence represented by SEQ ID NO: 1, CPPS consisting of a nucleotide sequence represented by SEQ ID NO: 2 ( A gene encoding a copalyl diphosphate synthase, a gene encoding a KS (kaurene synthase) consisting of a nucleotide sequence represented by SEQ ID NO: 3, a gene encoding a KO (kaurene oxidase) consisting of a nucleotide sequence represented by SEQ ID NO: 4, and a sequence A gene group including a gene encoding KAH (kaurenoic acid hydroxylase) consisting of a nucleotide sequence represented by Number 5; And
  • UGT85G2 uridine diphospho-glucuronosyltransferase (UGT) 74G1) comprising a gene encoding UGT85C2 (uridine diphospho-glucuronosyltransferase (UGT) 85C2) consisting of a nucleotide sequence represented by SEQ ID NO: 6 and a nucleotide sequence represented by SEQ ID NO: 7
  • UGT85G2 uridine diphospho-glucuronosyltransferase (UGT) 74G1
  • UGT85C2 uridine diphospho-glucuronosyltransferase (UGT) 85C2
  • SEQ ID NO: 6 uridine diphospho-glucuronosyltransferase (UGT) 85C2) consisting of a nucleotide sequence represented by SEQ ID NO: 6
  • SEQ ID NO: 7 Provided is a recombinant microorganism for producing steviol glycosides into which one or more genes
  • the present invention (a) a gene encoding a GGPPS (geranylgeranyl diphosphate synthase, crtE) consisting of a nucleotide sequence represented by SEQ ID NO: 1, a gene encoding a CPPS (copalyl diphosphate synthase) consisting of a nucleotide sequence represented by SEQ ID NO: 2
  • a gene encoding KO (kaurene oxidase) consisting of a nucleotide sequence represented by SEQ ID NO: 4;
  • a group of genes including; a gene encoding KAH (kaurenoic acid hydroxylase) consisting of a nucleotide sequence represented by SEQ ID NO: 5;
  • UGT85C2 uridine diphospho-glucuronosyltransferase (UGT) 85C2 consisting of the nucleotide sequence represented by SEQ ID NO: 6;
  • (c) Provides a recombinant microorganism for steviol glycoside production, in which a gene encoding UGTx (uridine diphospho-glucuronosyltransferase (UGT) x) consisting of the nucleotide sequence represented by SEQ ID NO: 8 is introduced.
  • UGTx uridine diphospho-glucuronosyltransferase
  • the present invention (a) a gene encoding a GGPPS (geranylgeranyl diphosphate synthase, crtE) consisting of a nucleotide sequence represented by SEQ ID NO: 1, a gene encoding a CPPS (copalyl diphosphate synthase) consisting of a nucleotide sequence represented by SEQ ID NO: 2
  • a gene encoding KO (kaurene oxidase) consisting of a nucleotide sequence represented by SEQ ID NO: 4
  • a gene encoding KAH (kaurenoic acid hydroxylase) consisting of a nucleotide sequence represented by SEQ ID NO: 5;
  • UGT85C2 uridine diphospho-glucuronosyltransferase (UGT) 85C2) consisting of the nucleotide sequence represented by SEQ ID NO: 6,
  • UGT74G1 uridine diphospho-glucuronosyltransferase (UGT) 74G1) consisting of the nucleotide sequence represented by SEQ ID NO: 7
  • a gene encoding UGTx uridine diphospho-glucuronosyltransferase (UGT) x) consisting of a gene coding for and a nucleotide sequence represented by SEQ ID NO: 8 is introduced.
  • the present invention provides a mutant microorganism having steviol glycoside overproduction ability by knocking out the ushA gene (UDP-Sugar Hydrolase Gene) or the pgi gene (pig phosphoglucose isomerase gene) in the recombinant microorganism to cause mutation. do.
  • ushA gene UDP-Sugar Hydrolase Gene
  • pgi gene pig phosphoglucose isomerase gene
  • the present invention (1) culturing the microorganism; And (2) isolating and purifying steviol glycosides from the culture of the microorganism of step (1); it provides a method for producing a steviol glycoside.
  • the recombinant microorganism for steviol glycoside production of the present invention has an excellent effect of producing a large amount of steviol monoside, rubisoside, steviol bioside or stevioside. Therefore, steviol monosides are manipulated by a simple process by manipulating metabolic pathways by recombinant genes introduced into microorganisms, rather than directly separating steviol monosides, rubussides, steviol biosides or steviosides from the extract of stevia. It can be economically produced, rubisoside, steviol bioside or stevioside, it can be usefully used in the food industry, such as natural sweeteners and beverages using the steviol glycosides.
  • FIG. 1 is a diagram showing a biosynthetic metabolic circuit of steviol monosides.
  • Figure 2 is a diagram showing the biosynthetic metabolic circuit of rubisoside.
  • FIG. 3 is a diagram showing a biosynthetic metabolic circuit of steviol biosides.
  • Figure 4 shows the biosynthetic metabolic circuit of steviosides.
  • 5 (A) shows a pSTV29 vector for steviol recombinant gene assembly.
  • 5 (B) shows a pUC_mod vector used in a general cloning process.
  • 5 (C) shows a pBBR322 (MCSII) vector for glycosyl transferase assembly.
  • FIG. 6 shows a pSTV29 vector for steviol recombinant gene assembly.
  • 6B shows a pUC_mod vector used in a general cloning process.
  • C shows the pBBR322 (MCSII) vector for glycosyl transferase assembly.
  • Fig. 6D shows the pET21a vector.
  • Figure 7 is a diagram showing a cleavage map of the recombinant vector for steviol production, including the GGPPS, CPPS, KS, KO and KAH gene.
  • Fig. 8A is a diagram showing a cleavage map of a recombinant vector containing a UGT85C2 gene in a vector derived from pUC.
  • 8B is a diagram showing a cleavage map of a recombinant vector including the UGT85C2 gene in a vector derived from pBBR.
  • 9A is a diagram showing a cleavage map of a recombinant vector containing the UGT74G1 gene in a vector derived from pUC.
  • 8B is a diagram showing a cleavage map of a recombinant vector containing the UGT74G1 gene in a vector derived from pBBR.
  • FIG. 10 is a diagram confirming the degree of production of steviol monosides in a recombinant strain transformed with a recombinant vector further comprising a UGT74G1 gene or a UGT85C2 gene through LCMS-ESI analysis.
  • FIG. 11 is a diagram showing a cleavage map of a recombinant vector comprising a UGT74G1 gene and a UGT85C2 gene.
  • FIG. 12 is a diagram confirming the production of the rubusoside of the recombinant strain transformed with a recombinant vector further comprising the UGT74G1 gene and UGT85C2 gene through LCMS-ESI analysis.
  • Figure 13 is a diagram showing the results confirmed by SDS-PAGE UGTx protein expressed from recombinant E. coli.
  • Fig. 15 shows a cleavage map of a recombinant vector containing the UGT85C2 gene in a vector derived from pBBR.
  • FIG. 16 shows a cleavage map of a recombinant vector containing a UGTx gene.
  • 17 is a diagram confirming the production level of steviolbiosides in the transformed recombinant strain through LCMS-ESI analysis.
  • 18 is a diagram confirming the degree of production of steviosides according to the expression of the UGTx gene through LCMS-ESI analysis.
  • Fig. 19 shows a cleavage map of a recombinant vector for gene expression encoding UGT85C2, UGT74G1 and UGTx.
  • 20 is a diagram schematically illustrating the biosynthetic metabolic circuit of stevioside using the UGT74G1 gene, the UGT85C2 gene, and the UGTx gene.
  • 21 is a diagram showing the results of confirming the steviosides produced from the stevioside-producing recombinant strain through LCMS-ESI analysis.
  • 22 is a diagram showing the ushA gene and pgi gene to be knocked out in the glucose glycolysis process.
  • Figure 23 is a diagram showing the results confirmed by electrophoresis of the primer and its result for confirming the ushA gene knockout of recombinant E. coli.
  • Figure 24 is a diagram showing the results confirmed by electrophoresis of primers and their results for confirming the knockout of the ushA gene and pgi gene of recombinant E. coli.
  • the present invention (a) a gene encoding a GANPS (geranylgeranyl diphosphate synthase, crtE) consisting of a nucleotide sequence represented by SEQ ID NO: 1, a gene encoding a CPPS (copalyl diphosphate synthase) consisting of a nucleotide sequence represented by SEQ ID NO: 2, A gene encoding KS (kaurene synthase) consisting of a nucleotide sequence represented by SEQ ID NO: 3, a gene encoding KO (kaurene oxidase) consisting of a nucleotide sequence represented by SEQ ID NO: 4, and a nucleotide sequence represented by SEQ ID NO: 5 A gene group including a gene encoding KAH (kaurenoic acid hydroxylase); And
  • UGT85G2 uridine diphospho-glucuronosyltransferase (UGT) 74G1) comprising a gene encoding UGT85C2 (uridine diphospho-glucuronosyltransferase (UGT) 85C2) consisting of a nucleotide sequence represented by SEQ ID NO: 6 and a nucleotide sequence represented by SEQ ID NO: 7
  • UGT85G2 uridine diphospho-glucuronosyltransferase (UGT) 74G1
  • UGT85C2 uridine diphospho-glucuronosyltransferase (UGT) 85C2
  • SEQ ID NO: 6 uridine diphospho-glucuronosyltransferase (UGT) 85C2) consisting of a nucleotide sequence represented by SEQ ID NO: 6
  • SEQ ID NO: 7 Provided is a recombinant microorganism for producing steviol glycosides into which one or more genes
  • GGPPS stevioside biosynthesis-related enzyme
  • CPPS cowin acid biosynthesis-related enzyme
  • KAH steviol biosynthesis-related enzyme
  • the "UGT85C2" is an enzyme which makes steviol monoside in steviol and rubus side in 19-glycoside.
  • the "UGT74G1" is an enzyme that makes 19-glycoside in steviol and rubusside in steviol monoside, as well as stevioside in steviolbioside.
  • the microorganism may be at least one selected from the group consisting of E. coli, bacteria, yeast and mold, preferably E. coli, but is not limited thereto.
  • the steviol glycoside may be steviol monoside (Steviolmonoside) or rubusoside.
  • the gene group of (a) is introduced by a vector having a cleavage map of FIG. 7, the gene encoding UGT85C2 of (b) is introduced by a vector having a cleavage map of FIG.
  • the gene encoding UGT74G1 may be introduced by a vector having a cleavage map of FIG. 9, and the gene encoding UGT85C2 of (b) and the gene encoding UGT74G1 may be introduced by a vector having a cleavage map of FIG. 11.
  • Kinds of genes and vectors are not limited to those which produce steviol glycosides.
  • a "vector” refers to a gene construct containing a nucleotide sequence of a gene operably linked to a suitable regulatory sequence so that the target gene can be expressed in a suitable host, wherein the regulatory sequence initiates transcription.
  • a suitable regulatory sequence so that the target gene can be expressed in a suitable host, wherein the regulatory sequence initiates transcription.
  • the "operably linked" means that the nucleic acid expression control sequence and the nucleic acid sequence encoding the protein of interest is functionally linked to perform a general function.
  • a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence.
  • Operational linkage with recombinant vectors can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation uses enzymes commonly known in the art and the like.
  • expression of the target gene may mean to express the target gene to produce a protein encoded by the target gene.
  • the method of expressing a target gene may be a method of expressing a protein encoded by the target gene by culturing a transformant (host cell) transformed with a vector containing the target gene, thereby The final product of this involved biosynthetic pathway can be prepared.
  • the vector of the present invention is not particularly limited as long as it can replicate in cells, and any vector known in the art may be used, and may be, for example, a plasmid, cosemid, phage particle, or viral vector.
  • the expression vector may be a vector commercially available in the art such as pUC19, pSTV28, pBBR1MCS, pBluscriptII, pBAD, pTrc99A, pET, pACYC184 and pBR322 family.
  • each gene constituting the combination may be inserted into one vector or divided into two or more types of vectors.
  • the genes when two or more genes are inserted into one vector, the genes may be inserted in a form having a constitutive lac promoter, a terminator, and the like, respectively, without being limited thereto.
  • the gene encoding GGPPS is preferably a gene derived from Rhodobacter sphaeroides .
  • the gene encoding CPPS, the gene encoding KS, the gene encoding KO, the gene encoding KAH, the gene encoding UGT85C2, the gene encoding UGT74G1 and the gene encoding UGTx are Stevia rebaudiana ( Stevia rebaudiana Bertoni).
  • the gene encoding UGT85C2 or the gene encoding UGT74G1 refers to the coding region or gene of the nucleic acid molecule for transformation of various hosts, thereby reflecting the typical codon utilization of the host organism without changing the polypeptide encoded by the DNA. To change the codon in the coding region or gene of said nucleic acid molecule.
  • Stevia rebaudiana is a plant, it is optimized for codons of E. coli rather than codons of plants so that codons can be expressed well in E. coli.
  • the "rhodobacter spheroid" is characterized by overproduction of hydrophobic and insoluble compounds with photosynthetic bacteria.
  • the "Stevia rebaudiana” is a perennial herb of the Asteraceae, and its origin is an alpine region adjacent to the border region of Brazil and Paraguay of South America. Stevia rebaudiana grows around rivers and wetlands and contains sweet substances in the leaves.
  • PCR the base sequence of each gene can be obtained.
  • each base sequence may include at least 70%, more preferably at least 80%, even more preferably at least 90%, and most preferably at least 95%.
  • the "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).
  • the present invention (a) a gene encoding a GGPPS (geranylgeranyl diphosphate synthase, crtE) consisting of a nucleotide sequence represented by SEQ ID NO: 1, a gene encoding a CPPS (copalyl diphosphate synthase) consisting of a nucleotide sequence represented by SEQ ID NO: 2
  • a gene encoding KO (kaurene oxidase) consisting of a nucleotide sequence represented by SEQ ID NO: 4;
  • a group of genes including; a gene encoding KAH (kaurenoic acid hydroxylase) consisting of a nucleotide sequence represented by SEQ ID NO: 5;
  • UGT85C2 uridine diphospho-glucuronosyltransferase (UGT) 85C2 consisting of the nucleotide sequence represented by SEQ ID NO: 6;
  • (c) Provides a recombinant microorganism for steviol glycoside production, in which a gene encoding UGTx (uridine diphospho-glucuronosyltransferase (UGT) x) consisting of the nucleotide sequence represented by SEQ ID NO: 8 is introduced.
  • UGTx uridine diphospho-glucuronosyltransferase
  • the steviol glycoside may be steviolbioside.
  • the gene group of (a) is introduced by a vector having a cleavage map of FIG. 7
  • the gene encoding UGT85C2 of (b) is introduced by a vector having a cleavage map of FIG.
  • the gene encoding UGTx may be introduced by a vector having a cleavage map of FIG. 16, but the type of gene and vector is not limited thereto, as long as it produces steviolbiosides.
  • the gene encoding the UGTx is a gene derived from Stevia rebaudiana Bertoni, but is not limited thereto.
  • the "gene encoding the UGTx" is limited to the glycosylation enzyme of Stevia rebaudiana, looking at the Phylogenetic relationship (Fig. 16), it was confirmed that the gene with the highest similarity is UGT91D1. . Although this may be inferred from having high sequence similarity to the UGTx gene of the present invention, the UGTx gene of the present invention has activity, but among the various candidate glycosylation enzymes in screening the function of the glycosylation enzyme of Stevia rebaudiana, the UGT91D1 The gene is described as not having the same activity as the UGTx gene of the present invention (Richman A, et al., (2005), Plant Journal, 41 (1): p. 56-67).
  • the gene encoding UGTx of the present invention cannot be regarded as having the same activity as the UGT91D1.
  • the present invention (a) a gene encoding a GGPPS (geranylgeranyl diphosphate synthase, crtE) consisting of a nucleotide sequence represented by SEQ ID NO: 1, a gene encoding a CPPS (copalyl diphosphate synthase) consisting of a nucleotide sequence represented by SEQ ID NO: 2
  • a gene encoding KO (kaurene oxidase) consisting of a nucleotide sequence represented by SEQ ID NO: 4
  • a gene encoding KAH (kaurenoic acid hydroxylase) consisting of a nucleotide sequence represented by SEQ ID NO: 5;
  • UGT85C2 uridine diphospho-glucuronosyltransferase (UGT) 85C2) consisting of the nucleotide sequence represented by SEQ ID NO: 6,
  • UGT74G1 uridine diphospho-glucuronosyltransferase (UGT) 74G1) consisting of the nucleotide sequence represented by SEQ ID NO: 7
  • a gene encoding UGTx uridine diphospho-glucuronosyltransferase (UGT) x) consisting of a gene coding for and a nucleotide sequence represented by SEQ ID NO: 8 is introduced.
  • the steviol glycoside may be stevioside.
  • the gene group of (a) is introduced by a vector having a cleavage map of FIG. 7, wherein the gene encoding UGT85C2, the gene encoding UGT74G1 and the gene encoding UGTx have the cleavage map of FIG.
  • the type of gene and vector is not limited to this, as long as it produces steviosides.
  • the present invention provides a mutant microorganism having steviol glycoside overproduction ability by knocking out the ushA gene (UDP-Sugar Hydrolase Gene) or the pgi gene (pig phosphoglucose isomerase gene) in the recombinant microorganism to cause mutation. do.
  • ushA gene UDP-Sugar Hydrolase Gene
  • pgi gene pig phosphoglucose isomerase gene
  • the "ushA gene” is a gene encoding an enzyme that decomposes UDP-glucose into UDP and glucose. Since the glycosyl transferase expressed during stevioside production glycosylates using UDP-glucose, it is necessary to knock out the ushA gene that degrades UDP-glucose to increase the UDP-glucose pool. Has its purpose.
  • the flux goes to the pentose phosphate pathway instead of the glycolytic pathway. Since stevioside production-related genes use NADPH 2 as a cofactor, fluxes toward the pentose phosphate pathway can increase the effectiveness of NADPH 2 .
  • the mutant microorganisms can increase the UDP-glucose pool and increase the utility of NADPH2, which can overproduce steviol glycosides, and more preferably allow mass production of steviosides.
  • the present invention (1) culturing the microorganism; And (2) isolating and purifying steviol glycosides from the culture of the microorganism of step (1); it provides a method for producing a steviol glycoside.
  • culturing means to grow microorganisms under appropriately artificially controlled environmental conditions.
  • the microorganisms can be grown in a conventional medium, for example, can be cultured in a Nutrient broth medium.
  • the medium may contain a nutritional substance required by the microorganism to be cultured, that is, the culture medium in order to cultivate a specific microorganism, and may be mixed with an additional substance for a special purpose.
  • the medium may also be referred to as an incubator or a culture medium, and is a concept that includes all natural, synthetic, or selective media.
  • the medium used for the cultivation should meet the requirements of the particular strain in an appropriate manner while controlling the temperature, pH, etc. in a conventional medium containing a suitable carbon source, nitrogen source, amino acids, vitamins and the like.
  • Carbon sources that can be used include mixed sugars of glucose and xylose as the main carbon source, and sugars and carbohydrates such as sucrose, lactose, fructose, maltose, starch and cellulose, soybean oil, sunflower oil, castor oil, coconut Oils such as oils and fats, fatty acids such as palmitic acid, stearic acid, linoleic acid, alcohols such as glycerol, ethanol, organic acids such as acetic acid. These materials can be used individually or as a mixture.
  • Nitrogen sources that can be used include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, anmonium carbonate, and ammonium nitrate; Amino acids such as glutamic acid, methionine, glutamine and organic nitrogen sources such as peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquor, casein hydrolyzate, fish or its degradation product, skim soy cake or its degradation product Can be. These nitrogen sources may be used alone or in combination.
  • the medium may include, as personnel, monopotassium phosphate, dipotassium phosphate and corresponding sodium-containing salts.
  • Personnel that may be used include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.
  • potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts include potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts.
  • sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate and calcium carbonate may be used.
  • essential growth substances such as amino acids and vitamins can be used.
  • suitable precursors to the culture medium may be used.
  • the raw materials described above may be added batchwise, fed-batch or continuous in a suitable manner to the culture in the culture process, but is not particularly limited thereto.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia or acid compounds such as phosphoric acid or sulfuric acid can be used in an appropriate manner to adjust the pH of the culture.
  • the method for separating and purifying steviol glycosides from the microorganism of step (2) may use a known method suitable according to the physical and chemical properties of the material, for example distillation, electrodialysis, pervaporation , Chromatography, solvent extraction, reaction extraction, HPLC and the like can be used, and these may be used in combination, but is not limited thereto.
  • Example 1 The Dividend Chain of Steviol Steviol Monoside , Rubusoside , Steviol Bioside Or gene selection for biosynthesis related enzymes of steviosides, securing of vectors and Cloning Of primer making
  • the glycoside biosynthesis-related enzymes of steviol include GGPPS (geranylgeranyl diphosphate synthase), CPPS (copalyl diphosphate synthase), and KS (kaurene synthase) .
  • GGPPS geranylgeranyl diphosphate synthase
  • CPPS copalyl diphosphate synthase
  • KS kaurene synthase
  • Kaurin acid biosynthesis-related enzymes include KO (kaurene oxidase) and steviol biosynthesis.
  • Related enzymes include kaurenoic acid hydroxylase (KAH).
  • the GGPPS gene was obtained from Rhodobacter sphaeroides .
  • the remaining genes RNA was obtained from the leaves of Stevia rebaudiana Bertoni, and cDNA was synthesized from it.
  • the pSTV29 vector (Takara) of Figure 5A is steviol recombinant Genes were used to assemble
  • pUC_mod vector of B of Figure 5 was used in the general cloning process
  • pBBR322 (MCSII) vector of C of Figure 5 was used to assemble glycosyl transferase.
  • MCSII MCSII
  • the pSTV29 vector (Takara) of FIG. 6A was used to assemble the steviol recombinant genes, and The pUC_mod vector of B was used in the general cloning process, and the pBBR322 (MCSII) vector of C of FIG. 6 was used for in vitro assay by expressing the protein of D of FIG. 6 when assembling glycosyl transferase. .
  • the primers for cloning the genes are shown in Tables 1 and 2 below, and the underlined parts of the primers in Tables 1 and 2 represent complementary parts to the respective genes, and Table 3 shows each vector. The information on the specific recombinant vector obtained by cloning each gene is shown.
  • Recombinant vectors for steviol production were prepared comprising the GGPPS (SEQ ID NO: 1), CPPS (SEQ ID NO: 2), KS (SEQ ID NO: 3), KO (SEQ ID NO: 4), and KAH (SEQ ID NO: 5) genes.
  • genes related to steviol, GGPPS, CPPS, KS, KO and KAH are assembled to express in one plasmid, a recombinant vector is produced to produce steviol, and then transformed into E. coli. Switched. A cleavage map of the recombinant vector is shown in FIG. 7.
  • the recombinant vector for preparing steviol of Example 2 (FIG. 7) and a recombinant vector comprising a glycosyl UGT85C2 gene (FIG. 8); Or a recombinant vector comprising the transferase UGT74G1 gene (FIG. 9);
  • Each of E. coli was transformed to produce each recombinant E. coli. Thereafter, to confirm that the recombinant E. coli produces steviol monosides, steviol monosides were identified through LCMS-ESI.
  • the LC used the Agilent 1200 Series and the MS used the 6950 Single Quadrupole mass spectrometer.
  • SIM single ion monitoring
  • the recombinant E. coli transformed with the pET21a_UGTx recombinant vector into which the UGTx gene was inserted was incubated at 37 until the OD600 nm was 0.6 in 50 ml LB medium, and then the IPTG was incubated at 30 with a final concentration of 1 mM.
  • Bacteria in the culture were collected by centrifugation, and the resulting cell pellet was collected from glycosyltransferase assay buffer (50 mM potassium phosphate, pH 7.2, 3 mM MgCl2, 10 ⁇ g / ml BSA) and lysozyme (100 mg). / ml) was mixed. This was incubated for 15 minutes at 37 and then sonicated three times for 20 seconds on ice. After centrifugation at 12000g, the supernatant was taken to obtain the UGTx protein. The results are shown in FIG.
  • the band was confirmed around 50 kDa, and the UGTx expressed in the recombinant E. coli was fully identified.
  • a recombinant vector for preparing steviol prepared in Example 2 (FIG. 7); Recombinant vectors constructed to express UGT85C2 (FIG. 15); E. coli was transformed using a recombinant vector (FIG. 16) prepared to express UGTx. Whether or not the production of steviolbioside in the recombinant Escherichia coli transformed with the recombinant vector was confirmed using LCMS-ESI.
  • steviool monosides should be produced in the stevioside biosynthetic metabolic circuit, and the steviool monoside to stevioside should be converted, but no commercial steviol monosides are sold. It was confirmed that the conversion from rubisoside to stevioside. Therefore, in order to confirm that the UGTx functioned normally and the conversion of rubisoside to stevioside was performed, 500 ⁇ g and 200 ⁇ l of glycosyl protein extract of the recombinant E. coli expressing the UGTx gene obtained in Example 5-1 was expressed.
  • a recombinant vector for steviol expression prepared in Example 2 (FIG. 7); And recombinant vectors for gene expression encoding UTG85C2, UGT74G1 and UGTx (FIG. 19); was used to prepare a recombinant E. coli that produces steviosides.
  • the whole cultured cells were extracted with methanol, dried and extracted with the same methanol and concentrated.
  • a diagram schematically illustrating its biosynthetic metabolic circuit is shown in FIG. 20, and the analysis results are shown in FIG. 21.
  • steviosides were not generated at all in the control group including the vector containing no UGTx gene, but it was confirmed that steviosides were normally generated in the group including the recombinant vector containing the UGTx gene.
  • Generating knockout mutant strains from E. coli was carried out using PCR using the primers of Table 4 below, which had a homologous portion of about 50 bp of the gene to be knocked out using FRT-PGK-gb2-neo-FRT as a template. And linear DNA was obtained.
  • the knockout strain was made by inserting the kanamycin gene into the gene to be knocked out and destroying the original gene. More specifically, as shown in FIG. 22, ushA, a gene to be knocked out, and pgi, a gene of glucose glycolysis, are indicated with a red X.
  • the ushA gene was knocked out to increase the UDP-glucose pool, and the pgi gene of the glycolysis pathway was knocked out to increase the NADPH2 pool.
  • MG1655 wild-type strain without first knockout was used as a control for wild-type Escherichia coli, and the knockout of the ushA gene was induced in the stevioside-producing recombinant E. coli of Example 7-2, and the knockout was extracted by gDNA of the ushA mutant strain. Whether or not by using a primer shown in Table 5 by performing a PCR as shown in Figure 23 was confirmed by electrophoresis.
  • the stevioside-producing vector was expressed to produce stevioside and extracted with the same amount of cells to compare the production of stevioside.
  • the amount was extracted by LCMS-ESI Analyzed. More specifically, by performing LCMS-ESI under the same conditions as in Example 5-2, an ushA mutant strain; And ushA and pgi mutant strains; stevioside production was confirmed. The results are shown in FIG.
  • the recombinant microorganism for steviol glycoside production of the present invention is a simple process by manipulating the metabolic pathway by the recombinant gene introduced into the microorganism, rather than directly separating the steviol monoside, rubisoside, steviol bioside or stevioside
  • the steviol glycosides can be economically mass-produced alone, and can be usefully used in the food industry such as natural sweeteners and beverages.

Landscapes

  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

본 발명은 스테비올 배당체 생산용 재조합 미생물 및 스테비올 배당체의 생산 방법에 관한 것이다. 본 발명의 스테비올 배당체 생산용 재조합 미생물은 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 다량으로 생산하는 우수한 효과가 있다. 따라서, 스테비아의 추출물로부터 직접 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 분리하는 것이 아닌, 미생물에 도입된 재조합 유전자에 의해 대사경로를 조작함으로써, 간단한 공정만으로도 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 경제적으로 생산할 수 있어, 상기 스테비올 배당체를 이용하는 천연 감미료 및 음료 등의 식품 산업에 유용하게 이용될 수 있다.

Description

스테비올 배당체 생산용 재조합 미생물
본 발명은 스테비올 배당체 생산용 재조합 미생물 및 스테비올 배당체의 생산 방법에 관한 것이다.
스테비아(Stevia rebaudiana Bertoni)는 국화과의 여러해살이풀로 원산지는 남미의 브라질과 파라과이의 국경지역에 인접한 고산지대이다. 스테비아는 하천이나 습지대 주변에서 자생하며, 잎에 감미 물질이 함유되어 있다. 스테비아의 감미 성분은 스테비올(steviol)을 배당체로 하는 스테비올모노사이드(Steviolmonoside), 스테비올바이오사이드(Steviolbioside), 스테비오사이드(Stevioside), 레바우디오사이드-에이(Rebaudioside-A) 등이 있다. 현재까지 스테비오사이드의 생산과 관련된 연구는 스테비아의 잎으로부터 직접 추출하는 것이 주된 내용이었다. 선행 특허문헌으로는 스테비오사이드를 주성분으로 한 스테비아추출물과 β-1,4-갈락토실 당화합물을 포함하는 수용액 상에서 β-1,4-갈락토실 전이효소를 작용시켜 스테비오사이드에 갈락토실기를 제조하는 방법(일본특허공개 제58-94367호), 물과 소수성 유기용매를 혼합한 반응계에서 효소반응에 의하여 스테비오사이드를 당전이 스테비오사이드로 전환하여 스테비오사이드의 미질을 개선하는 방법(한국등록특허 특1994-528호), 스테비오사이드와 레바우디오사이드 A 혼합물로부터 알코올과 물에 대한 용해도 차이를 이용하여 각각을 결정형으로 분리하는 방법(일본공개특허 제56-121453호) 및 스테비아 식물에 감마광선을 조사하여 레바우디오사이드 A를 다량 함유케 하는 식물로 유전적 변형을 유발시키는 방법(일본특허공개 제2002-34502호) 등이 개시되어 있다. 그러나, 현재까지 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 대량 생산할 수 있는 방법은 미비하며, 이와 관련하여 간단한 공정만으로도 효과적으로 스테비올 배당체를 생산하는 방법이 필요한 실정이다.
특히, 스테비오사이드는 설탕의 약 300배에 달하는 단맛을 내는 천연 감미료이며 파라과이, 브라지르 일본 등 여러 나라에서 저칼로리 감미료로 쓰이므로, 이를 효과적으로 대량 생산하는 방법이 요구되고 있다.
본 발명자들은 스테비올로부터 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 합성할 수 있는 유전자를 연구하던 중 선발된 유전자가 도입된 재조합 미생물은 스테비올로부터 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드에 대한 생성능을 갖고 있음을 확인하였다. 또한, 상기 재조합 미생물에 돌연변이를 유발시켜 생성된 돌연변이 미생물은 스테비오사이드를 과생산함을 확인하여, 본 발명을 완성하였다.
따라서, 본 발명의 목적은 스테비올 배당체 생산용 재조합 미생물을 제공하는 것이다.
또한 본 발명의 목적은 스테비올 배당체의 생산 방법을 제공하는 것이다.
상기와 같은 과제를 해결하기 위해, 본 발명은 (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자, 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자를 포함하는 유전자 군; 및
(b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자 및 서열번호 7로 표시되는 염기서열로 이루어진 UGT74G1(uridine diphospho-glucuronosyltransferase(UGT) 74G1)를 코딩하는 유전자로 이루어진 군에서 선택된 1종 이상의 유전자가 도입된 스테비올 배당체(steviol glycosides) 생산용 재조합 미생물을 제공한다.
또한 본 발명은 (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자; 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자;를 포함하는 유전자 군;
(b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자; 및
(c) 서열번호 8로 표시되는 염기서열로 이루어진 UGTx (uridine diphospho-glucuronosyltransferase(UGT) x)를 코딩하는 유전자가 도입된, 스테비올 배당체 생산용 재조합 미생물을 제공한다.
또한 본 발명은 (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자; 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자; 및
(b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자, 서열번호 7로 표시되는 염기서열로 이루어진 UGT74G1(uridine diphospho-glucuronosyltransferase(UGT) 74G1)를 코딩하는 유전자 및 서열번호 8로 표시되는 염기서열로 이루어진 UGTx(uridine diphospho-glucuronosyltransferase(UGT) x)를 코딩하는 유전자가 도입된, 스테비올 배당체 생산용 재조합 미생물을 제공한다.
또한 본 발명은 상기 재조합 미생물에 ushA 유전자(UDP-Sugar Hydrolase Gene) 또는 pgi 유전자(pig phosphoglucose isomerase gene)를 넉아웃(knockout)시켜 돌연변이를 유발시킨, 스테비올 배당체 과생산능을 갖는 돌연변이 미생물을 제공한다.
또한 본 발명은 (1) 상기 미생물을 배양하는 단계; 및 (2) 상기 (1) 단계의 미생물의 배양물에서 스테비올 배당체를 분리 및 정제하는 단계;를 포함하는, 스테비올 배당체의 생산 방법을 제공한다.
본 발명의 스테비올 배당체 생산용 재조합 미생물은 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 다량으로 생산하는 우수한 효과가 있다. 따라서, 스테비아의 추출물로부터 직접 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 분리하는 것이 아닌, 미생물에 도입된 재조합 유전자에 의해 대사경로를 조작함으로써, 간단한 공정만으로도 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 경제적으로 생산할 수 있어, 상기 스테비올 배당체를 이용하는 천연 감미료 및 음료 등의 식품 산업에 유용하게 이용될 수 있다.
도 1은 스테비올모노사이드의 생합성 대사회로를 나타낸 도이다.
도 2는 루부소사이드의 생합성 대사회로를 나타낸 도이다.
도 3은 스테비올바이오사이드의 생합성 대사회로를 나타낸 도이다.
도 4는 스테비오사이드의 생합성 대사회로를 나타낸 도이다.
도 5의 (A)는 스테비올 재조합 유전자 어셈블리용 pSTV29 벡터를 나타낸다. 도 5의 (B)는 일반적인 클로닝과정에서 이용하는 pUC_mod 벡터를 나타낸다. 도 5의 (C)는 글리코실 전이효소 어셈블리용 pBBR322(MCSII) 벡터를 나타낸다.
도 6의 (A)는 스테비올 재조합 유전자 어셈블리용 pSTV29 벡터를 나타낸다. 도 6의 (B)는 일반적인 클로닝과정에서 이용하는 pUC_mod 벡터를 나타낸다. 도 6의 (C)는 글리코실 전이효소 어셈블리용 pBBR322(MCSII) 벡터를 나타낸다. 도 6의 (D)는 pET21a 벡터를 나타낸다.
도 7은 GGPPS, CPPS, KS, KO 및 KAH 유전자를 포함하는 스테비올 생산용 재조합 벡터의 개열지도를 나타낸 도이다.
도 8의 (A)는 pUC 유래의 벡터에 UGT85C2 유전자를 포함한 재조합 벡터의 개열지도를 나타낸 도이다. 도 8의 (B)는 pBBR 유래의 벡터에 UGT85C2 유전자를 포함한 재조합 벡터의 개열지도를 나타낸 도이다.
도 9의 (A)는 pUC 유래의 벡터에 UGT74G1 유전자를 포함한 재조합 벡터의 개열지도를 나타낸 도이다. 도 8의 (B)는 pBBR 유래의 벡터에 UGT74G1 유전자를 포함한 재조합 벡터의 개열지도를 나타낸 도이다.
도 10은 UGT74G1 유전자 또는 UGT85C2 유전자를 더 포함하는 재조합 벡터로 형질전환된 재조합 균주에서 스테비올모노사이드의 생산 정도를 LCMS-ESI 분석을 통해 확인한 도이다.
도 11은 UGT74G1 유전자 및 UGT85C2 유전자를 포함하는 재조합 벡터의 개열지도를 나타낸 도이다.
도 12는 UGT74G1 유전자 및 UGT85C2 유전자를 더 포함하는 재조합 벡터로 형질전환된 재조합 균주의 루부소사이드의 생산을 LCMS-ESI 분석을 통해 확인한 도이다.
도 13은 재조합 대장균으로부터 발현한 UGTx 단백질을 SDS-PAGE를 통해 확인한 결과를 나타낸 도이다.
도 14는 UGTx의 서열 분석을 통하여 다른 유사 단백질과의 유사도 및 계통관계를 나타낸 도이다.
도 15는 pBBR 유래의 벡터에 UGT85C2 유전자를 포함하는 재조합 벡터의 개열 지도를 나타낸 도이다.
도 16은 UGTx 유전자를 포함하는 재조합 벡터의 개열 지도를 나타낸 도이다.
도 17은 형질전환된 재조합 균주에서 스테비올바이오사이드의 생산 정도를 LCMS-ESI 분석을 통해 확인한 도이다.
도 18은 UGTx 유전자의 발현에 따른 스테비오사이드의 생산 정도를 LCMS-ESI 분석을 통해 확인한 도이다.
도 19는 UGT85C2, UGT74G1 및 UGTx를 코딩하는 유전자 발현용 재조합 벡터의 개열 지도를 나타낸 도이다.
도 20은 UGT74G1 유전자, UGT85C2 유전자 및 UGTx 유전자를 이용한 스테비오사이드의 생합성 대사회로를 모식한 도이다.
도 21은 스테비오사이드 생산 재조합 균주로부터 생산된 스테비오사이드를 LCMS-ESI 분석을 통해 확인한 결과를 나타낸 도이다.
도 22는 글루코스 해당과정에서 넉아웃 하고자 하는 ushA 유전자 및 pgi 유전자를 표시한 도이다.
도 23은 재조합 대장균의 ushA 유전자 넉아웃 여부를 확인하기 위한 프라이머 및 이의 결과를 전기영동하여 확인한 결과를 나타낸 도이다.
도 24는 재조합 대장균의 ushA 유전자 및 pgi 유전자의 넉아웃 여부를 확인하기위한 프라이머 및 이의 결과를 전기영동하여 확인한 결과를 나타낸 도이다.
도 25은 ushA 돌연변이 균주; 및 ushA 및 pgi 돌연변이 균주의 스테비오사이드 과생산 여부를 LCMS-ESI 분석을 통해 확인한 결과를 나타낸 도이다.
본 발명은 (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자, 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자를 포함하는 유전자 군; 및
(b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자 및 서열번호 7로 표시되는 염기서열로 이루어진 UGT74G1(uridine diphospho-glucuronosyltransferase(UGT) 74G1)를 코딩하는 유전자로 이루어진 군에서 선택된 1종 이상의 유전자가 도입된 스테비올 배당체(steviol glycosides) 생산용 재조합 미생물을 제공한다.
본 발명에 있어서, 상기 "GGPPS", "CPPS" 및 "KS"는 스테비오사이드 생합성 관련 효소이고, "KO"는 카우린산 생합성 관련 효소이며, "KAH"는 스테비올 생합성 관련 효소이다.
본 발명에 있어서, 상기 "UGT85C2"는 스테비올에서 스테비올모노사이드를 만들고 19-글리코시드에서 루부소사이드를 만드는 효소이다.
본 발명에 있어서, 상기 "UGT74G1"는 스테비올에서 19-글리코시드를 만들고 스테비올모노사이드에서 루부소사이드를 만들 뿐만 아니라 스테비올바이오사이드에서 스테비오사이드를 만드는 효소이다.
본 발명에 있어서, 미생물은 대장균, 박테리아, 효모 및 곰팡이로 이루어진 군으로부터 선택된 1종 이상일 수 있고, 바람직하게는 대장균이나, 이에 제한되지 않는다.
상기 스테비올 배당체는 스테비올모노사이드(Steviolmonoside) 또는 루부소사이드(rubusoside)일 수 있다.
상기 (a) 의 유전자 군은 도 7의 개열지도를 갖는 벡터에 의해 도입되고, 상기 (b)의 UGT85C2를 코딩하는 유전자는 도 8의 개열지도를 갖는 벡터에 의해 도입되며, 상기 (b)의 UGT74G1를 코딩하는 유전자는 도 9의 개열지도를 갖는 벡터에 의해 도입되고, 상기 (b)의 UGT85C2를 코딩하는 유전자 및 UGT74G1를 코딩하는 유전자는 도 11의 개열지도를 갖는 벡터에 의해 도입될 수 있으나, 유전자 및 벡터의 종류는 스테비올 배당체를 생산하는 것이라면, 이에 제한되지 않는다.
본 발명에 있어서, "벡터"는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 유전자의 염기서열을 함유하는 유전자 작제물을 의미하는 것으로, 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다.
본 발명에서 상기 "작동가능하게 연결된 (operably linked)"는 일반적 기능을 수행하도록 핵산 발현조절 서열과 목적하는 단백질을 코딩하는 핵산 서열이 기능적으로 연결되어 있는 것을 말한다. 예를 들어 프로모터와 단백질 또는 RNA를 코딩하는 핵산 서열이 작동가능하게 연결되어 코딩서열의 발현에 영향을 미칠 수 있다. 재조합 벡터와의 작동적 연결은 당해 기술분야에서 잘 알려진 유전자 재조합 기술을 이용하여 제조할 수 있으며, 부위-특이적 DNA 절단 및 연결은 당해 기술 분야에서 일반적으로 알려진 효소 등을 사용한다.
본 발명에서 상기 "목적 유전자의 발현"은 상기 목적 유전자를 발현시켜 목적 유전자가 코딩하는 단백질을 생산하는 것을 의미할 수 있다. 본 발명에서 목적 유전자를 발현하는 방법은 상기 목적 유전자를 포함하는 벡터로 형질전환된 형질전환체(숙주세포)를 배양하여 상기 목적 유전자가 코딩하는 단백질을 발현시키는 방법일 수 있으며, 이를 통해 상기 단백질이 관여되는 생합성 경로의 최종산물을 제조할 수 있다.
본 발명의 벡터는 세포 내에서 복제 가능한 것이면 특별히 한정되지 않고 당업계에 알려진 임의의 벡터를 이용할 수 있으며, 예컨대 플라스미드, 코즈미드, 파지 입자, 바이러스 벡터일 수 있다. 예를 들어, 발현 벡터는 pUC19, pSTV28, pBBR1MCS, pBluscriptII, pBAD, pTrc99A, pET, pACYC184 및 pBR322 계열 등의 당업계에 상용화된 벡터를 사용할 수 있다.
본 발명에 따른 벡터는 해당 조합을 구성하는 각 유전자들을 하나의 벡터에 삽입시키거나, 2 종류 이상의 벡터에 나누어 삽입시킬 수 있다. 이 때 하나의 벡터에 둘 이상의 유전자들이 삽입되는 경우, 유전자들은 항시성 프로모터(예를 들어, constitutive lac promoter), 터미네이터 등을 각각 가진 형태로 삽입될 수 있으며, 이에 제한되지 않는다.
본 발명에 있어서, GGPPS를 코딩하는 유전자는 로도박터 스페로이드(Rhodobacter sphaeroides)에서 유래한 유전자인 것이 바람직하다. 또한, 상기 CPPS를 코딩하는 유전자, KS를 코딩하는 유전자, KO를 코딩하는 유전자, KAH를 코딩하는 유전자, UGT85C2를 코딩하는 유전자, UGT74G1를 코딩하는 유전자 및 UGTx을 코딩하는 유전자는 스테비아 레바우디아나(Stevia rebaudiana Bertoni)에서 유래한 유전자인 것이 바람직하다.
상기 UGT85C2을 코딩하는 유전자 또는 UGT74G1를 코딩하는 유전자는 각종 숙주의 형질전환을 위한 핵산 분자의 암호화 영역 또는 유전자를 지칭함에 따라, DNA에 의해 암호화된 폴리펩티드를 변화시키지 않고서 숙주 유기체의 전형적인 코돈 활용을 반영하도록 상기 핵산 분자의 암호화 영역 또는 유전자 내의 코돈을 변화시키는 것을 지칭한다. 본 발명의 맥락에서, 스테비아 레바우디아나가 식물체이기 때문에 대장균에서 코돈을 잘 발현할 수 있도록 식물체의 코돈이 아닌 대장균의 코돈에 최적화한 것이다.
본 발명에서 상기 "로도박터 스페로이드"는 광합성 세균으로 소수성 및 불용성 화합물을 과잉 생산하는 특징이 있다.
본 발명에서 상기 "스테비아 레바우디아나"는 국화과의 여러해살이풀로 원산지는 남미의 브라질과 파라과이의 국경지역에 인접한 고산지대이다. 스테비아 레바우디아나는 하천이나 습지대 주변에서 자생하며, 잎에 감미물질이 함유되어 있다.
본 발명에 있어서, 로도박터 스페로이드의 mRNA를 추출하여 합성한 cDNA를 주형으로 목적한 GGPPS를 코딩하는 유전자 뿐만 아니라, 스테비아 레바우디아나의 mRNA를 추출하여 합성한 cDNA를 주형으로 목적한 CPPS를 코딩하는 유전자, KS를 코딩하는 유전자, KO를 코딩하는 유전자, KAH를 코딩하는 유전자, UGT85C2를 코딩하는 유전자, UGT74G1를 코딩하는 유전자 및 UGTx를 코딩하는 유전자의 양 말단에 상보적인 서열을 가지는 올리고뉴클레오타이드를 프라이머로 이용하여 PCR을 실시함으로써 상기 각 유전자의 염기서열을 수득할 수 있다. 한편, 코돈의 축퇴성으로 인하여 본 발명의 GGPPS를 코딩하는 유전자, CPPS를 코딩하는 유전자, KS를 코딩하는 유전자, KO를 코딩하는 유전자, KAH를 코딩하는 유전자 및 UGT85C2를 코딩하는 유전자, UGT74G1를 코딩하는 유전자 및 UGTx를 코딩하는 유전자는 다양한 염기 서열로 존재할 수 있으며, 이들은 모두 본 발명의 범주에 포함된다. 본 발명의 1 내지 8의 염기서열 및 이의 변이체가 본 발명의 범주에 포함된다. 구체적으로, 상기 각 염기서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 보다 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 염기서열을 포함할 수 있다. 폴리뉴클레오티드에 대한 "서열 상동성의 %"는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열(추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제(즉, 갭)를 포함할 수 있다.
또한 본 발명은 (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자; 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자;를 포함하는 유전자 군;
(b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자; 및
(c) 서열번호 8로 표시되는 염기서열로 이루어진 UGTx (uridine diphospho-glucuronosyltransferase(UGT) x)를 코딩하는 유전자가 도입된, 스테비올 배당체 생산용 재조합 미생물을 제공한다.
상기 스테비올 배당체는 스테비올바이오사이드(steviolbioside)일 수 있다.
상기 (a)의 유전자 군은 도 7의 개열지도를 갖는 벡터에 의해 도입되고, 상기 (b)의 UGT85C2를 코딩하는 유전자는 도 15의 개열지도를 갖는 벡터에 의해 도입되며, 상기 (c)의 UGTx를 코딩하는 유전자는 도 16의 개열지도를 갖는 벡터에 의해 도입될 수 있으나, 유전자 및 벡터의 종류는 스테비올바이오사이드를 생산하는 것이라면, 이에 제한되지 않는다.
상기 UGTx를 코딩하는 유전자는 스테비아 레바우디아나(Stevia rebaudiana Bertoni)에서 유래한 유전자이나, 이에 제한되지 않는다.
본 발명에 있어서, 상기 "UGTx를 코딩하는 유전자"는 스테비아 레바우디아나의 글라이코실화 효소에 한정하여, 계통 관계(Phylogenetic relationship)를 보면(도 16), 가장 유사도가 높은 유전자는 UGT91D1임을 확인하였다. 이는 본 발명의 UGTx 유전자와 서열 유사성이 높아 본 발명의 UGTx 유전자 갖고 있는 활성이 있다고 추측할 수 있으나, 스테비아 레바우디아나의 글라이코실화 효소의 기능을 스크리닝함에 있어서 여러 후보 글라이코실화 효소 중 상기 UGT91D1 유전자는 본 발명의 UGTx 유전자와 동일한 활성을 갖고 있지 않은 것으로 기재되어 있다(Richman A, et al., (2005), Plant Journal, 41(1): p. 56-67). 따라서, 본 발명의 UGTx를 코딩하는 유전자는, 상기 UGT91D1와 동일한 활성을 갖는다고 볼 수 없다. 본 발명의 일실시예에 따라 UGTx를 코딩하는 유전자를 이용 시, 스테비오모노사이드를 생성할 수 있고, 스테비오모노사이드에서 스테비오사이드를 생성하거나, 루부소사이드에서 스테비오사이드를 생성할 수 있다.
또한 본 발명은 (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자; 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자; 및
(b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자, 서열번호 7로 표시되는 염기서열로 이루어진 UGT74G1(uridine diphospho-glucuronosyltransferase(UGT) 74G1)를 코딩하는 유전자 및 서열번호 8로 표시되는 염기서열로 이루어진 UGTx(uridine diphospho-glucuronosyltransferase(UGT) x)를 코딩하는 유전자가 도입된, 스테비올 배당체 생산용 재조합 미생물을 제공한다.
상기 스테비올 배당체는 스테비오사이드(stevioside)일 수 있다.
상기 (a) 의 유전자 군은 도 7의 개열지도를 갖는 벡터에 의해 도입되고, 상기 (b)의 UGT85C2를 코딩하는 유전자, UGT74G1를 코딩하는 유전자 및 UGTx 코딩하는 유전자는 도 19의 개열지도를 갖는 벡터에 의해 도입될 수 있으나, 유전자 및 벡터의 종류는 스테비오사이드를 생산하는 것이라면, 이에 제한되지 않는다.
또한 본 발명은 상기 재조합 미생물에 ushA 유전자(UDP-Sugar Hydrolase Gene) 또는 pgi 유전자(pig phosphoglucose isomerase gene)를 넉아웃(knockout)시켜 돌연변이를 유발시킨, 스테비올 배당체 과생산능을 갖는 돌연변이 미생물을 제공한다.
본 발명에 있어서, 상기 "ushA 유전자"는, UDP-글루코스를 UDP와 글루코스로 분해하는 효소를 코딩하는 유전자이다. 스테비오사이드 생산시에 발현하는 글라이코실 전이 효소가 UDP-글루코스를 이용하여 글라이코실화를 하기 때문에, UDP-글루코스를 분해하는 상기 ushA 유전자를 넉아웃하여 UDP-글루코스 풀(pool)을 증가 시키기 위함에 그 목적이 있다.
본 발명에 있어서, 상기 "pgi 유전자"는 글루코스의 해당과정 대사 경로 중 상기 pgi 유전자를 넉아웃시킬 경우, 해당과정이 아닌 5탄당 인산경로 (pentose phosphate pathway)로 flux가 가게 된다. 스테비오사이드 생산 관련 유전자가 공동인자(cofactor)로서 NADPH2를 사용하기 때문에, 5탄당 인산경로 쪽으로 flux가 가면 NADPH2 의 효용성을 증가시킬 수 있다.
상기 돌연변이 미생물은 UDP-글루코스 풀(pool)을 증가시킬 수 있고, NADPH2 의 효용성을 증가시킬 수 있어, 스테비올 배당체를 과생산할 수 있고, 더욱 바람직하게는 스테비오사이드를 대량 생산할 수 있도록 한다.
또한 본 발명은 (1) 상기 미생물을 배양하는 단계; 및 (2) 상기 (1) 단계의 미생물의 배양물에서 스테비올 배당체를 분리 및 정제하는 단계;를 포함하는, 스테비올 배당체의 생산 방법을 제공한다.
본 발명에 있어서, "배양"은 미생물을 적당히 인공적으로 조절한 환경조건에서 생육시키는 것을 의미한다.
상기 미생물은 통상의 배지에서 생육 가능하며, 일 예로 뉴트리엔트 브로스(Nutrient broth) 배지에서 배양할 수 있다. 상기 배지는 특정 미생물을 배양하기 위하여 배양대상 즉 배양체가 되는 미생물이 필요로 하는 영양물질을 포함하는 것으로 특수한 목적을 위한 물질이 추가로 첨가되어 혼합된 것일 수 있다. 상기 배지는 배양기 또는 배양액이라고도 하며, 천연배지, 합성배지 또는 선택배지를 모두 포함하는 개념이다.
배양에 사용되는 배지는 적당한 탄소원, 질소원, 아미노산, 비타민 등을 함유한 통상의 배지 내에서 온도, pH 등을 조절하면서 적절한 방식으로 특정 균주의 요건을 충족해야 한다. 사용될 수 있는 탄소원으로는 글루코즈 및 자일로즈의 혼합당을 주 탄소원으로 사용하며 이외에 수크로즈, 락토즈, 프락토즈, 말토즈, 전분, 셀룰로즈와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다. 사용될 수 있는 질소원으로는 암모니아, 황산암모늄, 염화암모늄, 초산암모늄, 인산암모늄, 탄산안모늄, 및 질산암모늄과 같은 무기질소원; 글루탐산, 메티오닌, 글루타민과 같은 아미노산 및 펩톤, NZ-아민, 육류 추출물, 효모 추출물, 맥아 추출물, 옥수수 침지액, 카세인 가수분해물, 어류 또는 그의 분해생성물, 탈지 대두 케이크 또는 그의 분해생성물 등 유기질소원이 사용될 수 있다. 이들 질소원은 단독 또는 조합되어 사용될 수 있다. 상기 배지에는 인원으로서 인산 제1칼륨, 인산 제2칼륨 및 대응되는 소듐-함유 염이 포함될 수 있다. 사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함된다. 또한, 무기화합물로는 염화나트륨, 염화칼슘, 염화철, 황산마그네슘, 황산철, 황산망간 및 탄산칼슘 등이 사용될 수 있다. 마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장 물질이 사용될 수 있다.
또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양과정에서 배양물에 적절한 방식에 의해 회분식, 유가식 또는 연속식으로 첨가될 수 있으나, 특별히 이에 제한되지는 않는다. 수산화나트륨, 수산화칼륨, 암모니아와 같은 기초 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다.
본 발명에 있어서, 상기 (2) 단계의 미생물에서 스테비올 배당체의 분리 및 정제 방법은 해당 물질의 물리, 화학적 특성에 따라 적합한 공지의 방법을 이용할 수 있으며, 예를 들어 증류, 전기투석, 투과증발, 크로마토그래피, 용매추출, 반응추출, HPLC 등을 이용할 수 있으며, 이들을 조합하여 이용할 수 있으나, 이에 제한되지 않는다.
이하, 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1. 스테비올의 배당체인 스테비올모노사이드 , 루부소사이드 , 스테비올바이오사이드 또는 스테비오사이드의 생합성 관련 효소들에 대한 유전자 선발, 벡터의 확보 및 클로닝 프라이머의 제작
스테비올의 배당체(스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드)의 생합성 관련 효소들에 대한 유전자를 선발하고, 벡터의 확보 및 클로닝 프라이머의 제작을 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 스테비올의 배당체인 스테비올모노사이드(도 1), 루부소사이드(도 2), 스테비올바이오사이드(도 3) 또는 스테비오사이드(도 4)의 생합성 대사회로에 나타낸 바와 같이, 스테비올의 배당체 생합성 관련 효소로는 GGPPS(geranylgeranyl diphosphate synthase), CPPS(copalyl diphosphate synthase) 및 KS(kaurene synthase) 등이 있으며, 카우린산 생합성 관련 효소로는 KO(kaurene oxidase)가, 스테비올 생합성 관련 효소로는 KAH(kaurenoic acid hydroxylase)가 더 포함된다. 상기 GGPPS 유전자의 경우 로도박터 스페로이드(Rhodobacter sphaeroides)로부터 확보하였다. 또한, 나머지 유전자는 스테비아 레바우디아나(Stevia rebaudiana Bertoni)의 잎으로부터 RNA를 확보하였고, 이로부터 cDNA를 합성하여 확보하였다.
스테비올의 배당체(스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드) 생성능을 가지는 재조합 미생물을 제조하기 위하여, 생합성 관련 효소를 확보하기 위한 클로닝을 각각 수행하였다. 본 발명에서 클로닝 및 단백질 발현을 확인하기 위해, 도 5의 재조합 벡터의 개열 지도에 나타낸 바와 같이, 스테비오사이드 또는 루부소사이드의 생산을 위하여, 도 5의 A의 pSTV29 벡터(Takara)는 스테비올 재조합 유전자들을 어셈블리할 때 이용하였으며, 도 5의 B의 pUC_mod 벡터는 일반적인 클로닝 과정에서 이용하였고, 도 5의 C의 pBBR322(MCSII) 벡터는 글리코실 전이효소를 어셈블리할 때 이용하였다. 도 6의 재조합 벡터의 개열 지도에 나타낸 바와 같이, 스테비올바이오사이드 또는 스테비오사이드의 생산을 위하여, 도 6의 A의 pSTV29 벡터(Takara)는 스테비올 재조합 유전자들을 어셈블리할 때 이용하였으며, 도 6의 B의 pUC_mod 벡터는 일반적인 클로닝 과정에서 이용하였고, 도 6의 C의 pBBR322(MCSII) 벡터는 글리코실 전이효소를 어셈블리할 때, 도 6의 D의 벡터는 단백질 발현하여 in vitro assay하는 데에 이용하였다.
또한, 상기 각 유전자를 클로닝하기 위한 프라이머를 하기 표 1 및 2에 나타내었으며, 하기 표 1 및 표 2의 프라이머 중 밑줄로 표시된 부분은 각 유전자와 상보적인 부분을 나타내었고, 하기 표 3은 각 벡터에 각 유전자를 클로닝한 구체적인 재조합 벡터의 정보를 나타내었다.
유전자 프라이머 염기서열 제한효소자리 서열번호
GGPPS 5’-F GCTCTAGAAGGAGGATTACAAAATGGCGTTTGAACAGCGGATTG XbaI 9
5’-R GGAATTCTCAGACGCGGGCCGCG EcoRI 10
CPPS 5’-F GCTCTAGAAGGAGGATTACAAAATGAAGACCGGCTTCATC XbaI 11
5’-R TTCCCTTGCGGCCGCTCATATTACAATCTCGAAC NotI 12
KS 5’-F GCTCTAGAAGGAGGATTACAAAATGAATCTTTCACTATGCATC XbaI 13
5’-R TTCCCTTGCGGCCGCTTACCTTTGTTCTTCATTTTC NotI 14
KO 5’-F GCTCTAGAAGGAGGATTACAAAATGGATGCCGTCACCGGTTTG XbaI 15
5’-R GGAATTCTCATATCCTGGGCTTTATTATG EcoRI 16
KAH 5’-F GCTCTAGAAGGAGGATTACAAAATGATTCAGGTGCTGACCC XbaI 17
5’-R GGAATTCTTAGACTTGGTGTGGGTGC EcoRI 18
UGT85C2 5’-F GCTCTAGAAGGAGGATTACAAAATGGATGCTATGGCAACTAC XbaI 19
5’-R GGAATTCTTAGTTGCGCGCCAGAACGG EcoRI 20
74G1 5’-F GCTCTAGAAGGAGGATTACAAAATGGCTGAACAACAAAAAATC XbaI 21
5’-R GGAATTCTTATGCCTTGATCAGCTCGG EcoRI 22
UGTx 5’-F TCCCCCCGGGAGGAGGATTACAAAATGTACAACGTTACTTATCATC XmaI 23
5’-R GGAATTCTTAACTCTCATGATCGATGG EcoRI 24
유전자 프라이머 염기서열 제한효소 자리 서열번호
UGTx 5’-F CGGGATCCATGTACAACGTTACTTATCATC BamHI 25
5’-R CCCAAGCTTACTCTCATGATCGATGGC HindIII 26
플라스미드 특성
pUCM pUC19으로부터 변형된 앰피실린 내성을 가지고 있으며 지속적으로 발현이 가능한 벡터
pUCM_GGPPS 로도박터 스페로이드로부터 유래한GGPPS 발현 벡터
pUCM_CPPS 스테비아 레바우디아나로부터 유래한CPPS 발현 벡터
pUCM_KS 스테비아 레바우디아나로부터 유래한KS 발현 벡터
pUCM_KO 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 KO 발현 벡터
pUCM_KAH 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 KAH 발현 벡터
pUCM_UGT85C2 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 UGT85C2 발현 벡터
pUCM_UGT74G1 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 74G1 발현 벡터
pUCM_UGTx 스테비아 레바우디아나로부터 유래한 UGTx 글리코실 전이효소 발현 벡터
pET21a C-terminal에 6개의 His tag을 갖고 있는 단백질 발현용 벡터
pET21a_UGTx 스테비아 레바우디아나로부터 유래한UGTx 단백질 발현 벡터
pSTV29 스테비올 생성 유전자 어셈블리를 위한 클로람페니콜 내성을 가지고 있는 벡터
pSTV29_GGPPS_CPPS_KS_KO_KAH 스테비아 레바우디아나로부터 유래한CPPS, KS 로도박터 스페로이드로부터 유래한 GGPPS와 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 KO, KAH 가 어셈블리 되어있는 스테비올 생산 벡터
pBBR1MCS2 글리코실 전이효소 유전자 어셈블리를 위한 카나마이신 내성을 가지고 있는 벡터
pBBR_UGT85C2 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 UGT85C2 발현 벡터
pBBR_74G1 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 74G1 발현 벡터
pBBR_UGT85C2_74G1 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 UGT85C2, 74G1 발현 벡터
pBBR_UGT85C2_74G1_UGTx 스테비아 레바우디아나의 단백질 시퀀스 정보로부터 합성한 UGT85C2, 74G1와 스테비아 레바우디아나로부터 유래한UGTx 발현 벡터
실시예 2. 스테비올 제조용 재조합 벡터의 제작
GGPPS(서열번호 1), CPPS(서열번호 2), KS(서열번호 3), KO(서열번호 4) 및 KAH(서열번호 5) 유전자를 포함하는 스테비올 생산용 재조합 벡터를 제작하였다.
보다 구체적으로, 스테비올에 관련된 유전자인 GGPPS, CPPS, KS, KO 및 KAH를 하나의 플라스미드에서 발현할 수 있도록 조립하여, 스테비올이 생성될 수 있도록 재조합 벡터를 제작한 후 이를 이용하여 대장균에 형질전환시켰다. 상기 재조합 벡터의 개열 지도를 도 7에 나타내었다.
그 결과, 상기 재조합 벡터로 형질 전환된 재조합 균주 내에서 스테비올 생성이 이루어지는 것을 확인하였다.
실시예 3. UGT85C2 또는 UGT74G1 유전자를 포함하는 재조합 벡터를 이용한 스테비올모노사이드의 생산
UGT85C2(서열번호 6) 또는 UGT74G1(서열번호 7) 유전자와 상기 실시예 2의 스테비올 제조용 재조합 벡터를 함께 발현시켜 스테비올 배당체 중 하나인 스테비올모노사이드를 생산하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 상기 실시예 2의 스테비올 제조용 재조합 벡터(도 7)와, 글리코실 UGT85C2 유전자를 포함하는 재조합 벡터(도 8); 또는 전이효소인 UGT74G1 유전자를 포함하는 재조합 벡터(도 9); 각각을 대장균에 형질전환 시켜 각 재조합 대장균을 제작하였다. 그 후, 상기 재조합 대장균이 스테비올모노사이드를 생산하는지 확인하기 위하여, LCMS-ESI를 통해 스테비올모노사이드를 확인하였다. LC는 Agilent사의 1200 Series를, MS는6150 Single Quadrupole mass spectrometer를 이용하였다. 상기 LCMS-ESI의 분석 조건으로는, 40의 C18 컬럼에서 0.5 ml/min의 유량(flow rate)를 유지하면서, 2 mM 아세트산 암모늄(ammonium acetate)(pH6.5) 및 0.1% CH2Cl2의 CAN과 같은 두 용매를 단계적(gradient)으로 실시하였다. 또한, 음성 모드(negative mode)로 [M-H]-=479의 SIM(single ion monitoring) 조건으로 스테비올모노사이드를 확인하였다. 그 결과를 도 10에 나타내었다.
도 10에 나타낸 바와 같이, 형질전환된 재조합 균주 내에서, UGT85C2 또는 UGT74G1를 코딩하는 유전자를 이용할 경우, 스테비올모노사이드가 효과적으로 생성됨을 확인하였다.
실시예 4. UGT85C2 및 UGT74G1 유전자를 포함하는 재조합 벡터를 이용한 루부소사이드의 생산
UGT85C2 및 UGT74G1 유전자를 포함하는 재조합 벡터를 이용하여 스테비올 배당체 중 하나인 루부소사이드의 생산하기 위하여 하기와 같은 실험을 수행하였다.
보다 구체적으로, 대장균 내에서 최종적으로는 루부소사이드를 생성하기 위하여 실시예 2에서 제작한 스테비올 제조용 재조합 벡터(도 7); 및 실시예 3에서 각각의 기능을 확인한 UGT85C2 및 UGT74G1을 하나의 플라즈미드에서 발현할 수 있도록 pBBR322 벡터에 조립한 재조합 벡터(도 11)를 대장균에 형질전환시켰으며, 형질전환된 재조합 균주 내에서 LCMS-ESI를 이용하여 루부소사이드 생성이 이루어지는 것을 확인하였다. 분석 조건은 30의 C18 칼럼에서 0.4 ml/min의 유량을 유지하면서 0.01% 포름산(formic acid) 및 100% CAN 용매를 단계적(gradient)으로 실시하였다. 또한, 루부소사이드 측정을 위하여 MS-ESI는 음성 모드(positive mode)에서 [M+H]+=665의 SIM(single ion monitoring)조건으로 확인하였다. 그 결과를 도 12에 나타내었다.
도 12에 나타낸 바와 같이, 형질전환된 재조합 균주 내에서, UGT85C2 및 UGT74G1를 코딩하는 유전자를 이용할 경우, 루부소사이드가 효과적으로 생성됨을 확인하였다.
실시예 5. UGTx 유전자를 포함하는 재조합 대장균의 UGTx 유전자 발현 확인 및 UGTx의 계통 분석
5-1. UGTx 유전자를 포함하는 재조합 대장균의 UGTx 유전자 발현 확인
스테비올바이오사이드 또는 스테비오사이드의 생산에 필수적인 UGTx 유전자(서열번호 8)가 대장균에서 효과적으로 발현하는지 확인하기 위하여, 생체 외 기능 검정(In vitro functional assay)하여 이를 확인인하였다.
보다 구체적으로, UGTx 유전자를 삽입한 pET21a_UGTx 재조합 벡터로 형질전환된 재조합 대장균을 50ml LB배지에서 OD600nm에서 0.6이 될 때까지 37에서 배양한 뒤, IPTG를 최종농도 1mM로 맞추어 30에서 배양하였다. 배양액 내의 균을 원심분리를 통해 모으고, 이를 통해 모아진 세포 펠렛에 글리코실 전이효소(glycosyltransferase) 어세이 완충액(50mM potassium phosphate, pH7.2, 3mM MgCl2, 10μg/ml BSA) 및 라이소자임(lysozyme, 100 mg/ml)을 섞어주었다. 이를 37에서 15분간 배양한 뒤 얼음에서 20초 간 3회 초음파 처리하였다. 이를 12000g에서 원심분리 한 후, 상등액을 취하여 UGTx 단백질을 수득하였다. 그 결과를 도 13에 나타내었다.
도 13에 나타낸 바와 같이, 약 50kDa 근처에서 밴드를 확인하였으며, 재조합 대장균 내에서 발현된 UGTx를 전체 밴드(fully band)로 확인하였다.
5-2. UGTx의 계통 분석
UGTx유전자와 이와 유사힌 유전자와의 유사도 및 계통 관계를 확인하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 계통 관계는 스테비아 레바우디아나에 한정 지었으며, UGTx는 화살표로 나타내었다. 식물 UGT 기능적으로 특성이 알려진 아미노산의 서열을 NCBI 데이터베이스에서 추출한 뒤, 계통수(phylogenetic tree)를 MEGA 6.0 소프트웨어에 의한 부트스트랩핑(bootstrapping)-1000 복제를 이용한 인접 결합 방법(neighbor joining method)으로 작성하였다. 그 결과를 도 14에 나타내었다.
도 14에 나타낸 바와 같이, 가장 유사도가 높은 유전자는 UGT91D1임을 확인하였다. 그러나, 상기 유전자는 후보 글라이코실화 효소의 일부분이고, 본 발명의 UGTx 유전자의 스테비오사이드 생성과 유사하게 알려진 바가 없음을 확인하였다.
실시예 6. UGT85C2 및 UGTx 유전자를 포함하는 벡터와 스테비올 제조용 재조합 벡터를 함께 발현하여 스테비올바이오사이드 생산
UGT85C2(서열번호 6) 및 UGTx(서열번호 8) 유전자를 포함하는 벡터와 스테비올 제조용 재조합 벡터를 함께 발현하여 스테비올바이오사이드를 생산하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 대장균 내에서 스테비올 배당체 중 하나인 스테비올바이오사이드를 생성하기 위하여, 상기 실시예 2에서 제작한 스테비올 제조용 재조합 벡터(도 7); UGT85C2를 발현하도록 제작한 재조합 벡터(도 15); 및 UGTx를 발현하도록 제작한 재조합 벡터(도 16)를 이용하여 대장균에 형질전환 시켰다. 상기 재조합 벡터로 형질전환된 재조합 대장균 내에서 스테비올바이오사이드의 생성 여부를 LCMS-ESI를 이용하여 확인 하였다. LC는 Agilent사의 1200 Series를, MS는6150 Single Quadrupole mass spectrometer를 이용하였고, 분석 조건은 30의 C18 칼럼에서 0.4 ml/min의 유량(flow rate)을 유지하면서 0.01% 포름산(formic acid) 및 100% ACN의 두 용매를 단계적(gradient)으로 적용하였다. 스테비올바이오사이드 측정을 위하여, MS-ESI는 양성 모드(positive mode)로 [M+H]+=665의 SIM(single ion monitoring)에서 확인하였다. 그 결과를 도 17에 나타내었다.
도 17에 나타낸 바와 같이, 형질전환된 재조합 균주 내에서, 스테비올바이오사이드가 효과적으로 생성됨을 확인하였다.
실시예 7. UGT74G1 , UGT85C2 및 UGTx 유전자를 포함하는 벡터와 스테비올 제조용 재조합 벡터를 함께 발현하여 스테비오사이드 생산
UGTx 유전자의 정상적인 발현에 따른 스테비오사이드 생산을 확인하였다. 또한, UGT74G1, UGT85C2 및 UGTx 유전자를 포함하는 벡터 및 스테비올 제조용 재조합 벡터를 함께 발현하여 스테비오사이드 생산을 확인하였다.
7-1. UGTx 유전자 발현에 스테비오사이드 생성 확인
생체 외 기능 검정(In vitro functional assay)을 통한 UGTx 유전자 발현에 따른 스테이오사이드 생성을 확인하기 위하여, 하기와 같은 실험을 수행하였다.
보다 구체적으로, 상기 UGTx가 정상적으로 발현된다면, 스테비오사이드 생합성 대사 회로에서 스테비올모노사이드를 생산하고, 상기 스테비올모노사이드에서 스테비오사이드로 전환이 되어야 하지만, 시중에 스테비올 모노사이드를 판매하지 않아, 루부소사이드에서 스테비오사이드로 전환이 되는 것을 확인하였다. 따라서 UGTx가 정상적인 기능을 하여 루부소사이드에서 스테비오사이드로의 전환이 이루어진 것을 확인하기 위해, 상기 실시예 5-1에서 수득한 UGTx 유전자가 발현된 재조합 대장균의 단백질 추출물 500㎍과 200㎕의 글리코실전이효소(glycosyltransferase) 어세이 완충액에 녹인 루부소사이드(rubusoside)(Sigma, St Louis, Missouri, USA) 50 uM와 1 mM UDP 글루코스를 섞어 30에서 2시간 동안 배양하였다. 생체 외(In vitro) 반응이 끝난 반응물에 부탄올 200㎕을 넣고 추출한 뒤에 이를 액체 크로마토그래피-ESI질량분석기(liquid chromatography-mass spectrometry, LCMS-ESI)를 통하여 UGTx가 제대로 작동된다면 루부소사이드에서 스테비오사이드로의 전환이 이루어지므로 스테비오사이드가 생산된 것으로 확인하였다. 대조군으로 유전자를 발현시키지 않은 공벡터를 삽입한 재조합 대장균의 단백질 추출물을 이용하였다. 그 결과를 도 18에 나타내었다.
도 18에 나타낸 바와 같이, LCMS-ESI를 통하여 스테비오사이드가 확인되었으며, 이를 통하여 UGTx 유전자가 정상적으로 발현됨을 확인하였다.
7-2. 스테비오사이드 생산용 재조합 미생물의 제작
상기 실시예 2에서 제작한 스테비올 발현용 재조합 벡터(도 7); 및UGT85C2, UGT74G1 및 UGTx를 코딩하는 유전자 발현용 재조합 벡터(도 19); 를 이용하여, 스테비오사이드를 생성하는 재조합 대장균을 제조하였다. 상기 재조합 대장균으로부터 생성된 스테비오사이드의 분리 및 정성 분석을 위하여, 전체 배양된 세포를 메탄올로 추출하고 모두 건조한 뒤에 같은 메탄올로 추출하여 농축하였다. 이의 생합성 대사회로를 구체적으로 모식한 도를 도 20에 나타내었으며, 분석 결과를 도 21에 나타내었다.
도 21에 나타낸 바와 같이, UGTx 유전자가 포함되지 않는 벡터를 포함한 대조군에서는 스테비오사이드가 전혀 생성되지 않았으나, UGTx 유전자를 포함한 재조합 벡터를 포함한 군에서는 스테비오사이드가 정상적으로 생성됨을 확인하였다.
실시예 8. 유전자 넉아웃(knockout)을 통한 돌연변이 재조합 미생물의 제작
상기 실시예 7-2의 스테비오사이드 생산 재조합 대장균에 ushA 유전자 및 pgi 유전자를 넉아웃시켜 돌연변이를 유도한 뒤, 스테비오사이드의 과생산을 유도하기 위하여, 하기와 같은 실험을 수행하였다.
대장균으로부터 넉아웃 돌연변이 균주를 만드는 것은 FRT-PGK-gb2-neo-FRT를 주형으로 사용하여 넉아웃 하고자 하는 유전자의 약 50bp의 상동(homologous) 부분을 가지고 있는 하기 표 4의 프라이머를 사용하여 PCR을 실시하여 linear DNA를 확보하였다. 이를 pRedET vector 시스템을 사용하여 넉아웃 하고자 하는 유전자에 카나마이신 유전자를 삽입하면서 본래의 유전자를 파괴하여 넉아웃 균주를 만들었다. 보다 구체적으로, 도 22에 나타낸 바와 같이, 넉아웃 하고자 하는 유전자인 ushA 및 글루코스 해당과정의 유전자인 pgi를 붉은색 X로 표시하였다. UDP-glucose pool을 증가 시키기 위하여 ushA 유전자의 넉아웃 시켰고, NADPH2 pool을 증가 시키기 위하여, 해당과정(glycolysis) 경로의 pgi 유전자를 넉아웃시켰다. 최초의 넉아웃을 하지 않은 MG1655 야생형 균주를 야생형 대장균을 대조군으로 이용하였고상기 실시예 7-2의 스테비오사이드 생산 재조합 대장균에 ushA 유전자의 넉아웃을 유도하였고, ushA 돌연변이 균주의 gDNA를 추출하여 넉아웃 여부를 하기 표 5에 나타낸 프라이머를 이용하여 도 23와 같이 PCR을 수행하여 전기영동하여 확인 하였다. 상기 ushA 돌연변이 균주에 pgi 유전자를 넉아웃 시킨 뒤, 표 6의 프라이머를 이용하여, 도 24에 나타낸 바와 같이, 상기 ushA 돌연변이 균주를 대조군으로 하여, 최종적으로 ushA 및 pgi 넉아웃 된 돌연변이가 제작되었는지 확인하였다. 따라서, ushA 돌연변이 균주 뿐 아니라, ushA 및 pgi 돌연변이 균주를 제작하였다.
Gene Sequence
UshA 5'-F CAAAGAGGTTGCGGCTGAAGGCGGTAGCGTGCTGCTACTTTCCGGTGGCGACATTAACAC AATTAACCCTCACTAAAGGGCGG
5'-R GATAACAGCGAGATCATTTGCTGGTTTTCAGCGATTTCAGGAGTGTAAAGCACGCGCTCG TAATACGACTCACTATAGGGCTC
Pgi 5'-F TGACTGGTTCCTGAAAGCGGCAGGTGATGAAAAACACGTTGCAAAACACTTTGCGGCGCTTTCCACC AATTAACCCTCACTAAAGGGCGG
5'-R CAGCAGTACAGGCAGGTTTTTCTCGGCAGGCGTGGTGGAGAAATGCTTGTCCATCGCGTGTGCGCCG TAATACGACTCACTATAGGGCTC
프라이머 서열
#1 atgaaattat tgcagcgggg
#2 cgagactagt gagacgtgct ac
#3 tatcaggaca tagcgttggc tacc
#4 ttactgccag ctcacctcac
프라이머 서열
#1 atgaaaaaca tcaatccaac
#2 cgagactagt gagacgtgct ac
#3 tatcaggaca tagcgttggc tacc
#4 ttaaccgcgc cacgctttat
실시예 9. 돌연변이 균주에서 스테비오사이드 과생산
상기 실시예 8에서 제작한 ushA 돌연변이 균주; 및 ushA 및 pgi 돌연변이 균주;의 스테비오사이드 생산을 확인하기 위하여, 하기와 같은 실험을 수 행하였다.
실시예 8을 수행하여 만든 넉아웃 균주에 스테비오사이드 생산용 벡터를 발현하여 스테비오사이드를 생산하도록 하고 이에 대한 스테비오사이드의 생산량을 비교분석하기 위해 같은 양의 세포를 가지고 추출하여 그 양을 LCMS-ESI로 분석하였다. 보다 구체적으로, 상기 실시예 5-2의 조건과 동일한 조건으로 LCMS-ESI을 수행하여, ushA 돌연변이 균주; 및 ushA 및 pgi 돌연변이 균주;의 스테비오사이드 생산을 확인하였다. 그 결과를 도 25에 나타내었다.
도 25에 나타낸 바와 같이, ushA 돌연변이 균주; 및 ushA 및 pgi 돌연변이 균주는 스테비오사이드를 생산함을 확인하였으며, 특히, 상기 ushA 및 pgi 돌연변이 균주는 다른 대조군 및 ushA 돌연변이 균주에 비하여 우수하게 스테비오사이드를 과생산함을 확인하였다.
본 발명의 스테비올 배당체 생산용 재조합 미생물은 스테비올모노사이드, 루부소사이드, 스테비올바이오사이드 또는 스테비오사이드를 직접 분리하는 것이 아닌, 미생물에 도입된 재조합 유전자에 의해 대사경로를 조작함으로써, 간단한 공정만으로도 상기 스테비올 배당체를 경제적으로 대량 생산할 수 있어, 천연 감미료 및 음료 등의 식품 산업에 유용하게 이용될 수 있다.

Claims (21)

  1. (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자, 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자를 포함하는 유전자 군; 및
    (b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자 및 서열번호 7로 표시되는 염기서열로 이루어진 UGT74G1(uridine diphospho-glucuronosyltransferase(UGT) 74G1)를 코딩하는 유전자로 이루어진 군에서 선택된 1종 이상의 유전자가 도입된 스테비올 배당체(steviol glycosides) 생산용 재조합 미생물.
  2. 제1항에 있어서,
    상기 미생물은 대장균, 박테리아, 효모 및 곰팡이로 이루어진 군으로부터 선택된 1종 이상인 것을 특징으로 하는, 스테비올 배당체 생산용 재조합 미생물.
  3. 제1항에 있어서, 상기 스테비올 배당체는 스테비올모노사이드(Steviolmonoside) 또는 루부소사이드(rubusoside)인 것을 특징으로 하는, 스테비올 배당체 생산용 재조합 미생물.
  4. 제1항에 있어서, 상기 (a) 의 유전자 군은 도 7의 개열지도를 갖는 벡터에 의해 도입되는 것인, 스테비올 배당체 생산용 재조합 미생물.
  5. 제1항에 있어서, 상기 (b)의 UGT85C2를 코딩하는 유전자는 도 8의 개열지도를 갖는 벡터에 의해 도입되는 것인, 재조합 미생물.
  6. 제1항에 있어서, 상기 (b)의 UGT74G1를 코딩하는 유전자는 도 9의 개열지도를 갖는 벡터에 의해 도입되는 것인, 재조합 미생물.
  7. 제1항에 있어서, 상기 (b)의 UGT85C2를 코딩하는 유전자 및 UGT74G1를 코딩하는 유전자는 도 11의 개열지도를 갖는 벡터에 의해 도입되는 것인, 재조합 미생물.
  8. 제1항에 있어서,
    상기 GGPPS를 코딩하는 유전자는 로도박터 스페로이드(Rhodobacter sphaeroides)에서 유래한 유전자인 것을 특징으로 하는, 스테비올 배당체 생산용 재조합 미생물.
  9. 제1항에 있어서,
    상기 CPPS를 코딩하는 유전자, KS를 코딩하는 유전자, KO를 코딩하는 유전자, KAH를 코딩하는 유전자, UGT85C2을 코딩하는 유전자 및 UGT74G1를 코딩하는 유전자는 스테비아 레바우디아나(Stevia rebaudiana)에서 유래한 유전자인 것을 특징으로 하는, 스테비올 배당체 생산용 재조합 미생물.
  10. (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자; 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자;를 포함하는 유전자 군;
    (b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자; 및
    (c) 서열번호 8로 표시되는 염기서열로 이루어진 UGTx (uridine diphospho-glucuronosyltransferase(UGT) x)를 코딩하는 유전자가 도입된, 스테비올 배당체 생산용 재조합 미생물.
  11. 제10항에 있어서, 상기 스테비올 배당체는 스테비올바이오사이드(steviolbioside)인 것을 특징으로 하는, 스테비올 배당체 생산용 재조합 미생물.
  12. 제10항에 있어서, 상기 (a)의 유전자 군은 도 7의 개열지도를 갖는 벡터에 의해 도입되는 것인, 스테비올 배당체 생산용 재조합 미생물.
  13. 제10항에 있어서, 상기 (b)의 UGT85C2를 코딩하는 유전자는 도 15의 개열지도를 갖는 벡터에 의해 도입되는 것인, 스테비올 배당체 생산용 재조합 미생물.
  14. 제 항에 있어서, 상기 (c)의 UGTx를 코딩하는 유전자는 도 16의 개열지도를 갖는 벡터에 의해 도입되는 것인, 스테비올 배당체 생산용 재조합 미생물.
  15. 제1항에 있어서,
    상기 UGTx를 코딩하는 유전자는 스테비아 레바우디아나(Stevia rebaudiana)에서 유래한 유전자인 것을 특징으로 하는, 스테비올 배당체 생산용 재조합 미생물.
  16. (a) 서열번호 1로 표시되는 염기서열로 이루어진 GGPPS(geranylgeranyl diphosphate synthase, crtE)를 코딩하는 유전자, 서열번호 2로 표시되는 염기서열로 이루어진 CPPS(copalyl diphosphate synthase)를 코딩하는 유전자, 서열번호 3으로 표시되는 염기서열로 이루어진 KS(kaurene synthase)를 코딩하는 유전자, 서열번호 4로 표시되는 염기서열로 이루어진 KO(kaurene oxidase)를 코딩하는 유전자; 서열번호 5로 표시되는 염기서열로 이루어진 KAH(kaurenoic acid hydroxylase)를 코딩하는 유전자; 및
    (b) 서열번호 6으로 표시되는 염기서열로 이루어진 UGT85C2(uridine diphospho-glucuronosyltransferase(UGT) 85C2)를 코딩하는 유전자, 서열번호 7로 표시되는 염기서열로 이루어진 UGT74G1(uridine diphospho-glucuronosyltransferase(UGT) 74G1)를 코딩하는 유전자 및 서열번호 8로 표시되는 염기서열로 이루어진 UGTx(uridine diphospho-glucuronosyltransferase(UGT) x)를 코딩하는 유전자가 도입된, 스테비올 배당체 생산용 재조합 미생물.
  17. 제16항에 있어서, 상기 스테비올 배당체는 스테비오사이드(stevioside)인 것을 특징으로 하는, 스테비올 배당체 생산용 재조합 미생물.
  18. 제16항에 있어서, 상기 (a) 의 유전자 군은 도 7의 개열지도를 갖는 벡터에 의해 도입되는 것인, 스테비올 배당체 생산용 재조합 미생물.
  19. 제16항에 있어서, 상기 (b)의 UGT85C2를 코딩하는 유전자, UGT74G1를 코딩하는 유전자 및 UGTx 코딩하는 유전자는 도 19의 개열지도를 갖는 벡터에 의해 도입되는 것인, 스테비올 배당체 생산용 재조합 미생물.
  20. 제16항의 재조합 미생물에 ushA 유전자(UDP-Sugar Hydrolase Gene) 또는 pgi 유전자(pig phosphoglucose isomerase gene)를 넉아웃(knockout)시켜 돌연변이를 유발시킨, 스테비올 배당체 과생산능을 갖는 돌연변이 미생물.
  21. (1) 제1항, 제10항, 제16항 또는 제20항 중 어느 한 항의 미생물을 배양하는 단계; 및
    (2) 상기 (1) 단계의 미생물의 배양물에서 스테비올 배당체를 분리 및 정제하는 단계;를 포함하는, 스테비올 배당체의 생산 방법.
PCT/KR2016/007527 2016-07-11 2016-07-11 스테비올 배당체 생산용 재조합 미생물 WO2018012644A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
PCT/KR2016/007527 WO2018012644A1 (ko) 2016-07-11 2016-07-11 스테비올 배당체 생산용 재조합 미생물

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/KR2016/007527 WO2018012644A1 (ko) 2016-07-11 2016-07-11 스테비올 배당체 생산용 재조합 미생물

Publications (1)

Publication Number Publication Date
WO2018012644A1 true WO2018012644A1 (ko) 2018-01-18

Family

ID=60953102

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2016/007527 WO2018012644A1 (ko) 2016-07-11 2016-07-11 스테비올 배당체 생산용 재조합 미생물

Country Status (1)

Country Link
WO (1) WO2018012644A1 (ko)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114107242A (zh) * 2021-11-12 2022-03-01 江南大学 一种提高β-环糊精葡萄糖基转移酶可溶性表达量的方法

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080064063A1 (en) * 2006-03-21 2008-03-13 Her Majesty The Queen In Right Of Canada As Repres Compositions and methods for producing steviol and steviol glycosides
KR20140134636A (ko) * 2012-04-19 2014-11-24 아주대학교산학협력단 카우린 생성능을 가지는 재조합 미생물 및 이를 이용한 카우린의 제조 방법
US20150252401A1 (en) * 2012-09-29 2015-09-10 Shanghai Institutes For Biological Sciences Chinese Academyof Sciences Method for producing stevioside compounds by microorganism
KR20160116767A (ko) * 2015-03-31 2016-10-10 아주대학교산학협력단 스테비올바이오사이드 생산능을 가지는 재조합 미생물 및 이를 이용한 스테비올바이오사이드의 생산 방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080064063A1 (en) * 2006-03-21 2008-03-13 Her Majesty The Queen In Right Of Canada As Repres Compositions and methods for producing steviol and steviol glycosides
KR20140134636A (ko) * 2012-04-19 2014-11-24 아주대학교산학협력단 카우린 생성능을 가지는 재조합 미생물 및 이를 이용한 카우린의 제조 방법
US20150252401A1 (en) * 2012-09-29 2015-09-10 Shanghai Institutes For Biological Sciences Chinese Academyof Sciences Method for producing stevioside compounds by microorganism
KR20160116767A (ko) * 2015-03-31 2016-10-10 아주대학교산학협력단 스테비올바이오사이드 생산능을 가지는 재조합 미생물 및 이를 이용한 스테비올바이오사이드의 생산 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BRANDLE, J. E.: "Steviol glycoside biosynthesis", PHYTOCHEMISTRY, vol. 68, 29 March 2007 (2007-03-29), pages 1855 - 1863, XP022145443, ISSN: 0031-9422, DOI: 10.1016/j.phytochem.2007.02.010 *
DATABASE NUCLEOTIDE 28 December 2004 (2004-12-28), RICHMAN ET AL.: "Stevia rebaudiana UDP-glycosyltransferase 91D1 mRNA, complete cds", XP055602297, retrieved from NCBI Database accession no. AY345980 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114107242A (zh) * 2021-11-12 2022-03-01 江南大学 一种提高β-环糊精葡萄糖基转移酶可溶性表达量的方法
CN114107242B (zh) * 2021-11-12 2022-07-05 江南大学 一种提高β-环糊精葡萄糖基转移酶可溶性表达量的方法

Similar Documents

Publication Publication Date Title
KR100838038B1 (ko) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
KR100838035B1 (ko) Ｌ-라이신 생산능이 향상된 코리네박테리움 속 미생물 및그를 이용한 ｌ-라이신 생산 방법
WO2018182345A1 (ko) 타가토스 생산용 조성물 및 이를 이용한 타가토스 제조방법
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
DK1649029T3 (en) PROCEDURE FOR PREPARING A LOW MOLECULAR WEIGHT SECONDARY PLANT METABOLITE IN A YARCELL
WO2014142463A1 (ko) L-발린 생산능이 향상된 균주 및 이를 이용한 l-발린 생산방법
WO2019076941A1 (en) FERMENTATIVE PRODUCTION OF N-ACETYLNEURAMINE ACID
WO2018124440A2 (ko) 신규한 이소프로필말레이트 신타제 변이체 및 이를 이용한 l-류신의 생산 방법
WO2013095071A2 (ko) Ｌ-라이신 생산능을 갖는 미생물을 이용하여 ｌ-라이신을 생산하는 방법
JP2002520067A (ja) グルコサミンを製造するためのプロセス及び物質
Kato et al. A point mutation in ftmD blocks the fumitremorgin biosynthetic pathway in Aspergillus fumigatus strain Af293
WO2019190193A1 (ko) 글라이신 생산능이 증가된 미생물 및 이를 이용한 발효 조성물 생산 방법
WO2017007159A1 (ko) Ｌ-라이신 생산능을 갖는 미생물 및 이를 이용한 ｌ-라이신 생산 방법
WO2012102552A2 (ko) 3,6-안하이드로-ｌ-갈락토오스에 작용하는 신규한 3,6-안하이드로-ｌ-갈락토오스 데히드로게나제와 이 효소를 이용한 3,6-안하이드로 갈락토닉산의 생산
WO2013157887A1 (ko) 카우린, 카우린산 또는 스테비올 생성능을 가지는 재조합 미생물 및 이를 이용한 카우린, 카우린산 또는 스테비올의 제조 방법
WO2018012644A1 (ko) 스테비올 배당체 생산용 재조합 미생물
WO2019132510A2 (ko) 세포 소기관이 변이된 재조합 효모 및 이를 이용한 아이소프레노이드 생산 방법
KR101669041B1 (ko) 스테비오사이드 생산능을 가지는 재조합 미생물 및 이를 이용한 스테비오사이드의 생산 방법
WO2023121427A1 (ko) 당전이 효소 변이체 및 이를 이용한 스테비올 배당체의 제조방법
WO2019190143A1 (ko) β-아가라아제 DagA 효소의 과발현 유도 기술의 개발
WO2021080277A1 (ko) 신규 d-트레오닌 생산 효소 및 이를 이용한 d-트레오닌의 입체특이적 생산 방법
WO2021256703A1 (ko) 데이노잔틴 고생산능을 갖는 변이 균주의 제조방법 및 온도제어를 이용한 데이노잔틴 대량생산 방법
KR101669044B1 (ko) 스테비올바이오사이드 생산능을 가지는 재조합 미생물 및 이를 이용한 스테비올바이오사이드의 생산 방법
JP2008200046A (ja) トレハロースを含まないアミノ酸の製造方法
WO2016182273A1 (ko) 사카로마이세스 세레비지애 효모의 만노스 인산화 활성에 핵심적인 유전자 mnn14 및 그 결손 변이주를 활용한 재조합 당단백질 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16908908

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16908908

Country of ref document: EP

Kind code of ref document: A1