WO2023121328A1 - 신규 면역 억제 인터루킨 2 (interleukin 2) 아날로그 - Google Patents

신규 면역 억제 인터루킨 2 (interleukin 2) 아날로그 Download PDF

Info

Publication number
WO2023121328A1
WO2023121328A1 PCT/KR2022/021040 KR2022021040W WO2023121328A1 WO 2023121328 A1 WO2023121328 A1 WO 2023121328A1 KR 2022021040 W KR2022021040 W KR 2022021040W WO 2023121328 A1 WO2023121328 A1 WO 2023121328A1
Authority
WO
WIPO (PCT)
Prior art keywords
interleukin
amino acid
analog
amino acids
native
Prior art date
Application number
PCT/KR2022/021040
Other languages
English (en)
French (fr)
Inventor
오의림
신승현
박다현
임창규
김진영
박초롱
최재혁
허용호
Original Assignee
한미약품 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한미약품 주식회사 filed Critical 한미약품 주식회사
Publication of WO2023121328A1 publication Critical patent/WO2023121328A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/55—IL-2

Definitions

  • the present invention relates to novel interleukin 2 analogs.
  • Interleukin 2 is an important immune stimulant with a molecular weight of about 15 kDa consisting of a total of 133 amino acid residues, and activates various cells of the immune system, including T cells and B cells.
  • the high efficacy of interleukin 2 as an immune stimulant can be used to treat various immune-related diseases including cancer and AIDS (Korean Patent Publication No. 10-2017-0070091).
  • interleukin 2 (trade name Proleukin®) is an FDA-approved drug for the treatment of metastatic renal cell carcinoma and metastatic melanoma.
  • interleukin 2 because of the severe toxicity associated with high-dose interleukin 2 therapy, the number of applicable patients is limited, and only a small number of patients who are actually suitable for this therapy are receiving this therapy. Toxicities associated with interleukin 2 include severe fever, nausea and vomiting, vascular leak syndrome, severe hypotension, pulmonary edema, and vascular leak syndrome causing liver damage.
  • the interleukin 2 receptor has three subunit receptors. Its subunit consists of an alpha chain (IL-2R ⁇ , CD25), a beta chain (IL-2R ⁇ or CD122), and a gamma chain (IL-2R ⁇ or CD132), and interleukin 2 binds to various combinations of receptor subunits to achieve various function can be exerted.
  • a single interleukin 2 alpha receptor is called the low affinity interleukin 2 receptor and is not involved in signal transduction.
  • a complex of interleukin 2 beta and gamma receptors bind interleukin 2 with moderate affinity.
  • a complex of interleukin 2 alpha, beta and gamma receptors bind interleukin 2 with high affinity.
  • complexes of high-affinity interleukin 2 alpha, beta, and gamma receptors are usually found on recently activated T cells as well as CD4 + T regulatory cells (Tregs).
  • One object of the present invention is to provide an interleukin 2 analog.
  • Another object of the present invention is an isolated nucleic acid encoding the interleukin 2 analog; a recombinant expression vector comprising the nucleic acid; And to provide a transformant comprising the vector.
  • Another object of the present invention is to provide a method for preparing the interleukin 2 analog.
  • Another object of the present invention is to provide a method for increasing interleukin 2 alpha receptor binding ability, comprising mutating one or more amino acids in native interleukin 2.
  • the interleukin 2 analog according to the present invention is an analog with increased binding ability to the living body interleukin 2 alpha receptor, and can be used for various purposes.
  • One aspect of the present invention is a novel interleukin 2 analog (or IL-2 analog).
  • the interleukin 2 analog is an interleukin 2 analog with increased binding ability to an interleukin 2 alpha receptor compared to native interleukin 2 or interleukin 2 analog aldesleukin.
  • the interleukin 2 analog may include a sequence in which one or more amino acids are mutated from native interleukin 2.
  • the interleukin 2 analog according to any one of the preceding embodiments is located at positions 1, 19, 20, 42, 61, 68, 69, 91, 125, 126 and 130 in native interleukin 2. Characterized in that one or more amino acids among the amino acids corresponding to comprise a mutated sequence.
  • interleukin 2 analog according to any one of the preceding embodiments is characterized in that it comprises an amino acid sequence represented by the following general formula 1:
  • X1 is the fruit
  • X19 is leucine (L), or valine (V);
  • X20 is phenylalanine (F), or aspartic acid (D);
  • X42 is phenylalanine (F), or tryptophan (W);
  • X61 is aspartic acid (D) or glutamic acid (E);
  • X68 is aspartic acid (D);
  • X69 is valine (V), or glycine (G);
  • X91 is valine (V), or threonine (T);
  • X126 is glutamine (Q) or threonine (T);
  • X130 is serine (S) or arginine (R).
  • the interleukin 2 analog according to any one of the above embodiments is characterized by comprising any one of the amino acid sequences of SEQ ID NOs: 3 to 9.
  • the interleukin 2 analog according to any one of the above embodiments is characterized by comprising any one of the amino acid sequences of SEQ ID NOs: 3 to 8.
  • the mutation is a group consisting of substitution, addition, deletion, modification, and combinations of one or more amino acids of native interleukin 2. It is characterized in that selected from.
  • amino acid No. 1 of native interleukin 2 is mutated, or amino acid No. 19, No. 20, No. 42, No. 61, No. 68, No. 69, No. 91, No. 125, No. 126
  • amino acids selected from the group consisting of amino acids 130 are mutated to other amino acids.
  • interleukin 2 analog according to any one of the preceding embodiments is characterized in that any one of the following analogs:
  • interleukin 2 analog according to any one of the preceding embodiments is characterized in that any one of the following analogs:
  • interleukin 2 analog according to any one of the preceding embodiments is characterized in that any one of the following analogs:
  • the interleukin 2 analog according to any one of the above embodiments is characterized in that the binding ability of the interleukin 2 alpha receptor is increased by 500% or more compared to aldesleukin.
  • interleukin 2 analog according to any one of the preceding embodiments is characterized by further including one or more amino acids at the C-terminus.
  • Another aspect for implementing the present invention is an isolated nucleic acid encoding the interleukin 2 analog; a recombinant expression vector comprising said nucleic acid; A transformant containing the vector.
  • Another aspect for implementing the present invention is a method for preparing the interleukin 2 analog.
  • Another aspect for implementing the present invention is a method for increasing interleukin 2 alpha receptor binding ability, comprising mutating one or more amino acids in native interleukin 2.
  • the mutation corresponds to positions 1, 19, 20, 42, 61, 68, 69, 91, 125, 126 and 130 in native interleukin 2. Characterized in that one or more amino acids among the amino acids are mutated.
  • the mutation is mutation of natural interleukin 2, or 19 times, 20 times, 42 times, 61 times, 68 times, 69 times, 91 times, 125 times, 126 times and 130 times. It is characterized in that one or more amino acids selected from the group consisting of amino acids are mutated into other amino acids.
  • Another aspect for implementing the present invention is an interleukin 2 analog comprising any one sequence selected from the group consisting of the amino acid sequences of SEQ ID NOs: 3 to 9.
  • the interleukin 2 analog of the present invention is characterized in that its binding ability to the interleukin 2 receptor is changed compared to native interleukin 2 or known aldesleukin, and in particular, its binding ability to the interleukin 2 alpha receptor is increased compared to aldesleukin.
  • the interleukin 2 analog of the present invention may have increased binding ability to the interleukin 2 alpha receptor compared to native interleukin 2 or known aldesleukin, and more specifically, to the interleukin 2 alpha receptor compared to aldesleukin. It may be that the binding force is increased.
  • interleukin 2 refers to a type of cytokine that transmits signals in the immune system in vivo and refers to an immune modulator.
  • Interleukin 2 is generally known as an important immune stimulant of about 15 kDa.
  • interleukin 2 analog refers to one or more amino acids mutated in the natural sequence. This may be a mutated interleukin 2 analog. Specifically, the interleukin 2 analog of the present invention may be non-naturally occurring.
  • the native interleukin 2 may be human interleukin 2, and its sequence can be obtained from a known database or the like. Specifically, it may be the amino acid sequence of SEQ ID NO: 1, but is not limited thereto.
  • wild-type interleukin 2 may be the amino acid sequence of SEQ ID NO: 1
  • SEQ ID NO: 1 means not only the same sequence as SEQ ID NO: 1, but also 80%, 85%, 90%, 91%, 92% homology to SEQ ID NO: 1, Sequences of 93%, 94%, 95%, 96%, 97%, 98%, 99% or more also belong to the scope of wild-type interleukin 2 of the present invention, and the amino acid mutation position is different based on SEQ ID NO: 1 Amino acids of SEQ ID NO: 1 when 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequences of homology are aligned It means that the corresponding position on the sequence is mutated.
  • mutation of one or more amino acids in the wild-type sequence is composed of substitution, addition, deletion, modification, and combinations thereof to at least one amino acid in wild-type interleukin 2.
  • a variant selected from the group may have occurred.
  • the interleukin 2 analog of the present invention corresponds to positions 1, 19, 20, 42, 61, 68, 69, 91, 125, 126 and 130 in native interleukin 2. It may include a sequence in which one or more of the amino acids are mutated, and specifically, amino acid number 1 in natural interleukin 2 is mutated, or amino acid number 19, 20, 42, 61, 68, 69 , At least one of the amino acids corresponding to positions 91, 125, 126, and 130 may include a mutated sequence. More specifically, the interleukin 2 analog of the present invention includes amino acid number 1 removed from native interleukin 2, amino acid number 125 replaced with another amino acid, and additionally one, two, three, or more amino acid substitutions.
  • cysteine which is amino acid number 125
  • amino acids where additional substitution occurs are amino acids 19, 20, 42, 61, 68, 69, 91, 126 and It may be an amino acid corresponding to position 130, but is not limited thereto.
  • interleukin 2 analogs including substitution, addition, deletion, modification, etc. of amino acid residues known in the art and to the extent that can be performed to increase the stability and half-life of peptides in addition to the above mutation sites are also included in the scope of the present invention. .
  • aldesleukin or “interleukin 2 analog (aldesleukin)” is a commercially available interleukin 2 analog, and may be aldesleukin (trade name: Proleukin®), specifically, of SEQ ID NO: 2 It may have an amino acid sequence. In the present invention, it is used in combination with “interleukin 2 analog 1”.
  • the interleukin analog according to the present invention may have increased binding ability to the interleukin 2 alpha receptor compared to the interleukin 2 analog 1.
  • interleukin 2 alpha receptor is not known to be involved in the signal transduction system of interleukin 2, it increases the binding force of interleukin 2 with other interleukin 2 receptors (beta or gamma) by 10 to 100 times, and is expressed in CD4 + regulatory T cells. there is.
  • the differentiation inhibitory effect of CD8 + T cells can be increased to effectively suppress the immune response, thereby increasing the treatment effect of immune diseases.
  • the effect of reducing side effects can be expected.
  • the interleukin 2 analog may include a sequence in which amino acid No. 1 of natural interleukin 2 is removed and amino acid No. 125 is substituted with another amino acid, and further include two or three amino acid mutations.
  • amino acid position 125 is substituted with serine, and one or more amino acids among positions 19, 20, 42, 61, 68, 69, 91, 126 and 130 are further substituted with another amino acid.
  • it may include a sequence in which one or more amino acids are added to amino acid position 133, but is not limited thereto, and an interleukin 2 analog having increased interleukin 2 alpha receptor binding ability compared to native interleukin 2 and/or aldesleukin is not limited thereto. included in the scope of the present invention.
  • the added amino acid has increased interleukin 2 alpha receptor binding ability compared to native interleukin 2 or aldesleukin, and specifically, as long as the interleukin 2 alpha receptor binding ability is increased compared to aldesleukin, its type
  • the length There is no limit to the length, and in addition to natural amino acids, non-natural amino acids and amino acids including chemical modifications may be added.
  • Amino acids at positions 19, 20, 42, 61, 68, 69, 91, 126, and 130 in native interleukin are involved in the binding of interleukin 2 to the interleukin 2 alpha receptor.
  • the interleukin 2 analog may include, but is not limited to, an amino acid sequence represented by Formula 1 below: X1-PTSSSTKKTQLQLEHLL-X19-X20-LQMILNGINNYKNPKLTRMLT-X42-KFYMPKKATELKHLQCLE-X61-ELKPLE -X68-X69-LNLAQSKNFHLRPRDLISNIN-X91-IVLELKGSETTFMCEYADETATIVEFLNRWITFS-X126-SII-X130-TLT (Formula 1, SEQ ID NO: 38)
  • X1 is the fruit
  • X19 is leucine (L), or valine (V);
  • X20 is phenylalanine (F), or aspartic acid (D);
  • X42 is phenylalanine (F), or tryptophan (W);
  • X61 is aspartic acid (D) or glutamic acid (E);
  • X68 is aspartic acid (D);
  • X69 is valine (V), or glycine (G);
  • X91 is valine (V) or threonine (T);
  • X126 is glutamine (Q) or threonine (T);
  • X130 is serine (S) or arginine (R).
  • one or more amino acids may be added to threonine (T) corresponding to X133 in Formula 1, but is not limited thereto.
  • the interleukin 2 analog of the present invention is an interleukin 2 analog with increased binding ability to interleukin 2 alpha receptor compared to native interleukin 2 or known aldesleukin. there is. Specifically, the interleukin 2 analog may have increased interleukin 2 alpha receptor binding ability compared to aldesleukin, but is not limited thereto.
  • the interleukin 2 analog may include a sequence in which amino acid No. 1 of wild-type interleukin 2 is removed and amino acid No. 125 is substituted with another amino acid, or may include substitution of additional amino acids. Substitution of the additional amino acid may occur at one or more of positions X19, X20, X42, X61, X68, X69, X91, X126 and X130, but is not limited thereto.
  • the interleukin 2 analog may be one in which glutamic acid (E) at position X68 is substituted with aspartic acid (D) compared to native interleukin 2 or known aldesleukin, but is not limited thereto.
  • the interleukin 2 analog may be any one selected from the group consisting of the following analogs:
  • the interleukin 2 analog may be any one selected from the group consisting of the following analogs:
  • amino acid substitution included in the interleukin 2 analog may be one or more selected from the group consisting of the following amino acid substitutions:
  • amino acid position 19 is substituted with valine;
  • amino acid 20 is substituted with phenylalanine;
  • amino acid position 42 is substituted with tryptophan;
  • amino acid position 61 is substituted with aspartic acid;
  • amino acid position 68 is substituted with aspartic acid;
  • amino acid position 69 is substituted with glycine;
  • amino acid position 91 is substituted with threonine;
  • amino acid position 126 is substituted with threonine; and
  • substitution of amino acid 130 with arginine substitution of amino acid 130 with arginine.
  • substitution may be (j) amino acid 68 is substituted with aspartic acid and amino acid 69 is substituted with glycine, or (k) amino acid 126 is substituted with threonine and amino acid 130 is substituted with arginine It may be, but is not limited thereto.
  • the interleukin 2 analog may be any one selected from the group consisting of the following analogs:
  • the term “corresponding to” refers to an amino acid residue at a recited position in a peptide, or an amino acid residue similar to, identical to, or homologous to a recited residue in a peptide. Identification of the amino acid at the corresponding position may be determining the specific amino acid in the sequence that references the specific sequence.
  • any amino acid sequence can be aligned with SEQ ID NO: 1, and based on this, each amino acid residue of the amino acid sequence can be numbered with reference to the numerical position of the amino acid residue corresponding to the amino acid residue of SEQ ID NO: 1. .
  • Such alignments include, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needle program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. , 2000), Trends Genet. 16: 276-277) may be used, but it is not limited thereto, and a sequence alignment program known in the art, a pairwise sequence comparison algorithm, and the like may be appropriately used.
  • the interleukin 2 analog may include, consist essentially of, or consist of an amino acid sequence selected from the group consisting of SEQ ID NOs: 3 to 9, but is not limited thereto.
  • Interleukin 2 analogs of the present invention are 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83 %, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% It may include an amino acid sequence having the above homology or identity, but is not limited thereto.
  • the term 'homology' or 'identity' refers to the degree to which two given amino acid sequences or base sequences are related to each other and can be expressed as a percentage.
  • Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard alignment algorithms, together with default gap penalties established by the program used. Substantially homologous or identical sequences are generally capable of hybridizing with all or part of the sequence under moderate or high stringent conditions. It is obvious that hybridization also includes hybridization with polynucleotides containing common codons or codons in consideration of codon degeneracy in polynucleotides.
  • GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215] : 403 (1990);Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego, 1994, and [CARILLO ETA/.] (1988) SIAM J Applied Math 48: 1073) Homology, similarity or identity can be determined using, for example, BLAST of the National Center for Biotechnology Information Database, or ClustalW.
  • GAP program defines the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values of 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp.
  • the interleukin 2 analog of the present invention can be used as a novel substitute for interleukin 2 by increasing the binding force of interleukin 2 with the alpha receptor.
  • the activation effect of CD4 + regulatory T cells is increased, and the differentiation of CD8 + T cells is inhibited, thereby effectively suppressing the immune response.
  • modifications for preparation of analogues of interleukin 2 include modifications using L-type or D-type amino acids, and/or non-natural amino acids; and/or modification of the native sequence, e.g., modification of side chain functional groups, intramolecular covalent linkages such as inter-side chain ring formation, methylation, acylation, ubiquitination, phosphorylation, aminohexaylation, biotinylation, etc. including all that
  • the substituted or added amino acids may be 20 amino acids commonly observed in human proteins as well as atypical or non-naturally occurring amino acids.
  • Commercial sources of atypical amino acids include Sigma-Aldrich, ChemPep and Genzyme pharmaceuticals. Peptides containing these amino acids and typical peptide sequences can be synthesized and purchased through commercialized peptide synthesis companies, such as American Peptide Company or Bachem in the US or Anygen in Korea.
  • Amino acid derivatives can also be obtained in the same way, and examples thereof include 4-imidazoacetic acid and the like.
  • interleukin 2 analog according to the present invention is chemically modified at its N-terminus and/or C-terminus, protected with an organic group, or peptide terminus, etc. It may be in a modified form by adding amino acids.
  • the N-terminus is acetylated and/or the C-terminus is amidated to remove these charges. It may be, but is not particularly limited thereto.
  • the interleukin 2 analog according to the present invention is in the form of a peptide, it includes all forms of the peptide itself, a salt thereof (eg, a pharmaceutically acceptable salt of the peptide), or a solvate thereof.
  • the peptide may be in any pharmaceutically acceptable form.
  • the type of salt is not particularly limited. However, it is preferably in a form that is safe and effective for an individual, such as a mammal, but is not particularly limited thereto.
  • pharmaceutically acceptable refers to a substance that can be effectively used for a desired purpose without causing excessive toxicity, irritation, or allergic reaction within the scope of medical or pharmaceutical judgment.
  • the term "pharmaceutically acceptable salt” includes salts derived from pharmaceutically acceptable inorganic acids, organic acids, or bases.
  • suitable acids include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, perchloric acid, fumaric acid, maleic acid, phosphoric acid, glycolic acid, lactic acid, salicylic acid, succinic acid, toluene-P-sulfonic acid, tartaric acid, acetic acid, citric acid, methanesulfonic acid, formic acid.
  • Salts derived from suitable bases may include alkali metals such as sodium and potassium, alkaline earth metals such as magnesium, and ammonium.
  • solvate used in the present invention refers to the formation of a complex between the peptide or its salt according to the present invention and solvent molecules.
  • the binding ability of any interleukin 2 analog to the native interleukin 2 receptor can be measured using various known techniques as a method of measuring affinity for the receptor.
  • SPR surface plasmon resonance
  • Example 5 Example 5 in detail, but is not limited thereto.
  • the interleukin 2 analog of the present invention may have increased binding ability to the interleukin 2 alpha receptor compared to native interleukin 2 or aldesleukin.
  • the interleukin 2 analog of the present invention is about 1.1 times or more, about 1.2 times or more, about 1.5 times or more, about 2 times or more, about 3 times or more, about 4 times or more than the interleukin 2 alpha receptor binding ability of aldesleukin. Or more, about 5 times or more, about 6 times or more, about 7 times or more, about 8 times or more, or more, but may have an interleukin 2 alpha receptor binding ability, but the number is not limited and the binding ability is natural interleukin 2 or aldehyde. If it is increased compared to Thrukin, it belongs to the scope of the present invention.
  • the interleukin 2 analog of the present invention has about 100% or more, about 150% or more, about 200% or more, about 300% or more, about 400% or more. , It may have a binding force of about 500% or more, about 600% or more, about 700% or more, about 800% or more, or more, but the value is not limited, and if the binding force is increased compared to aldesleukin, of the present invention belong to the category
  • the interleukin 2 analog of the present invention may exhibit an affinity of about 500% or more based on the binding ability of aldesleukin to the interleukin 2 alpha receptor (100%), and for example, the amino acid sequences of SEQ ID NOs: 3 to 8 It may include, but is not limited thereto.
  • the term "about” is a range including ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc., and includes all numerical values in a range equivalent to or similar to the numerical value following the term about, but, therefore, Not limited.
  • the interleukin 2 analog of the present invention is characterized in that its binding ability to the interleukin 2 alpha receptor is increased compared to native interleukin 2 or aldesleukin, and more specifically, to the interleukin 2 alpha receptor compared to aldesleukin. .
  • interleukin 2 analog of the present invention in order to prepare the interleukin 2 analog of the present invention, a mutated interleukin 2 analog was prepared based on native interleukin 2 (SEQ ID NO: 1).
  • the interleukin 2 analog prepared in the present invention may include the amino acid sequence of any one of SEQ ID NOs: 3 to 9, or may be encoded by any one of the nucleotide sequences of SEQ ID NOs: 11 to 17.
  • nucleic acid polynucleotide
  • a recombinant expression vector containing the nucleic acid
  • a transformant containing the nucleic acid or the recombinant expression vector
  • the nucleic acid encoding the interleukin 2 analog of the present invention is modified to introduce a mutation (amino acid deletion, substitution, and/or addition) to an amino acid at a specific position in the nucleotide sequence encoding native interleukin 2 of SEQ ID NO: 1. and, specifically, may include a nucleotide sequence encoding any one amino acid sequence of SEQ ID NOs: 3 to 9. As an example, the nucleic acid of the present invention may have or include any one of SEQ ID NOs: 11 to 17.
  • the nucleotide sequence of the present invention is a coding region within a range that does not change the amino acid sequence of the interleukin 2 analog of the present invention, considering codon degeneracy or codons preferred in organisms intended to express the nucleic acid of the present invention.
  • the nucleic acid of the present invention has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 96% homology or identity with any one of SEQ ID NOs: 11 to 17.
  • nucleotide sequence or more than 97%, more than 98%, and less than 100% of the nucleotide sequence, or having at least 70% homology or identity with any one of the sequences of SEQ ID NOs: 11 to 17, 75% or more, 80 % or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and may consist essentially of, or consist essentially of, a base sequence that is less than 100%, but is not limited thereto.
  • nucleic acid of the present invention can be included without limitation as long as it is a probe that can be prepared from a known gene sequence, for example, a sequence that can hybridize under stringent conditions with a sequence complementary to all or part of the nucleic acid sequence of the present invention.
  • stringent condition means a condition that allows specific hybridization between polynucleotides. These conditions are described in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8).
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases are possible depending on the stringency of hybridization.
  • complementary is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine.
  • the nucleic acids of the present invention may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments complementary to the entire sequence.
  • Appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementarity, parameters well known in the art (e.g., J. Sambrook et al., supra).
  • the recombinant vector according to the present invention may typically be constructed as a vector for cloning or as a vector for expression, and may be constructed as a vector for using prokaryotic or eukaryotic cells as host cells.
  • vector is a recombinant vector capable of expressing a target protein in a suitable host cell, and refers to a nucleic acid construct including essential regulatory elements operably linked to express a nucleic acid insert.
  • the present invention can prepare a recombinant vector containing a nucleic acid encoding an interleukin 2 analog.
  • the recombinant vector can be transformed or transfected into a host cell to obtain the interleukin 2 analog of the present invention.
  • Transformation as used in the present invention is to introduce DNA into a host cell so that the DNA can be replicated as a chromosome factor or by completion of chromosomal integration, and artificially genetically It means something that causes change.
  • a host suitable for the present invention is not particularly limited as long as it expresses the nucleic acid of the present invention.
  • Specific examples of the host that can be used in the present invention include Escherichia genus bacteria such as Escherichia coli ( E. coli ); Bacteria of the genus Bacillus, such as Bacillus subtilis ; bacteria of the genus Pseudomonas, such as Pseudomonas putida ; Yeasts such as Pichia pastoris, Saccharomyces cerevisiae , and Schizosaccharomyces pombe ; insect cells such as Spodoptera frugiperda (Sf9); and animal cells such as CHO, COS, and BSC.
  • Escherichia genus bacteria such as Escherichia coli ( E. coli )
  • Bacteria of the genus Bacillus such as Bacillus subtilis
  • Another aspect for implementing the present invention provides a method for preparing an interleukin 2 analog containing one or more amino acid mutations.
  • the method consists of amino acids corresponding to positions 1, 19, 20, 42, 61, 68, 69, 91, 125, 126 and 130 in native interleukin 2. It may include introducing a mutation in one or more amino acids selected from the group.
  • amino acid No. 1 of native interleukin 2 is removed, and positions 19, 20, 42, 61, 68, 69, 91, 125, 126, and 130 are removed. It may include introducing mutations in one or more amino acids selected from the group consisting of amino acids corresponding to .
  • Amino acid No. 1 of native interleukin 2 may be removed, and amino acids No. 125, No. 42, and No. 68 may be substituted with other amino acids, but is not limited thereto.
  • amino acid No. 1 of native interleukin 2 is removed, amino acid No. 125 is replaced with serine, amino acid No. 68 is replaced with aspartic acid, amino acid No. 126 is replaced with threonine, and amino acid No. 130 is replaced with arginine;
  • amino acid No. 1 of native interleukin 2 is removed, amino acid No. 125 is replaced with serine, amino acid No. 68 is replaced with aspartic acid, and amino acid No. 69 is replaced with glycine;
  • amino acid No. 1 of native interleukin 2 is removed, amino acid No. 125 is substituted with serine, amino acid No. 68 is replaced with aspartic acid, and amino acid No. 91 is substituted with threonine;
  • Amino acid No. 1 of native interleukin 2 may be removed, amino acid No. 125 with serine, amino acid No. 42 with tryptophan, and amino acid No. 68 with aspartic acid may be substituted, but is not limited thereto.
  • the interleukin 2 analog prepared by the method of the present invention may have increased binding ability to the interleukin 2 receptor compared to aldesleukin.
  • Interleukin 2 analogues, mutations, and increases in avidity are as described above.
  • the method for preparing an interleukin 2 analog includes a) culturing a transformant containing a nucleic acid encoding the interleukin 2 analog to express the interleukin 2 analog; and b) isolating and purifying the expressed interleukin 2 analog, but is not limited to a specific method and may be a method known in the art as long as the interleukin 2 analog can be prepared.
  • the nucleic acid encoding the interleukin 2 analog may include or (essentially) consist of any one of SEQ ID NOs: 11 to 17, but is not limited thereto.
  • the medium used for culturing the transformants must meet the requirements of host cell culture in an appropriate manner.
  • the carbon source that can be included in the medium for the growth of the host cell can be appropriately selected by the judgment of a person skilled in the art according to the type of the prepared transformant, and appropriate culture conditions can be adopted to control the culture time and amount. .
  • Sugar sources that can be used include sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch and cellulose, oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, These include fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture.
  • sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch and cellulose
  • oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, palmitic acid, stearic acid, These include fatty acids such as linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid. These materials may be used individually or as a mixture.
  • Nitrogen sources that can be used include peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal and urea or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate. Nitrogen sources may also be used individually or as a mixture.
  • the culture medium may contain metal salts such as magnesium sulfate or iron sulfate necessary for growth.
  • essential growth substances such as amino acids and vitamins may be used in addition to the above substances.
  • precursors suitable for the culture medium may be used.
  • the above-mentioned raw materials may be added in a batchwise or continuous manner during cultivation by a method suitable for the culture.
  • Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, or acid compounds such as phosphoric acid or sulfuric acid can be used in an appropriate manner to adjust the pH of the culture.
  • antifoaming agents such as fatty acid polyglycol esters may be used to suppress foam formation. Oxygen or an oxygen-containing gas (eg air) is injected into the culture to maintain aerobic conditions.
  • Cultivation of the transformant according to the present invention is usually carried out at a temperature of 20 ° C to 45 ° C, specifically 25 ° C to 40 ° C.
  • the culture is continued until the maximum production amount of the desired interleukin 2 analog is obtained, and for this purpose, the culture may be continued for 10 to 160 hours.
  • the transformant according to the present invention produces an interleukin 2 analog, and the interleukin 2 analog produced according to the composition of the vector and the characteristics of the host cell is produced in the cytoplasm of the host cell. It can be secreted internally, into the periplasmic space, or extracellularly.
  • Proteins expressed in or outside the host cell can be purified in a conventional manner.
  • purification methods include salting out (eg, ammonium sulfate precipitation, sodium phosphate precipitation, etc.), solvent precipitation (eg, protein fraction precipitation using acetone, ethanol, etc.), dialysis, gel filtration, ion exchange, reverse phase column chromatography, and the like. Techniques such as chromatography and ultrafiltration may be applied alone or in combination.
  • the following steps may be additionally included to isolate and purify the interleukin 2 analog expressed in the form of an inclusion body from a transformant:
  • step b-1 harvesting and disrupting transformants from the culture solution of step a);
  • Another aspect for implementing the present invention provides a method for preparing the interleukin 2 analog by a peptide synthesis method. Since the interleukin 2 analog sequence of the present invention is provided, such a peptide synthesis can be prepared without limitation using a known peptide synthesis method.
  • Interleukin 2 analogs and mutations are as described above.
  • Another aspect for implementing the present invention is a method for increasing interleukin 2 alpha receptor binding ability, comprising mutating one or more amino acids in native interleukin 2.
  • One specific aspect of the present invention is a method for increasing the binding ability to the interleukin 2 alpha receptor by mutating one or more amino acids in native interleukin 2.
  • the method for increasing interleukin 2 alpha receptor binding ability may increase the binding ability to interleukin 2 alpha receptor compared to native interleukin 2 or aldesleukin.
  • the binding ability of interleukin 2 analog to interleukin 2 alpha receptor is about 100% or more, 200% or more, 300% or more, 400% or more, 500% or more, 600% or more, 700% or more, 800% or more compared to aldesleukin. % or more, or may increase more than that, but is not limited thereto.
  • the method is one of amino acids corresponding to positions 1, 19, 20, 42, 61, 68, 69, 91, 125, 126, and 130 in native interleukin 2. It may include the step of introducing mutations to the above amino acids.
  • amino acid No. 1 of native interleukin 2 is removed, and positions 19, 20, 42, 61, 68, 69, 91, 125, 126, and 130 are removed. It may include introducing mutations in one or more amino acids selected from the group consisting of amino acids corresponding to .
  • Amino acid No. 1 of native interleukin 2 may be removed, and amino acids No. 125, No. 42, and No. 68 may be substituted with other amino acids, but is not limited thereto.
  • amino acid No. 1 of native interleukin 2 is removed, amino acid No. 125 is replaced with serine, amino acid No. 68 is replaced with aspartic acid, amino acid No. 126 is replaced with threonine, and amino acid No. 130 is replaced with arginine;
  • amino acid No. 1 of native interleukin 2 is removed, amino acid No. 125 is replaced with serine, amino acid No. 68 is replaced with aspartic acid, and amino acid No. 69 is replaced with glycine;
  • amino acid No. 1 of native interleukin 2 is removed, amino acid No. 125 is substituted with serine, amino acid No. 68 is replaced with aspartic acid, and amino acid No. 91 is substituted with threonine;
  • Amino acid No. 1 of native interleukin 2 may be removed, amino acid No. 125 with serine, amino acid No. 42 with tryptophan, and amino acid No. 68 with aspartic acid may be substituted, but is not limited thereto.
  • Interleukin 2 analogues, mutations, and increases in avidity are as described above.
  • Another aspect for implementing the present invention provides an interleukin 2 analog comprising any one sequence selected from the group consisting of the amino acid sequences of SEQ ID NOs: 3 to 9.
  • the interleukin 2 analog may include, consist essentially of, or consist of any one sequence selected from the group consisting of the amino acid sequences of SEQ ID NOs: 3 to 9, but is not limited thereto.
  • Example 1 Construction of wild-type interleukin 2 and interleukin 2 analog expression vectors
  • IL-2 synthesized based on the reported interleukin 2 sequence (NM_000586.3) was cloned into a pET-22b vector (Novagen).
  • a novel interleukin 2 analog was prepared by modifying the amino acid of interleukin 2 using the interleukin 2 as a template.
  • Table 1 shows the change sequence and analog name of each amino acid.
  • F forward
  • R reverse
  • the primer sequences in Table 2 represent forward and reverse primers, respectively, for sequencing of analogs shown in Table 1. Sequences were obtained by repeatedly performing mutegenesis PCR using corresponding mutant sequence primers for each analog. Bold text in Table 2 below indicates mutation positions.
  • delA1 means that alanine, the first amino acid of interleukin 2, is deleted.
  • PCR conditions for interleukin 2 analog amplification were 95°C for 30 seconds, 55°C for 60 seconds, and 65°C for 6.5 minutes, and this process was repeated 16 times.
  • the mutagenesis product obtained under the above conditions was subjected to sequence analysis, and it was confirmed that each interleukin 2 analogue was substituted with the mutated sequence at the desired mutated position.
  • Expression vectors thus obtained were named pET22b-interleukin 2 analogs 1 to 8.
  • Table 3 below shows the DNA sequences and protein sequences of each of the interleukin 2 analogues 1 to 8. Bold text in Table 3 below indicates mutation positions.
  • each recombinant interleukin 2 analog expression vector was transformed into an E. coli strain, E. coli BL21DE3 ( E. coli B F-dcm ompT hsdS(rB-mB-) gal ⁇ (DE3); Novagen).
  • E. coli BL21DE3 E. coli B F-dcm ompT hsdS(rB-mB-) gal ⁇ (DE3); Novagen.
  • a transformation method a method recommended by Novagen was used.
  • Each single colony transformed with each recombinant expression vector was taken, inoculated into 2X Luria Broth medium containing ampicillin (50 ⁇ g/ml), and incubated at 37° C. for 15 hours.
  • the recombinant strain culture medium and 2X LB medium containing 30% glycerol were mixed at a ratio of 1:1 (v/v), each 1 ml was dispensed into a cryo-tube, and stored at -150°C. This was used as a cell stock for the production of recombinant proteins.
  • Fermentation proceeded with fed-batch culture by adding an additional medium (feeding solution) when nutrients in the culture medium were limited.
  • the growth of the strain was observed by absorbance, and IPTG at a final concentration of 500 ⁇ M was introduced at an absorbance value of 70 or more.
  • the culture was further progressed until about 23 to 25 hours after the introduction of IPTG, and after the end of the culture, the recombinant strain was harvested using a centrifuge and stored at -80 ° C until use.
  • the supernatant was discarded by centrifugation at 13,900 g for 30 minutes, and the pellet was washed with 400 mL of the first wash buffer solution (50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0). The supernatant was discarded by centrifugation under the same conditions as above, and the pellet was washed with 400 mL of the second washing buffer solution (50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0, 2% Triton X-100).
  • the first wash buffer solution 50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0
  • the second washing buffer solution 50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0, 2% Triton X-100.
  • the supernatant was discarded by centrifugation under the same conditions as above, and the pellet was washed with 400 mL of the third washing buffer solution (50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0, 1% sodium deoxycholorate). The supernatant was discarded by centrifugation under the same conditions as above, and the pellet was washed with 400 mL of the fourth washing buffer solution (50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0, 1 M NaCl). Washed E. coli inclusion body pellets were obtained by centrifugation under the same conditions as above.
  • the washed inclusion body pellet was resuspended in 400 mL of soluble/reducing buffer (6 M Guanidine, 100 mM Tris pH 8.0, 2 mM EDTA pH 9.0, 50 mM DTT) and stirred at 50°C for 30 minutes.
  • 100 mL of distilled water was added to the soluble/reduced interleukin 2 analog to dilute 6 M Guanidine with 4.8 M Guanidine, and then centrifuged at 13,900 g for 30 minutes to discard the pellet and obtain only the solution.
  • 185.7 mL of distilled water was additionally added to the diluted solution to dilute 4.8 M Guanidine with 3.5 M Guanidine, and the pH was adjusted to 5.0 using 100% acetic acid.
  • the pH-adjusted solution was stirred at room temperature for 1 hour.
  • the solution in which the impurities were precipitated was centrifuged at 13,900 g for 30 minutes to discard the supernatant, and the pellet was washed with the last washing buffer solution (3.5 M Guanidine, 20 mM Sodium Acetate pH 5.0, 5 mM DTT). Pellets were obtained by centrifugation under the same conditions as above.
  • the washed interleukin 2 analog is dissolved in 400 mL of refolding buffer (6 mM Guanidine, 100 mM Tris pH 8.0, 0.1 mM CuCl 2 ). The refolding process was performed by stirring the mixed solution at 4°C for 15 - 24 hours.
  • the interleukin 2 analog refolding solution obtained in Example 3 was applied to a size exclusion column and concentrated to 1 mL or less for purification.
  • the column was equilibrated with a buffer solution (2 M Guanidine, 100 mM Tris pH 8.0) before introducing the refolding solution, and then eluted by flowing the buffer solution after introducing the refolding solution. Since the eluted sample contained Guanidine, it was changed to a stabilizing solution (10 mM Sodium Acetate pH 4.5, 5% Trehalose), and then the purity was measured through RP-HPLC and peptide mapping analysis. If the measured purity was 80% or more, it was used in the experiment.
  • the binding force was measured using the association rate constant (Ka) and the dissociation rate constant (Kd). Interleukin 2 analogs were flowed for 3 minutes at a flow rate of 10 ⁇ L/min to measure the association rate, and only the experimental buffer was flowed at the same time and flow rate. The rate of dissociation from the given interleukin 2 alpha receptor was measured. Upon completion of the measurement, the binding force of the receptor was evaluated according to the 1:1 binding fitting model in the Biaevaluation program. The evaluated binding force was expressed as a relative binding force compared to the binding force of analog #1 (SEQ ID NO: 2) according to the following formula.
  • the binding ability of interleukin 2 analogues 2, 3, 4, 5, 6, 7, and 8 to the IL-2 alpha receptor was the analogue of SEQ ID NO: 2 used as a control. Compared to 1, a higher binding force was confirmed.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 천연형에 비해 인터루킨 2 알파 수용체 결합력이 증가된, 인터루킨 2 아날로그에 관한 것이다.

Description

신규 면역 억제 인터루킨 2 (INTERLEUKIN 2) 아날로그
본 발명은 신규한 인터루킨 2 아날로그에 관한 것이다.
인터루킨 2(Interleukin 2)는 총 133개의 아미노산 잔기로 구성된 분자량 약 15 kDa의 중요한 면역 자극제로서, T 세포와 B 세포를 포함하는 면역 체계의 다양한 세포를 활성화시킨다. 인터루킨 2의 면역 자극제로서의 높은 효능은 암과 에이즈를 포함한 다양한 면역관련 병증을 치료하기 위해 사용할 수 있다(대한민국 공개특허 제10-2017-0070091호). 현재 인터루킨 2(상표명 Proleukin®)는 전이성 신세포암 및 전이성 흑색종의 치료용으로 FDA 승인을 받은 의약이다. 그러나 높은 복용량의 인터루킨 2 요법과 연관된 심각한 독성 때문에 적용 가능한 환자가 제한되며, 실제로 적합한 환자의 소수에 대해서만 이 치료 요법을 수행하고 있다. 인터루킨 2에 연관된 독성은 심한 열, 메스꺼움, 구토, 혈관 누출(vascular leak), 심한 저혈압, 폐 부종, 및 간 손상을 일으키는 혈관 누출 증후군(Vascular leak syndrome)을 포함한다.
인터루킨 2 수용체에는 3가지 서브유닛 수용체가 있다. 그 서브유닛은 알파 체인(IL-2Rα, CD25), 베타 체인(IL-2Rβ 또는 CD122) 및 감마 체인(IL-2Rγ 또는 CD132)으로 이루어져 있고, 인터루킨 2가 수용체 서브유닛들의 다양한 조합에 결합함으로써 여러가지 기능을 발휘 할 수 있다. 단일의 인터루킨 2 알파 수용체는 낮은 친화성 인터루킨 2 수용체로 불리며, 신호전달에는 관여하지 않는다. 인터루킨 2 베타 및 감마 수용체의 복합체는 중간 친화성으로 인터루킨 2에 결합한다. 인터루킨 2 알파, 베타 및 감마 수용체의 복합체는 높은 친화성으로 인터루킨 2에 결합한다. 또한 높은 친화성의 인터루킨 2 알파, 베타 및 감마 수용체의 복합체는 보통 CD4+ T 조절 세포(Treg)뿐 만 아니라 최근 활성화된 T 세포에서 발견된다.
한편, 인터루킨 2의 다양한 면역 관련 병증의 치료제로서의 가능성에도 불구하고, 독성 및 부작용을 감소시키면서도 복용량의 감소를 시킬 수 있는 약제의 존재가 미비한 상태로, 새롭고 향상된 약제에 관한 연구가 더욱 필요하다.
면역 관련 병증의 치료제 개발의 일환으로, 인터루킨 2 아날로그를 포함하면서 약리 효과가 우수한 약제의 개발이 요구된다.
본 발명의 하나의 목적은 인터루킨 2 아날로그를 제공하는 것이다.
본 발명의 또 다른 하나의 목적은 상기 인터루킨 2 아날로그를 코딩하는 분리된 핵산; 상기 핵산을 포함하는 재조합 발현 벡터; 및 상기 벡터를 포함하는 형질전환체를 제공하는 것이다.
본 발명의 또 하나의 목적은 상기 인터루킨 2 아날로그를 제조하는 방법을 제공하는 것이다.
본 발명의 또 하나의 목적은 천연형 인터루킨 2에서 하나 이상의 아미노산을 변이시키는 단계를 포함하는, 인터루킨 2 알파 수용체 결합력을 증가시키는 법을 제공하는 것이다.
본 발명에 따른 인터루킨 2 아날로그는 생체 인터루킨 2 알파 수용체에 대한 결합력이 증가된 아날로그로서, 다양한 용도로 사용될 수 있다.
도 1은 인터루킨 2 아날로그 1 내지 8(서열번호 2 내지 9)의 인터루킨 2 알파 수용체의 결합력을 확인한 결과이다.
본 발명의 하나의 양태는 신규한 인터루킨 2 아날로그(interleukin 2 analog, 또는 IL-2 analog)이다.
하나의 구체예로서, 상기 인터루킨 2 아날로그는 천연형 인터루킨 2 또는 인터루킨 2 아날로그인 알데스루킨(aldesleukin)에 비해 인터루킨 2 알파 수용체 결합력이 증가된 인터루킨 2 아날로그인 것을 특징으로 한다.
다른 하나의 구체예로서, 상기 인터루킨 2 아날로그는 천연형 인터루킨 2에서 하나 이상의 아미노산이 변이된 서열을 포함하는 것일 수 있다.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 천연형 인터루킨 2에서 1번, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산 중 하나 이상의 아미노산이 변이된 서열을 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 하기 일반식 1의 아미노산 서열을 포함하는 것을 특징으로 한다:
X1-PTSSSTKKTQLQLEHLL-X19-X20-LQMILNGINNYKNPKLTRMLT-X42-KFYMPKKATELKHLQCLE-X61-ELKPLE-X68-X69-LNLAQSKNFHLRPRDLISNIN-X91-IVLELKGSETTFMCEYADETATIVEFLNRWITFS-X126-SII-X130-TLT (일반식 1, 서열번호 38)
상기 일반식 1에서,
X1은 결실이고,
X19는 루신(L), 또는 발린(V)이고,
X20은 페닐알라닌(F), 또는 아스파르트산(D)이고,
X42는 페닐알라닌(F), 또는 트립토판(W)이고,
X61은 아스파르트산(D), 또는 글루탐산(E)이고,
X68은 아스파르트산(D)이고,
X69는 발린(V), 또는 글리신(G)이고,
X91은 발린(V), 또는 트레오닌(T)이고,
X126은 글루타민(Q), 또는 트레오닌(T)이고,
X130은 세린(S) 또는 아르기닌(R)임.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 서열번호 3 내지 9의 아미노산 서열 중 어느 하나의 서열을 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 서열번호 3 내지 8의 아미노산 서열 중 어느 하나의 서열을 포함하는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 상기 변이는 천연형 인터루킨 2 중 하나 이상의 아미노산이 치환(substitution), 추가(addition), 제거(deletion), 수식(modification) 및 이들의 조합으로 이루어지는 군에서 선택되는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 천연형 인터루킨 2 중 1번 아미노산이 변이되거나, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 아미노산으로 이루어진 군에서 선택된 하나 또는 그 이상의 아미노산이 다른 아미노산으로 변이된 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 하기 아날로그 중 어느 하나인 것을 특징으로 한다:
(a) 천연형 인터루킨 2 중 1번 아미노산이 변이된, 인터루킨 2 아날로그;
(b) 천연형 인터루킨 2 중 19번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(c) 천연형 인터루킨 2 중 20번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(d) 천연형 인터루킨 2 중 42번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(e) 천연형 인터루킨 2 중 61번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(f) 천연형 인터루킨 2 중 68번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(g) 천연형 인터루킨 2 중 69번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(h) 천연형 인터루킨 2 중 91번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(i) 천연형 인터루킨 2 중 126번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(j) 천연형 인터루킨 2 중 130번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그; 및
(l) 천연형 인터루킨 2 중 125번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 하기 아날로그 중 어느 하나인 것을 특징으로 한다:
(a) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 20번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(b) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 20번, 61번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(c) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번, 126번 및 130번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(d) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번 및 69번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(e) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번 및 91번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(f) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 19번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그; 및
(g) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 42번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 하기 아날로그 중 어느 하나인 것을 특징으로 한다:
(a) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 20번 아미노산이 페닐알라닌으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그;
(b) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 20번 아미노산이 페닐알라닌으로, 61번 아미노산이 아스파르트산으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그;
(c) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 126번 아미노산이 트레오닌으로, 130번 아미노산이 아르기닌으로 치환된, 인터루킨 2 아날로그;
(d) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 69번 아미노산이 글리신으로 치환된, 인터루킨 2 아날로그;
(e) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 91번 아미노산이 트레오닌으로 치환된, 인터루킨 2 아날로그;
(f) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 19번 아미노산이 발린으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그; 및
(g) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 42번 아미노산이 트립토판으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 알데스루킨과 비교하여 인터루킨 2 알파 수용체 결합력이 500% 이상 증가된 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 인터루킨 2 아날로그는 C-말단에 하나 이상의 아미노산을 추가로 포함하는 것을 특징으로 한다.
본 발명을 구현하기 위한 다른 양태는, 상기 인터루킨 2 아날로그를 코딩하는, 분리된 핵산; 상기 핵산을 포함하는, 재조합 발현 벡터; 상기 벡터를 포함하는, 형질전환체이다.
본 발명을 구현하기 위한 또 하나의 양태는 상기 인터루킨 2 아날로그를 제조하는 방법이다.
본 발명을 구현하기 위한 다른 양태는, 천연형 인터루킨 2에서 하나 이상의 아미노산을 변이시키는 단계를 포함하는, 인터루킨 2 알파 수용체 결합력을 증가시키는 방법이다.
하나의 구체예로서, 상기 변이는 천연형 인터루킨 2에서 1번, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산 중 하나 이상의 아미노산을 변이시키는 것을 특징으로 한다.
다른 하나의 구체예로서, 상기 변이는 천연형 인터루킨 2 중 1번을 변이시키거나, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 아미노산으로 이루어진 군에서 선택된 하나 또는 그 이상의 아미노산을 다른 아미노산으로 변이시키는 것을 특징으로 한다.
앞선 구체예 중 어느 하나에 따른 방법으로서, 상기 변이는
(a) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 20번 및 68번 아미노산을 다른 아미노산으로 치환시키거나;
(b) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 20번, 61번 및 68번 아미노산을 다른 아미노산으로 치환시키거나;
(c) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번, 126번 및 130번 아미노산을 다른 아미노산으로 치환시키거나;
(d) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번 및 69번 아미노산을 다른 아미노산으로 치환시키거나;
(e) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번 및 91번 아미노산을 다른 아미노산으로 치환시키거나;
(f) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 19번 및 68번 아미노산을 다른 아미노산으로 치환시키거나; 또는
(g) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 42번 및 68번 아미노산을 다른 아미노산으로 치환시키는 것을 특징으로 한다.
본 발명을 구현하기 위한 또 하나의 양태는 서열번호 3 내지 9의 아미노산 서열로 이루어진 군에서 선택되는 어느 하나의 서열을 포함하는 인터루킨 2 아날로그이다.
본 발명을 실시하기 위한 구체적인 내용을 설명하면 다음과 같다. 한편, 본원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본원에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술되는 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 할 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다.
본 명세서 전반을 통하여, 아미노산에 대한 통상의 1문자 및 3문자 코드가 사용된다. 또한 본 명세서에서 약어로 언급된 아미노산은 IUPAC-IUB 명명법에 따라 기재하였다.
알라닌 A 아르기닌 R
아스파라긴 N 아스파르트산D
시스테인 C 글루탐산 E
글루타민 Q 글리신 G
히스티딘 H 이소루신 I
루신 L 리신 K
메티오닌 M 페닐알라닌 F
프롤린 P 세린 S
트레오닌 T 트립토판 W
티로신 Y 발린 V
본 발명의 하나의 양태는 인터루킨 2 아날로그를 제공한다. 본 발명의 인터루킨 2 아날로그는 인터루킨 2 수용체에 대한 결합력이 천연형 인터루킨 2 또는 공지된 알데스루킨에 비해 변경된 것, 특히 알데스루킨 대비 인터루킨 2 알파 수용체 결합력이 증가된 것을 특징으로 한다.
구체적으로, 본 발명의 인터루킨 2 아날로그는 천연형 인터루킨 2 또는 공지된 알데스루킨에 비해 인터루킨 2 알파 수용체에 대한 결합력이 증가된 것일 수 있고, 보다 구체적으로, 알데스루킨 대비 인터루킨 2 알파 수용체에 대한 결합력이 증가된 것일 수 있다.
본 발명에서 용어, "인터루킨 2(interleukin 2, IL-2)"란 생체 내 면역 시스템에서 신호 전달을 하는 사이토카인의 일종으로 면역 조절제를 의미한다. 인터루킨 2는 일반적으로 약 15 kDa의 중요한 면역 자극제로 알려져 있다.
본 발명에서 용어, "인터루킨 2 아날로그"란 천연형 서열에서 하나 이상의 아미노산이 변이된 것을 의미하며, 특히 본 발명에서는 알데스루킨에 비해 인터루킨 2 알파 수용체에 대한 결합력이 증가한, 천연형 인터루킨 2의 아미노산이 변이된 인터루킨 2 아날로그일 수 있다. 구체적으로, 본 발명의 인터루킨 2 아날로그는 비자연적인(non-naturally occurring) 것일 수 있다.
상기 천연형 인터루킨 2는 인간 인터루킨 2 일 수 있으며, 이의 서열은 공지된 데이터베이스 등에서 얻을 수 있다. 구체적으로는 서열번호 1의 아미노산 서열일 수 있으나, 이에 제한되지 않는다.
본 발명에서, 천연형 인터루킨 2가 서열번호 1의 아미노산 서열일 수 있다는 의미는 서열번호 1과 동일한 서열뿐만 아니라, 서열번호 1과 상동성 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 이상의 서열 역시 본 발명의 천연형 인터루킨 2의 범주에 속한다는 의미이며, 아미노산의 변이 위치는 서열번호 1을 기준으로 상동성 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% 이상의 서열을 배열(align) 했을 때 서열번호 1의 아미노산 서열 상에서 상응되는 위치가 변이된 것을 의미한다.
본 발명에서, 천연형 서열에서 하나 이상의 아미노산이 변이된 것이란 천연형 인터루킨 2에서 적어도 하나 이상의 아미노산에 치환(substitution), 추가(addition), 제거(deletion), 수식(modification) 및 이들의 조합으로 이루어지는 군에서 선택된 변형이 일어난 것일 수 있다.
구체적으로, 본 발명의 인터루킨 2 아날로그는 천연형 인터루킨 2에서 1번, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산 중 하나 이상의 아미노산이 변이된 서열을 포함하는 것일 수 있고, 구체적으로는, 천연형 인터루킨 2에서 1번 아미노산이 변이되거나, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산 중 하나 이상이 변이된 서열을 포함하는 것일 수 있다. 보다 구체적으로, 본 발명의 인터루킨 2 아날로그는 천연형 인터루킨 2에서 1번 아미노산이 제거되고, 125번 아미노산이 다른 아미노산으로 치환되고, 추가적으로 1개, 2개, 3개, 또는 그 이상의 아미노산 치환을 포함하는 것일 수 있다. 이에 제한되는 것은 아니나, 상기 125번 아미노산인 시스테인이 세린으로 치환될 수 있고, 추가 치환이 일어나는 아미노산은 19번, 20번, 42번, 61번, 68번, 69번, 91번, 126번 및 130번 위치에 상응하는 아미노산이 될 수 있으나, 이에 제한되지 않는다.
또한, 상기 변이 위치 외에 당업계에 알려진, 펩타이드의 안정성 및 반감기 증가를 위해 수행될 수 있는 정도의 아미노산 잔기의 치환, 부가, 결실, 수식 등을 포함하는 인터루킨 2 아날로그 역시 본 발명의 범주에 포함된다.
본 발명에서 용어, “알데스루킨(aldesleukin)” 또는 “인터루킨 2 아날로그(aldesleukin)”는 상업적으로 구매 가능한 인터루킨 2 아날로그로서, aldesleukin(상표명: Proleukin®)일 수 있으며, 구체적으로는 서열번호 2의 아미노산 서열을 갖는 것일 수 있다. 본 발명에서는 “인터루킨 2 아날로그 1”과 혼용되어 사용된다. 본 발명에 따른 인터루킨 아날로그는 상기 인터루킨 2 아날로그 1에 비해 증가된 인터루킨 2 알파 수용체 결합력을 갖는 것일 수 있다.
인터루킨 2 알파 수용체는 인터루킨 2의 신호전달 체계에는 관여하지 않는 것으로 알려져 있지만, 다른 인터루킨 2 수용체(베타 혹은 감마)와 인터루킨 2의 결합력을 10배~100배 증가시키며, CD4+ 조절 T세포 등에 발현되어 있다. 인터루킨 2 알파 수용체에 대한 결합력을 증가시킴으로써 CD8+ T세포의 분화억제 효력이 증가하여 면역 반응을 효과적으로 억제시킬 수 있고, 이로 인해 면역질환 치료효과 증대가 가능하다. 또한, 낮은 투여용량으로도 기존과 유사한 수준의 효력을 가질 수 있으므로 부작용 감소효과를 기대할 수 있다.
본 발명에서 상기 인터루킨 2 아날로그는 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 다른 아미노산으로 치환된 서열을 포함하는 것일 수 있고, 2개 또는 3개의 아미노산 변이를 추가로 포함하는 것일 수 있다. 예를 들어, 125번 아미노산이 세린으로 치환되고, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 126번 및 130번 중 하나 이상의 아미노산이 다른 아미노산으로 추가로 치환된 것일 수 있다. 또한, 133번 아미노산에 하나 이상의 아미노산이 추가된 서열을 포함할 수 있으나, 이에 제한되지 않고, 천연형 인터루킨 2 및/또는 알데스루킨에 비해 인터루킨 2 알파 수용체 결합력이 증가된 인터루킨 2 아날로그는 제한 없이 본 발명의 범주에 포함된다.
본 발명의 목적상, 상기 추가되는 아미노산은 천연형 인터루킨 2 또는 알데스루킨에 비해 인터루킨 2 알파 수용체 결합력이 증가되고, 구체적으로, 알데스루킨에 비해 인터루킨 2 알파 수용체 결합력이 증가되는 이상, 그 종류나 길이에 제한이 없으며, 천연형 아미노산 외에도 비천연형 아미노산, 화학적 변형을 포함하는 아미노산 역시 추가될 수 있다.
천연형 인터루킨에서 19번, 20번, 42번, 61번, 68번, 69번, 91번, 126번 및 130번에 해당하는 위치의 아미노산은 인터루킨 2와 인터루킨 2 알파 수용체의 결합에 관여하는 것으로, 상기 위치의 아미노산에 치환을 도입함으로써 인터루킨 2 아날로그의 인터루킨 2 알파 수용체의 결합력을 증가시킬 수 있다.
본 발명의 하나의 구체적인 양태로, 상기 인터루킨 2 아날로그는 하기 일반식 1의 아미노산 서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다: X1-PTSSSTKKTQLQLEHLL-X19-X20-LQMILNGINNYKNPKLTRMLT-X42-KFYMPKKATELKHLQCLE-X61-ELKPLE-X68-X69-LNLAQSKNFHLRPRDLISNIN-X91-IVLELKGSETTFMCEYADETATIVEFLNRWITFS-X126-SII-X130-TLT (일반식 1, 서열번호 38)
상기 일반식 1에서,
X1은 결실이고,
X19는 루신(L), 또는 발린(V)이고,
X20은 페닐알라닌(F), 또는 아스파르트산(D)이고,
X42는 페닐알라닌(F), 또는 트립토판(W)이고,
X61은 아스파르트산(D), 또는 글루탐산(E)이고,
X68은 아스파르트산(D)이고,
X69는 발린(V), 또는 글리신(G)이고,
X91은 발린(V), 또는 쓰레오닌(T)이고,
X126은 글루타민(Q), 또는 쓰레오닌(T)이고,
X130은 세린(S) 또는 아르기닌(R)임.
또한, 상기 일반식 1에서 X133에 해당하는 트레오닌(T)에 하나 이상의 아미노산이 추가될 수 있으나, 이에 제한되지 않는다.
본 발명의 인터루킨 2 아날로그는 천연형 인터루킨 2 또는 공지된 알데스루킨에 비해 인터루킨 2 알파 수용체 결합력이 증가된 인터루킨 2 아날로그로서, 상기 인터루킨 2 아날로그는 천연형 인터루킨 2에서 하나 이상의 아미노산이 변이된 것일 수 있다. 구체적으로, 상기 인터루킨 2 아날로그는 알데스루킨에 비해 인터루킨 2 알파 수용체 결합력이 증가된 것일 수 있으나, 이에 제한되지 않는다.
상기 인터루킨 2 아날로그는 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 다른 아미노산으로 치환된 서열을 포함하는 것일 수 있고, 추가적인 아미노산의 치환을 포함하는 것일 수 있다. 상기 추가적인 아미노산의 치환은 X19, X20, X42, X61, X68, X69, X91, X126 및 X130 위치 중 하나 이상의 위치에서 일어날 수 있으나, 이에 제한되지 않는다. 구체적인 예로, 상기 인터루킨 2 아날로그는 천연형 인터루킨 2 또는 공지된 알데스루킨에 비해 X68번 위치의 글루탐산(E)이 아스파르트산(D)으로 치환된 것일 수 있으나, 이에 제한되지 않는다.
또 다른 하나의 예로서, 상기 인터루킨 2 아날로그는 하기 아날로그로 이루어진 군에서 선택된 어느 하나일 수 있다:
(a) 천연형 인터루킨 2 중 1번 아미노산이 변이된, 인터루킨 2 아날로그;
(b) 천연형 인터루킨 2 중 19번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(c) 천연형 인터루킨 2 중 20번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(d) 천연형 인터루킨 2 중 42번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(e) 천연형 인터루킨 2 중 61번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(f) 천연형 인터루킨 2 중 68번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(g) 천연형 인터루킨 2 중 69번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(h) 천연형 인터루킨 2 중 91번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(i) 천연형 인터루킨 2 중 126번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
(j) 천연형 인터루킨 2 중 130번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그; 및
(l) 천연형 인터루킨 2 중 125번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그.
또 다른 예로서, 상기 인터루킨 2 아날로그는 하기 아날로그로 이루어진 군에서 선택된 어느 하나일 수 있다:
(a) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 20번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(b) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 20번, 61번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(c) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번, 126번 및 130번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(d) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번 및 69번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(e) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번 및 91번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
(f) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 19번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그; 및
(g) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 42번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그.
여기에서, 상기 인터루킨 2 아날로그가 포함하는 아미노산 치환은 하기 아미노산 치환으로 이루어진 군에서 선택되는 어느 하나 이상인 것일 수 있다:
(a) 19번 아미노산이 발린으로 치환; (b) 20번 아미노산이 페닐알라닌으로 치환; (c) 42번 아미노산이 트립토판으로 치환; (d) 61번 아미노산이 아스파르트산으로 치환; (e) 68번 아미노산이 아스파르트산으로 치환; (f) 69번 아미노산이 글리신으로 치환; (g) 91번 아미노산이 트레오닌으로 치환; (h) 126번 아미노산이 트레오닌으로 치환; 및 (i) 130번 아미노산이 아르기닌으로 치환. 또한, 상기 치환은 (j) 68번 아미노산 아미노산이 아스파르트산으로 치환되고, 69번 아미노산이 글리신으로 치환되는 것일 수 있고, 또는 (k) 126번 아미노산이 트레오닌으로 치환되고 130번 아미노산이 아르기닌으로 치환되는 것일 수 있으나, 이에 제한되지 않는다.
또 다른 예로서, 상기 인터루킨 2 아날로그는 하기 아날로그로 이루어진 군에서 선택된 어느 하나일 수 있다:
(a) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 20번 아미노산이 페닐알라닌으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그;
(b) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 20번 아미노산이 페닐알라닌으로, 61번 아미노산이 아스파르트산으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그;
(c) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 126번 아미노산이 트레오닌으로, 130번 아미노산이 아르기닌으로 치환된, 인터루킨 2 아날로그;
(d) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 69번 아미노산이 글리신으로 치환된, 인터루킨 2 아날로그;
(e) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 91번 아미노산이 트레오닌으로 치환된, 인터루킨 2 아날로그;
(f) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 19번 아미노산이 발린으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그; 및
(g) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 42번 아미노산이 트립토판으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그.
본 명세서에서, 용어 "상응하는(corresponding to)"은, 펩타이드에서 열거되는 위치의 아미노산 잔기이거나, 또는 펩타이드에서 열거되는 잔기와 유사하거나 동일하거나 상동한 아미노산 잔기를 지칭한다. 상응하는 위치의 아미노산을 확인하는 것은 특정 서열을 참조하는 서열의 특정 아미노산을 결정하는 것일 수 있다.
예를 들어, 임의의 아미노산 서열을 서열번호 1과 정렬(align)하고, 이를 토대로 상기 아미노산 서열의 각 아미노산 잔기는 서열번호 1의 아미노산 잔기와 상응하는 아미노산 잔기의 숫자 위치를 참조하여 넘버링 할 수 있다.
이러한 정렬에는 예를 들어 Needleman-Wunsch 알고리즘 (Needleman 및 Wunsch, 1970, J. Mol. Biol. 48: 443-453), EMBOSS 패키지의 Needle 프로그램 (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) 등을 이용할 수 있으나, 이에 제한되지 않고 당업계에 알려진 서열 정렬 프로그램, 쌍 서열(pairwise sequence) 비교 알고리즘 등을 적절히 사용할 수 있다.
본 발명에서 펩타이드 내 아미노산의 특정 위치로 표현되었더라 하더라도, 참조 서열에서 상응하는 위치를 의미하는 것일 수 있다.
또 하나의 예로서, 상기 인터루킨 2 아날로그는 서열번호 3 내지 9로 이루어진 군에서 선택된 아미노산 서열을 포함하거나, 필수적으로 구성되거나, 구성된 것일 수 있으나, 이에 제한되지 않는다.
또한, 본 명세서에서 '특정 서열번호로 구성되는 인터루킨 2 아날로그'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 인터루킨 2 아날로그와 동일 혹은 상응하는 활성을 가지는 경우라면 해당 서열번호의 아미노산 서열 앞뒤의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 혹은 이의 잠재성 돌연변이 (silent mutation)를 제외하는 것이 아니며, 이러한 서열 추가 혹은 돌연변이를 가지는 경우에도 본원의 범위 내에 속하는 것이 자명하다.
본 발명의 인터루킨 2 아날로그는 서열번호 3 내지 9의 아미노산 서열과 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 또는 99% 이상의 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, '상동성(homology)' 또는 '동일성(identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열과 서로 관련된 정도를 의미하며 백분율로 표시될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
임의의 두 염기 서열 또는 펩타이드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 예를 들어, Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다. (GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
염기 서열 또는 펩타이드의 상동성, 유사성 또는 동일성은 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol.48: 443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의한다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 일진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL(NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다. 따라서, 본 발명에서 사용된 것으로서, 용어 "상동성" 또는 "동일성"은 서열들간의 관련성(relevance)를 나타낸다.
이상의 내용은 본 발명의 다른 구체예 혹은 다른 양태에도 적용될 수 있으나, 이에 제한되는 것은 아니다.
본 발명의 인터루킨 2 아날로그는 인터루킨 2의 알파 수용체와의 결합력을 증가시켜 새로운 인터루킨 2의 대체제로 이용될 수 있다. 특히, 알파 수용체에 대한 결합력이 증가됨으로써 CD4+ 조절 T세포의 활성화 효력을 높이고, CD8+ T세포의 분화를 억제하여 면역 반응을 효과적으로 억제시킬 수 있다. 이를 통해 낮은 투여용량으로 기존과 유사한 치료효과 혹은 치료효과 증대를 기대할 수 있으며, 낮아진 용량으로 부작용에 대한 우려도 감소하여 기존대비 효과적인 면역질환 치료제로 이용될 수 있다.
본 발명에서, 인터루킨 2의 아날로그의 제조를 위한 이러한 변형은 L-형 혹은 D-형 아미노산, 및/또는 비-천연형 아미노산을 이용한 변형; 및/또는 천연형 서열을 개질, 예를 들어 측쇄 작용기의 변형, 분자 내 공유결합, 예컨대, 측쇄 간 고리 형성, 메틸화, 아실화, 유비퀴틴화, 인산화, 아미노헥산화, 바이오틴화 등과 같이 개질함으로써 변형하는 것을 모두 포함한다.
또한, 천연형 인터루킨 2의 아미노 및/또는 카르복시 말단에 하나 또는 그 이상의 아미노산이 추가된 것을 모두 포함한다.
상기 치환되거나 추가되는 아미노산은 인간 단백질에서 통상적으로 관찰되는 20개의 아미노산뿐만 아니라 비정형 또는 비-자연적 발생 아미노산을 사용할 수 있다. 비정형 아미노산의 상업적 출처에는 Sigma-Aldrich, ChemPep과 Genzyme pharmaceuticals가 포함된다. 이러한 아미노산이 포함된 펩타이드와 정형적인 펩타이드 서열은 상업화된 펩타이드 합성 회사, 예를 들어 미국의 American peptide company나 Bachem, 또는 한국의 Anygen을 통해 합성 및 구매 가능하다.
아미노산 유도체도 마찬가지 방식으로 입수할 수 있는데, 그 예를 일부만 들자면 4-이미다조아세트산 (4-imidazoacetic acid) 등을 사용할 수 있다.
또한, 본 발명에 따른 인터루킨 2 아날로그는 생체 내의 단백질 절단 효소들로부터 보호하고 안정성을 증가시키기 위하여 이의 N-말단 및/또는 C-말단 등이 화학적으로 수식되거나 유기단으로 보호되거나, 또는 펩타이드 말단 등에 아미노산이 추가되어 변형된 형태일 수 있다.
특히, 화학적으로 합성한 펩타이드의 경우, N- 및 C-말단이 전하를 띠고 있기 때문에, 이러한 전하를 제거하기 위하여 N-말단을 아세틸화 (acetylation) 및/또는 C-말단을 아미드화 (amidation)할 수 있으나, 특별히 이에 제한되지는 않는다.
또한, 본 발명에 따른 인터루킨 2 아날로그는 펩타이드 형태인 바, 펩타이드 그 자체, 이의 염 (예컨대, 상기 펩타이드의 약학적으로 허용가능한 염), 또는 이의 용매화물의 형태를 모두 포함한다. 또한, 펩타이드는 약학적으로 허용되는 임의의 형태일 수 있다.
상기 염의 종류는 특별히 제한되지는 않는다. 다만, 개체, 예컨대 포유류에게 안전하고 효과적인 형태인 것이 바람직하나, 특별히 이에 제한되는 것은 아니다.
상기 용어, "약학적으로 허용되는"은 의약학적 판단의 범위 내에서，과도한 독성，자극, 또는 알레르기 반응 등을 유발하지 않고 원하는 용도에 효과적으로 사용 가능한 물질을 의미한다.
본 발명에서 용어, "약학적으로 허용되는 염" 이란 약학적으로 허용되는 무기산, 유기산, 또는 염기로부터 유도된 염을 포함한다. 적합한 산의 예로는 염산, 브롬산, 황산, 질산, 과염소산, 푸마르산，말레산, 인산, 글리콜산, 락트산, 살리실산，숙신산, 톨루엔-P-설폰산, 타르타르산, 아세트산，시트르산, 메탄설폰산，포름산, 벤조산, 말론산, 나프탈렌-2-설폰산，밴젠설폰산 등을 들 수 있다. 적합한 염기로부터 유도된 염은 나트륨, 칼륨 등의 알칼리 금속，마그네슘 등의 알칼리 토금속，및 암모늄 등을 포함할 수 있다.
또한, 본 발명에서 사용된 용어 "용매화물"은 본 발명에 따른 펩타이드 또는 이의 염이 용매 분자와 복합체를 형성한 것을 말한다.
본 발명에서 천연형 인터루킨 2 수용체에 대한 어떠한 인터루킨 2 아날로그의 결합력이란 수용체에 대한 친화력을 측정하는 방법으로 공지의 다양한 기술을 이용하여 측정할 수 있다. 그 예로, SPR(surface Plasmon resonance)를 이용할 수 있고, 구체적으로 실시예 5를 참조할 수 있으나, 이에 제한되지 않는다.
보다 구체적으로, 본 발명의 인터루킨 2 아날로그는 천연형 인터루킨 2 또는 알데스루킨에 비해 증가된 인터루킨 2 알파 수용체 결합력을 가질 수 있다.
구체적으로, 본 발명의 인터루킨 2 아날로그는 알데스루킨의 인터루킨 2 알파 수용체 결합력과 비교하여 약 1.1배 이상, 약 1.2배이상, 약 1.5배 이상, 약 2배 이상, 약 3배 이상, 약 4배 이상, 약 5배 이상, 약 6배 이상, 약 7배 이상, 약 8배 이상, 또는 그 이상의 인터루킨 2 알파 수용체 결합력을 갖는 것일 수 있으나, 그 수치는 한정되지 않으며 결합력이 천연형 인터루킨 2 또는 알데스루킨과 대비하여 증가되었으면 본 발명의 범주에 속한다.
또는, 알데스루킨의 인터루킨 2 알파 수용체 결합력(100%)을 기준으로, 본 발명의 인터루킨 2 아날로그는 약 100% 이상, 약 150% 이상, 약 200% 이상, 약 300% 이상, 약 400% 이상, 약 500% 이상, 약 600% 이상, 약 700% 이상, 약 800% 이상, 또는 그 이상의 결합력을 갖는 것일 수 있으나, 그 수치는 한정되지 않으며 결합력이 알데스루킨과 대비하여 증가되었으면 본 발명의 범주에 속한다.
보다 구체적으로, 본 발명의 인터루킨 2 아날로그는 알데스루킨의 인터루킨 2 알파 수용체 결합력(100%)을 기준으로, 약 500% 이상의 결합력을 나타내는 것일 수 있으며, 그 예로, 서열번호 3 내지 8의 아미노산 서열을 포함하는 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서 용어, "약"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 발명의 인터루킨 2 아날로그는 천연형 인터루킨 2 또는 알데스루킨에 비해 인터루킨 2 알파 수용체에 대한 결합력이 증가되고, 더 구체적으로는 알데스루킨 대비 인터루킨 2 알파 수용체에 대한 결합력이 증가된 것을 특징으로 한다.
본 발명의 구체적인 실시 형태에서는 본 발명의 인터루킨 2 아날로그를 제조하기 위하여, 천연형 인터루킨 2(서열번호 1)를 바탕으로 변이를 도입한 인터루킨 2 아날로그를 제조하였다. 본 발명에서 제조된 인터루킨 2 아날로그는 서열번호 3 내지 9 중 어느 하나의 아미노산 서열을 포함하는 것일 수 있고, 또는 서열번호 11 내지 17 중 어느 하나의 염기 서열로 코딩되는 것일 수 있다.
본 발명을 구현하기 위한 다른 하나의 양태는 상기 인터루킨 2 아날로그를 코딩하는 핵산(폴리뉴클레오티드), 상기 핵산을 포함하는 재조합 발현 벡터, 및 상기 핵산 또는 재조합 발현 벡터를 포함하는 형질전환체를 제공한다.
본 발명의 인터루킨 2 아날로그를 코딩하는 핵산은 서열번호 1의 천연형 인터루킨 2를 코딩하는 염기 서열에서 특정 위치의 아미노산에 변이(아미노산 결실, 치환, 및/또는 추가)를 도입할 수 있도록 변형된 것일 수 있고, 구체적으로는 서열번호 3 내지 9 중 어느 하나의 아미노산 서열을 코딩하는 염기 서열을 포함할 수 있다. 일 예로서, 본 발명의 핵산은 서열번호 11 내지 17 중 어느 하나의 염기 서열을 가지거나 포함할 수 있다.
본 발명의 염기 서열은 코돈의 축퇴성(degeneracy) 또는 본 발명의 핵산을 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 본 발명의 인터루킨 2 아날로그의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 본 발명의 핵산은 서열번호 11 내지 17 중 어느 하나의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 11 내지 17의 서열 중 어느 하나의 서열과 상동성 또는 동일성이 70% 이상, 75% 이상, 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
또한, 본 발명의 핵산은 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 본 발명의 핵산 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화할 수 있는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(J. Sambrook et al.,Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al.,Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York,9.50-9.51, 11.7-11.8 참조)에 구체적으로 기재되어 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 발명의 핵산은 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
상기 폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(예컨대, J. Sambrook et al., 상동).
상동성 또는 동일성에 관해서는 상술한 바와 같다.
본 발명에 따른 재조합 벡터는 전형적으로 클로닝을 위한 벡터 또는 발현을 위한 벡터로서 구축될 수 있고, 원핵세포 또는 진핵세포를 숙주세포로 사용하기 위한 벡터로서 구축될 수 있다.
본 발명에서 사용되는 "벡터"는 적당한 숙주세포에서 목적 단백질을 발현할 수 있는 재조합 벡터로서, 핵산 삽입물이 발현되도록 작동 가능하게 연결된 필수적인 조절요소를 포함하는 핵산 구조물(construct)을 의미한다. 본 발명은 인터루킨 2 아날로그를 코딩하는 핵산을 포함하는 재조합 벡터를 제조할 수 있는데, 상기 재조합 벡터를 숙주세포에 형질전환(transformation) 또는 형질감염(transfection) 시킴으로써, 본 발명의 인터루킨 2 아날로그를 수득할 수 있다.
본 발명에서 사용되는 "형질전환(transformation)"는 DNA를 숙주세포 내로 도입하여 DNA가 염색체의 인자로서 또는 염색체 통합 완성에 의해 복제 가능하게 되는 것으로, 외부의 DNA를 세포 내로 도입하여 인위적으로 유전적인 변화를 일으키는 현상을 의미한다.
본 발명에 적합한 숙주는 본 발명의 핵산을 발현하도록 하는 한 특별히 제한되지 않는다. 본 발명에 사용될 수 있는 숙주의 특정한 예로는 대장균(E. coli)과 같은 에스케리키아(Escherichia) 속 세균; 바실러스 서브틸리스(Bacillus subtilis)와 같은 바실러스(Bacillus) 속 세균; 슈도모나스 푸티다(Pseudomonas putida)와 같은 슈도모나스(Pseudomonas) 속 세균; 피키아 파스토리스(Pichia pastoris), 사카로마이세스 세레비지애(Saccharomyces cerevisiae), 스키조사카로마이세스 폼베(Schizosaccharomyces pombe)와 같은 효모; 스포도프테라 프루기페르다(Sf9)와 같은 곤충세포; 및 CHO, COS, BSC 등과 같은 동물세포가 있다.
본 발명을 구현하기 위한 다른 양태는 하나 이상의 아미노산 변이를 포함하는 인터루킨 2 아날로그를 제조하는 방법을 제공한다.
구체적으로, 상기 방법은 천연형 인터루킨 2에서 1번, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산으로 이루어진 군에서 선택된 하나 또는 그 이상의 아미노산에 변이를 도입시키는 단계를 포함하는 것일 수 있다.
본 발명의 방법의 한 예로, 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산으로 이루어진 군에서 선택된 하나 또는 그 이상의 아미노산에 변이를 도입시키는 단계를 포함하는 것일 수 있다.
보다 구체적으로는,
(a) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 20번 및 68번 아미노산을 다른 아미노산으로 치환시키거나;
(b) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 20번, 61번 및 68번 아미노산을 다른 아미노산으로 치환시키거나;
(c) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번, 126번 및 130번 아미노산을 다른 아미노산으로 치환시키거나;
(d) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번 및 69번 아미노산을 다른 아미노산으로 치환시키거나;
(e) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번 및 91번 아미노산을 다른 아미노산으로 치환시키거나;
(f) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 19번 및 68번 아미노산을 다른 아미노산으로 치환시키거나; 또는
(g) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 42번 및 68번 아미노산을 다른 아미노산으로 치환시키는 것일 수 있으나, 이에 제한되지 않는다.
더 구체적인 예로는,
(a) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 20번 아미노산을 페닐알라닌으로, 68번 아미노산을 아스파르트산으로 치환시키거나;
(b) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 20번 아미노산을 페닐알라닌으로, 61번 아미노산을 아스파르트산으로, 68번 아미노산을 아스파르트산으로 치환시키거나;
(c) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 68번 아미노산을 아스파르트산으로, 126번 아미노산을 쓰레오닌으로, 130번 아미노산을 아르기닌으로 치환시키거나;
(d) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 68번 아미노산을 아스파르트산으로, 69번 아미노산을 글리신으로 치환시키거나;
(e) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 68번 아미노산을 아스파르트산으로, 91번 아미노산을 쓰레오닌으로 치환시키거나;
(f) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 19번 아미노산을 발린으로, 68번 아미노산을 아스파르트산으로 치환시키거나; 또는
(g) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 42번 아미노산을 트립토판으로, 68번 아미노산을 아스파르트산으로 치환시키는 것일 수 있으나, 이에 제한되지 않는다.
상기 본 발명의 방법으로 제조된 인터루킨 2 아날로그는 알데스루킨에 비해 증가된 인터루킨 2 수용체에 대한 결합력을 가질 수 있다.
인터루킨 2 아날로그, 변이, 및 결합력의 증가는 상기에서 설명한 바와 같다.
본 발명의 인터루킨 2 아날로그의 제조 방법의 다른 예로서, 상기 인터루킨 2 아날로그를 제조하는 방법은 a) 상기 인터루킨 2 아날로그를 코딩하는 핵산을 포함하는 형질전환체를 배양하여 인터루킨 2 아날로그를 발현시키는 단계; 및 b) 발현된 인터루킨 2 아날로그를 분리 및 정제하는 단계를 포함하는 것일 수 있으나, 인터루킨 2 아날로그를 제조할 수 있는 한 특정 방법에 제한되지 않고 당업계에 공지된 방법일 수 있다.
본 발명에서, 상기 인터루킨 2 아날로그를 코딩하는 핵산은 서열번호 11 내지 17 중 어느 하나의 염기 서열을 포함하거나, (필수적으로) 구성된 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서 형질전환체의 배양에 사용되는 배지는 적절한 방식으로 숙주세포 배양의 요건을 충족해야 한다. 숙주세포의 성장을 위하여 배지 중에 포함될 수 있는 탄소원은 제조된 형질전환체의 종류에 따라 당업자의 판단에 의해 적절하게 선택될 수 있고, 배양 시기 및 양을 조절하기 위해 적당한 배양 조건을 채택할 수 있다.
사용될 수 있는 당원으로는 글루코스, 사카로스, 락토스, 프룩토스, 말토스, 전분, 셀룰로스와 같은 당 및 탄수화물, 대두유, 해바라기유, 피마자유, 코코넛유 등과 같은 오일 및 지방, 팔미트산, 스테아린산, 리놀레산과 같은 지방산, 글리세롤, 에탄올과 같은 알코올, 아세트산과 같은 유기산이 포함된다. 이들 물질은 개별적으로 또는 혼합물로서 사용될 수 있다.
사용될 수 있는 질소원으로는 펩톤, 효모 추출물, 육즙, 맥아 추출물, 옥수수 침지액, 대두밀 및 요소 또는 무기 화합물, 예를 들면 황산암모늄, 염화암모늄, 인산암모늄, 탄산암모늄 및 질산암모늄이 포함된다. 질소원 또한 개별적으로 또는 혼합물로서 사용될 수 있다.
사용될 수 있는 인원으로는 인산이수소칼륨 또는 인산수소이칼륨 또는 상응하는 나트륨-함유 염이 포함된다. 또한, 배양 배지는 성장에 필요한 황산마그네슘 또는 황산철과 같은 금속염을 함유할 수 있다.
마지막으로, 상기 물질에 더하여 아미노산 및 비타민과 같은 필수 성장물질이 사용될 수 있다. 또한, 배양 배지에 적절한 전구체들이 사용될 수 있다. 상기된 원료들은 배양 도중에 배양물에 적절한 방식에 의해 회분식으로 또는 연속식으로 첨가될 수 있다. 수산화나트륨, 수산화칼륨, 암모니아와 같은 염기성 화합물 또는 인산 또는 황산과 같은 산 화합물을 적절한 방식으로 사용하여 배양물의 pH를 조절할 수 있다. 또한, 지방산 폴리글리콜 에스테르와 같은 소포제를 사용하여 기포 생성을 억제할 수 있다. 호기 상태를 유지하기 위해 배양물 내로 산소 또는 산소-함유 기체(예: 공기)를 주입한다.
본 발명에 따른 형질전환체의 배양은 보통 20℃ 내지 45℃, 구체적으로는 25℃ 내지 40℃의 온도에서 수행된다. 또한 배양은 원하는 인터루킨 2 아날로그의 생성량이 최대로 얻어질 때까지 지속되는데, 이러한 목적으로 배양은 보통 10 내지 160시간 동안 지속될 수 있다.
전술한 바와 같이 숙주세포에 따라 적절한 배양 조건을 조성해주면 본 발명에 따른 형질전환체는 인터루킨 2 아날로그를 생산하게 되며, 벡터의 구성 및 숙주세포의 특징에 따라 생산된 인터루킨 2 아날로그는 숙주세포의 세포질 내, 원형질막 공간(periplasmic space) 또는 세포 외로 분비될 수 있다.
숙주세포 내 또는 외에서 발현된 단백질은 통상의 방식으로 정제될 수 있다. 정제 방법의 예로는 염석(예: 황산암모늄 침전, 인산나트륨 침전 등), 용매 침전(예: 아세톤, 에탄올 등을 이용한 단백질 분획 침전 등), 투석, 겔 여과, 이온 교환, 역상 칼럼 크로마토그래피와 같은 크로마토그래피 및 한외여과 등의 기법을 단독 또는 조합하여 적용할 수 있다.
본 발명의 구체예로서, 인터루킨 2 아날로그를 제조하는 방법은
(a) 상기 인터루킨 2 아날로그를 발현시키는 단계; 및
(b) 발현된 인터루킨 2 아날로그를 분리해 내는 단계를 포함할 수 있다.
본 발명의 구체예로서, 형질전환체로부터 봉입체 형태로 발현된 인터루킨 2 아날로그를 분리 및 정제하기 위하여 하기 단계를 추가적으로 포함할 수 있다:
b-1) 상기 a) 단계의 배양액으로부터 형질전환체를 수확하여 파쇄하는 단계;
b-2) 파쇄된 세포 용해물로부터 발현된 인터루킨 2 아날로그를 회수하여 리폴딩하는 단계; 및
b-3) 리폴딩된 인터루킨 2 아날로그를 크기 배제 크로마토그래피로 정제하는 단계.
본 발명을 구현하기 위한 다른 양태는 상기 인터루킨 2 아날로그를 펩타이드 합성법에 의해 제조하는 방법을 제공한다. 이와 같은 펩타이드 합성은 본 발명의 인터루킨 2 아날로그 서열이 제공되어 있는 바, 공지의 펩타이드 합성법을 이용해 제한없이 제조할 수 있다.
인터루킨 2 아날로그, 및 변이는 상기에서 설명한 바와 같다.
본 발명을 구현하기 위한 다른 양태는, 천연형 인터루킨 2에서 하나 이상의 아미노산을 변이시키는 단계를 포함하는, 인터루킨 2 알파 수용체 결합력을 증가시키는 방법이다. 본 발명의 하나의 구체적인 양태는 천연형 인터루킨 2에서 하나 이상의 아미노산을 변이시켜 인터루킨 2 알파 수용체에 대한 결합력을 증가시키는 방법이다.
본 발명에 따른 인터루킨 2 알파 수용체 결합력을 증가시키는 방법은, 천연형 인터루킨 2 또는 알데스루킨에 비해 인터루킨 2 알파 수용체에 대한 결합력을 증가시키는 것일 수 있다. 상기 방법으로 인터루킨 2 아날로그의 인터루킨 2 알파 수용체에 대한 결합력을 알데스루킨에 비해 약 100% 이상, 200% 이상, 300% 이상, 400% 이상, 500% 이상, 600% 이상, 700% 이상, 800% 이상, 또는 그 이상 증가시킬 수 있으나, 이에 제한되지 않는다.
구체적으로, 상기 방법은 천연형 인터루킨 2에서 1번, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산 중 하나 이상의 아미노산에 변이를 도입시키는 단계를 포함하는 것일 수 있다.
본 발명의 방법의 한 예로, 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산으로 이루어진 군에서 선택된 하나 또는 그 이상의 아미노산에 변이를 도입시키는 단계를 포함하는 것일 수 있다.
보다 구체적으로는,
(a) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 20번 및 68번 아미노산을 다른 아미노산으로 치환시키거나;
(b) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 20번, 61번 및 68번 아미노산을 다른 아미노산으로 치환시키거나;
(c) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번, 126번 및 130번 아미노산을 다른 아미노산으로 치환시키거나;
(d) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번 및 69번 아미노산을 다른 아미노산으로 치환시키거나;
(e) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번 및 91번 아미노산을 다른 아미노산으로 치환시키거나;
(f) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 19번 및 68번 아미노산을 다른 아미노산으로 치환시키거나; 또는
(g) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 42번 및 68번 아미노산을 다른 아미노산으로 치환시키는 것일 수 있으나, 이에 제한되지 않는다.
더 구체적인 예로는,
(a) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 20번 아미노산을 페닐알라닌으로, 68번 아미노산을 아스파르트산으로 치환시키거나;
(b) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 20번 아미노산을 페닐알라닌으로, 61번 아미노산을 아스파르트산으로, 68번 아미노산을 아스파르트산으로 치환시키거나;
(c) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 68번 아미노산을 아스파르트산으로, 126번 아미노산을 쓰레오닌으로, 130번 아미노산을 아르기닌으로 치환시키거나;
(d) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 68번 아미노산을 아스파르트산으로, 69번 아미노산을 글리신으로 치환시키거나;
(e) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 68번 아미노산을 아스파르트산으로, 91번 아미노산을 쓰레오닌으로 치환시키거나;
(f) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 19번 아미노산을 발린으로, 68번 아미노산을 아스파르트산으로 치환시키거나; 또는
(g) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번 아미노산을 세린으로, 42번 아미노산을 트립토판으로, 68번 아미노산을 아스파르트산으로 치환시키는 것일 수 있으나, 이에 제한되지 않는다.
인터루킨 2 아날로그, 변이, 결합력의 증가는 상기에서 설명한 바와 같다.
본 발명을 구현하기 위한 다른 양태는 서열번호 3 내지 9의 아미노산 서열로 이루어진 군에서 선택되는 어느 하나의 서열을 포함하는 인터루킨 2 아날로그를 제공한다.
인터루킨 2 아날로그, 변이, 및 서열번호로 표현되는 아날로그의 정의는 상기에서 설명한 바와 같다.
구체적으로, 상기 인터루킨 2 아날로그는 서열번호 3 내지 9의 아미노산 서열로 이루어진 군에서 선택되는 어느 하나의 서열을 포함하거나, 필수적으로 구성되거나, 구성되는 것일 수 있으나, 이에 제한되지 않는다.
한편, 본원 명세서에서 문맥상 달리 요구하지 않는 한, “포함한다”, “포함하는”, “함유하는”, 등의 표현은 명시된 정수(integer) 또는 정수 그룹의 포함을 의미하지만, 다른 정수 또는 정수의 집합을 배제하는 것이 아니라고 이해되어야 한다.　
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것은 아니다.
실시예 1: 천연형 인터루킨 2 및 인터루킨 2 아날로그 발현 벡터의 제작
133개의 아미노산을 코딩하는 천연형 인터루킨 2 발현 벡터를 제작하기 위해, 보고된 인터루킨 2 서열 (NM_000586.3)을 바탕으로 합성한 인터루킨 2를 pET-22b 벡터 (Novagen)에 클로닝하였다. 아울러, 상기 인터루킨 2를 주형으로 하여 인터루킨 2의 아미노산을 변형시킨 신규한 인터루킨 2 아날로그를 제작하였다.
하기 표 1에 각각의 아미노산의 변화 서열 및 아날로그 이름을 나타냈다. 이들 인터루킨 2 아날로그들을 제작하기 위해 순방향 (F) 및 역방향 (R) 프라이머를 합성한 후 (표 2), PCR을 진행하여 각각의 아날로그 유전자를 증폭하였다.
표 2의 프라이머 서열은 표 1에 나타낸 아날로그들의 서열변화를 위한 각각 순방향 및 역방향 프라이머를 나타낸다. 각 아날로그별 해당되는 변이 서열 프라이머를 사용하여 돌연변이 PCR (mutegenesis PCR) 을 반복적으로 수행하여 서열을 얻어내었다. 하기 표 2의 볼드체는 변이 위치를 나타낸 것이다.
인터루킨 2 아날로그 종류와 변이 위치 및 그 변화 서열
아날로그 변이 위치 및 변화 서열 서열번호
아날로그 #1 delA1, C125S 2
아날로그 #2 delA1, C125S, D20F, E68D 3
아날로그 #3 delA1, C125S, D20F, E61D, E68D 4
아날로그 #4 delA1, C125S, E68D, Q126T, S130R 5
아날로그 #5 delA1, C125S, E68D, V69G 6
아날로그 #6 delA1, C125S, E68D, V91T 7
아날로그 #7 delA1, C125S, E68D, L19V 8
아날로그 #8 delA1, C125S, E68D, F42W 9
delA1은 인터루킨 2의 첫번째 아미노산인 알라닌을 결실시킨 것을 의미한다.
인터루킨 2 아날로그 변이 증폭을 위한 프라이머
변이 위치 서열 서열번호
delA1 F: CGCCATATGCCTACTTCAAGTTCTACAAAGAAAA 18
R: CGGGATCCTCAAGTCAGTGTTGAGATGATGCTTT 19
C125S F: AGATGGATTACCTTTAGTCAAAGCATCATCTCA 20
R: TGAGATGATGCTTTGACTAAAGGTAATCCATCT 21
L19V F: GAGCATTTACTGGTGGATTTACAGATGATTTTG 22
R: CAAAATCATCTGTAAATCCACCAGTAAATGCTC 23
D20F F: GGAGCATTTACTGCTGTTTTTACAGATGATTTTG 24
R: CAAAATCATCTGTAAAAACAGCAGTAAATGCTCC 25
F42W F: ACCAGGATGCTCACATGGAAGTTTTACATGCCC 26
R: GGGCATGTAAAACTTCCATGTGAGCATCCTGGT 27
E61D F: CTTCAGTGTCTAGAAGACGAACTCAAACCTCTGG 28
R: CCAGAGGTTTGAGTTCGTCTTCTAGACACTGAAG 29
E68D F: CTCAAACCTCTGGAGGACGTGCTAAATTTAGCT 30
R: AGCTAAATTTAGCACGTCCTCCAGAGGTTTGAG 31
E68D, V69G F: CCTCTGGAGGACGGGCTAAATTTAGCTC 32
R: GAGCTAAATTTAGCCCGTCCTCCAGAGG 33
V91T F: CAGCAATATCAACACAATAGTTCTGGAACTAAAG 34
R: CTTTAGTTCCAGAACTATTGTGTTGATATTGCTG 35
Q126T, S130R F: GTACAAGCATCATCCGAACACTGACTTGA 36
R: TCAAGTCAGTGTTCGGATGATGCTTGTAC 37
인터루킨 2 아날로그 증폭을 위한 PCR 조건은 95℃ 30초, 55℃ 에서 60초, 65℃에서 6.5분으로 이 과정을 16회 반복하였다. 원하는 부위의 아미노산이 정상적으로 바뀌어 있는지 여부를 확인하기 위해, 상기 조건에서 얻어진 돌연변이 (mutagenesis) 산물은 서열 분석을 수행하였으며, 각각의 인터루킨 2 아날로그들의 목적하는 변이 위치에 변이된 서열로 치환된 것을 확인하였다. 이렇게 얻어진 발현 벡터를 pET22b-인터루킨 2 아날로그 1 내지 8이라 명명하였다.
하기 표 3에 각각의 인터루킨 2 아날로그 1 내지 8까지의 DNA 서열 및 단백질 서열을 나타냈다. 하기 표 3 내의 볼드체는 변이 위치를 나타낸 것이다.
인터루킨 2 아날로그 DNA 서열 및 단백질 서열
아날로그 서열 서열번호
아날로그 #1
 DNA CCTACTTCAAGT TCTACAAAGA AAACACAGCT ACAACTGGAG CATTTACTGC TGGATTTACA GATGATTTTG AATGGAATTA ATAATTACAA GAATCCCAAA CTCACCAGGA TGCTCACATT TAAGTTTTAC ATGCCCAAGA AGGCCACAGA ACTGAAACAT CTTCAGTGTC TAGAAGAAGA ACTCAAACCT CTGGAGGAAG TGCTAAATTT AGCTCAAAGC AAAAACTTTC ACTTAAGACC CAGGGACTTA ATCAGCAATA TCAACGTAAT AGTTCTGGAA CTAAAGGGAT CTGAAACAAC ATTCATGTGT GAATATGCTG ATGAGACAGC AACCATTGTA GAATTTCTGA ACAGATGGAT TACCTTTAGT CAAAGCATCA TCTCAACACT GACTTGA 10
단백질 PTSSSTKKTQ LQLEHLLLDL QMILNGINNY KNPKLTRMLT FKFYMPKKAT ELKHLQCLEE ELKPLEEVLN LAQSKNFHLR PRDLISNINV IVLELKGSET TFMCEYADET ATIVEFLNRW ITFSQSIIST LT 2
아날로그 #2 DNA CCTACTTCAAGT TCTACAAAGA AAACACAGCT ACAACTGGAG CATTTACTGC TGTTTTTACA GATGATTTTG AATGGAATTA ATAATTACAA GAATCCCAAA CTCACCAGGA TGCTCACATT TAAGTTTTAC ATGCCCAAGA AGGCCACAGA ACTGAAACAT CTTCAGTGTC TAGAAGAAGA ACTCAAACCT CTGGAGGACG TGCTAAATTT AGCTCAAAGC AAAAACTTTC ACTTAAGACC CAGGGACTTA ATCAGCAATA TCAACGTAAT AGTTCTGGAA CTAAAGGGAT CTGAAACAAC ATTCATGTGT GAATATGCTG ATGAGACAGC AACCATTGTA GAATTTCTGA ACAGATGGAT TACCTTTAGT CAAAGCATCA TCTCAACACT GACTTGA 11
단백질 PTSSSTKKT QLQLEHLLLF LQMILNGINN YKNPKLTRML TFKFYMPKKA TELKHLQCLE EELKPLEDVL NLAQSKNFHL RPRDLISNIN VIVLELKGSE TTFMCEYADE TATIVEFLNR WITFSQSIIS TLT 3
아날로그 #3 DNA CCTACTTCAAGT TCTACAAAGA AAACACAGCT ACAACTGGAG CATTTACTGC TGTTTTTACA GATGATTTTG AATGGAATTA ATAATTACAA GAATCCCAAA CTCACCAGGA TGCTCACATT TAAGTTTTAC ATGCCCAAGA AGGCCACAGA ACTGAAACAT CTTCAGTGTC TAGAAGACGA ACTCAAACCT CTGGAGGACG TGCTAAATTT AGCTCAAAGC AAAAACTTTC ACTTAAGACC CAGGGACTTA ATCAGCAATA TCAACGTAAT AGTTCTGGAA CTAAAGGGAT CTGAAACAAC ATTCATGTGT GAATATGCTG ATGAGACAGC AACCATTGTA GAATTTCTGA ACAGATGGAT TACCTTTAGT CAAAGCATCA TCTCAACACT GACTTGA 12
단백질 PTSSSTKKT QLQLEHLLLF LQMILNGINN YKNPKLTRML TFKFYMPKKA TELKHLQCLE DELKPLEDVL NLAQSKNFHL RPRDLISNIN VIVLELKGSE TTFMCEYADE TATIVEFLNR WITFSQSIIS TLT 4
아날로그 #4 DNA CCTACTTCAAGT TCTACAAAGA AAACACAGCT ACAACTGGAG CATTTACTGC TGGATTTACA GATGATTTTG AATGGAATTA ATAATTACAA GAATCCCAAA CTCACCAGGA TGCTCACATT TAAGTTTTAC ATGCCCAAGA AGGCCACAGA ACTGAAACAT CTTCAGTGTC TAGAAGAAGA ACTCAAACCT CTGGAGGACG TGCTAAATTT AGCTCAAAGC AAAAACTTTC ACTTAAGACC CAGGGACTTA ATCAGCAATA TCAACGTAAT AGTTCTGGAA CTAAAGGGAT CTGAAACAAC ATTCATGTGT GAATATGCTG ATGAGACAGC AACCATTGTA GAATTTCTGA ACAGATGGAT TACCTTTAGT ACAAGCATCA TCCGAACACT GACTTGA 13
단백질 PTSSSTKKT QLQLEHLLLD LQMILNGINN YKNPKLTRML TFKFYMPKKA TELKHLQCLE EELKPLEDVL NLAQSKNFHL RPRDLISNIN VIVLELKGSE TTFMCEYADE TATIVEFLNR WITFSTSIIR TLT 5
아날로그 #5 DNA CCTACTTCAAGT TCTACAAAGA AAACACAGCT ACAACTGGAG CATTTACTGC TGGATTTACA GATGATTTTG AATGGAATTA ATAATTACAA GAATCCCAAA CTCACCAGGA TGCTCACATT TAAGTTTTAC ATGCCCAAGA AGGCCACAGA ACTGAAACAT CTTCAGTGTC TAGAAGAAGA ACTCAAACCT CTGGAGGACG GGCTAAATTT AGCTCAAAGC AAAAACTTTC ACTTAAGACC CAGGGACTTA ATCAGCAATA TCAACGTAAT AGTTCTGGAA CTAAAGGGAT CTGAAACAAC ATTCATGTGT GAATATGCTG ATGAGACAGC AACCATTGTA GAATTTCTGA ACAGATGGAT TACCTTTAGT CAAAGCATCA TCTCAACACT GACTTGA 14
단백질 PTSSSTKKT QLQLEHLLLD LQMILNGINN YKNPKLTRML TFKFYMPKKA TELKHLQCLE EELKPLEDGL NLAQSKNFHL RPRDLISNIN VIVLELKGSE TTFMCEYADE TATIVEFLNR WITFSQSIIS TLT 6
아날로그 #6 DNA CCTACTTCAAGT TCTACAAAGA AAACACAGCT ACAACTGGAG CATTTACTGC TGGATTTACA GATGATTTTG AATGGAATTA ATAATTACAA GAATCCCAAA CTCACCAGGA TGCTCACATT TAAGTTTTAC ATGCCCAAGA AGGCCACAGA ACTGAAACAT CTTCAGTGTC TAGAAGAAGA ACTCAAACCT CTGGAGGACG TGCTAAATTT AGCTCAAAGC AAAAACTTTC ACTTAAGACC CAGGGACTTA ATCAGCAATA TCAACACAAT AGTTCTGGAA CTAAAGGGAT CTGAAACAAC ATTCATGTGT GAATATGCTG ATGAGACAGC AACCATTGTA GAATTTCTGA ACAGATGGAT TACCTTTAGT CAAAGCATCA TCTCAACACT GACTTGA 15
단백질 PTSSSTKKT QLQLEHLLLD LQMILNGINN YKNPKLTRML TFKFYMPKKA TELKHLQCLE EELKPLEDVL NLAQSKNFHL RPRDLISNIN TIVLELKGSE TTFMCEYADE TATIVEFLNR WITFSQSIIS TLT 7
아날로그 #7 DNA CCTACTTCAAGT TCTACAAAGA AAACACAGCT ACAACTGGAG CATTTACTGG TGGATTTACA GATGATTTTG AATGGAATTA ATAATTACAA GAATCCCAAA CTCACCAGGA TGCTCACATT TAAGTTTTAC ATGCCCAAGA AGGCCACAGA ACTGAAACAT CTTCAGTGTC TAGAAGAAGA ACTCAAACCT CTGGAGGACG TGCTAAATTT AGCTCAAAGC AAAAACTTTC ACTTAAGACC CAGGGACTTA ATCAGCAATA TCAACGTAAT AGTTCTGGAA CTAAAGGGAT CTGAAACAAC ATTCATGTGT GAATATGCTG ATGAGACAGC AACCATTGTA GAATTTCTGA ACAGATGGAT TACCTTTAGT CAAAGCATCA TCTCAACACT GACTTGA 16
단백질 PTSSSTKKT QLQLEHLLVD LQMILNGINN YKNPKLTRML TFKFYMPKKA TELKHLQCLE EELKPLEDVL NLAQSKNFHL RPRDLISNIN VIVLELKGSE TTFMCEYADE TATIVEFLNR WITFSQSIIS TLT 8
아날로그 #8 DNA CCTACTTCAAGT TCTACAAAGA AAACACAGCT ACAACTGGAG CATTTACTGC TGGATTTACA GATGATTTTG AATGGAATTA ATAATTACAA GAATCCCAAA CTCACCAGGA TGCTCACATG GAAGTTTTAC ATGCCCAAGA AGGCCACAGA ACTGAAACAT CTTCAGTGTC TAGAAGAAGA ACTCAAACCT CTGGAGGACG TGCTAAATTT AGCTCAAAGC AAAAACTTTC ACTTAAGACC CAGGGACTTA ATCAGCAATA TCAACGTAAT AGTTCTGGAA CTAAAGGGAT CTGAAACAAC ATTCATGTGT GAATATGCTG ATGAGACAGC AACCATTGTA GAATTTCTGA ACAGATGGAT TACCTTTAGT CAAAGCATCA TCTCAACACT GACTTGA 17
단백질 PTSSSTKKT QLQLEHLLLD LQMILNGINN YKNPKLTRML TWKFYMPKKA TELKHLQCLE EELKPLEDVL NLAQSKNFHL RPRDLISNIN VIVLELKGSE TTFMCEYADE TATIVEFLNR WITFSQSIIS TLT 9
실시예 2: 인터루킨 2 아날로그의 발현
상기 실시예 1에서 제조한 발현 벡터를 이용하여, T7 프로모터 조절하의 재조합 인터루킨 2 아날로그를 발현시켰다. 각각의 재조합 인터루킨 2 아날로그 발현 벡터로 발현 대장균 균주, E.coli BL21DE3(E. coli B F-dcm ompT hsdS(rB-mB-) gal λ(DE3); 노바젠)을 형질 전환하였다. 형질전환 방법은 노바젠사에서 추천하는 방법을 이용하였다. 각 재조합 발현 벡터가 형질 전환된 각각의 단일 콜로니를 취하여, 암피실린(50㎍/ml)이 포함된 2X 루리아 브로스(Luria Broth) 배지에 접종하고, 37℃에서 15시간 동안 배양하였다. 재조합 균주 배양액과 30% 글리세롤이 포함된 2X LB 배지를 1:1(v/v)의 비율로 혼합하여, 각 1 ml씩 cryo-튜브에 분주하고, -150℃에 보관하였다. 이를 재조합 단백질의 생산을 위한 세포 스톡(cell stock)으로 사용하였다.
재조합 인터루킨 2 아날로그들의 발현을 위하여, 각 세포 스톡 1 바이알(vial)을 녹여 500 ml의 2X LB에 접종하고, 37℃에서 14 ~ 16시간 동안 진탕 배양하였다. 600 nm에서의 흡광도 값이 4.0 이상을 나타내면 배양을 종료하고, 이를 종 배양액으로 사용하였다. 5 L 발효기(Bioflo-320, NBS, 미국)를 이용하여, 종 배양액을 1.6 L의 발효 배지에 접종하고, 초기 발효를 시작하였다. 배양조건은 온도 37℃ 공기량 2.0 L/min(1vvm), 교반 속도 650 rpm 및 30% 암모니아수를 사용하여, pH 6.70으로 유지시켰다. 발효 진행은 배양액 내의 영양소가 제한되었을 때, 추가 배지(feeding solution)을 첨가하여 유가배양을 진행하였다. 균주의 성장은 흡광도로 관측하였고, 흡광도 값 70 이상에서 최종 농도 500 μM의 IPTG를 도입하였다. 배양은 IPTG 도입 후 약 23~25시간까지 더 진행하였으며, 배양 종료 후 원심 분리기를 사용하여 재조합 균주를 수확하여 사용 시까지 -80℃에 보관하였다.
실시예 3: 인터루킨 2 아날로그의 추출 및 재접힘(refolding)
상기 실시예 2에서 얻은 인터루킨 2 아날로그 발현 대장균으로부터 인터루킨 2 아날로그를 가용성 형태로 바꾸기 위해 세포를 파쇄하고 재접힘하였다. 배양액 100 mL 분량에 해당하는 세포 펠렛을 1 - 200 mL의 파쇄 완충 용액 (20 mM Tris-HCl pH 9.0, 1 mM EDTA pH 9.0, 0.2 M NaCl, 0.5% Triton X-100)에 부유시킨 후, 미세용액화(Microfludizer)를 이용하여 15,000 psi로 재조합 대장균을 파쇄하였다. 13,900 g에서 30분간 원심분리하여 상층액을 버리고, 400 mL의 첫번째 세척 완충 용액(50 mM Tris-HCl pH 8.0, 5 mM EDTA pH9.0)으로 펠렛을 세척하였다. 상기와 동일 조건으로 원심분리하여 상층액을 버리고, 펠렛을 400 mL의 두번째 세척 완충 용액(50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0, 2% Triton X-100)으로 펠렛을 세척하였다. 상기와 동일 조건으로 원심분리하여 상층액을 버리고, 펠렛을 400 mL의 세번째 세척 완충 용액(50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0, 1% sodium deoxycholorate)으로 펠렛을 세척하였다. 상기와 동일 조건으로 원심분리하여 상층액을 버리고, 펠렛을 400 mL의 네번째 세척 완충 용액(50 mM Tris-HCl pH 8.0, 5 mM EDTA pH 9.0, 1 M NaCl)으로 펠렛을 세척하였다. 상기와 동일 조건으로 원심분리하여 세척된 대장균 봉입체 (inclusion body) 펠렛을 수득하였다. 세척된 봉입체 펠렛을 400 mL의 가용/환원화 완충액 (6 M Guanidine, 100 mM Tris pH 8.0, 2 mM EDTA pH 9.0, 50 mM DTT)에 재부유하여 50℃에서 30분 동안 교반하였다. 가용/환원된 인터루킨 2 아날로그에 증류수 100 mL를 넣어 6 M Guanidine을 4.8 M Guanidine으로 희석한 후 13,900 g에서 30분간 원심분리하여 펠렛은 버리고 용액만 수득하였다. 희석된 용액에 증류수 185.7 mL를 추가로 넣어 4.8 M Guanidine을 3.5 M Guanidine으로 희석한 후 100% acetic acid를 이용하여 pH를 5.0로 맞추었다. pH 조정된 용액을 상온에서 1시간 교반하였다. 불순물이 침전된 용액은 13,900 g에서 30분간 원심분리하여 상층액을 버리고, 펠렛을 마지막 세척 완충 용액 (3.5 M Guanidine, 20 mM Sodium Acetate pH 5.0, 5 mM DTT)으로 펠렛을 세척하였다. 상기와 동일 조건으로 원심분리하여 펠렛을 수득하였다. 세척된 인터루킨 2 아날로그를 400 mL의 재접힘 완충 용액 (6 mM Guanidine, 100 mM Tris pH 8.0, 0.1 mM CuCl2)으로 용해시킨다. 혼합용액을 4℃에서 15 - 24 시간 동안 교반함으로서 재접힘 과정을 수행하였다.
실시예 4: 크기 배제 컬럼 크로마토그래피
상기 실시예 3에서 얻은 인터루킨 2 아날로그 재접힘 용액을 크기 배제 컬럼에 적용하여 정제하기 위하여 1 mL이하로 농축하였다. 컬럼은 재접힘 용액 도입 전 완충 용액 (2 M Guanidine, 100 mM Tris pH 8.0)으로 평형화하였고, 재접힘 용액 도입 후 완충 용액 흘려주어 용출하였다. 용출된 시료는 Guanidine을 포함하고 있어 안정화 용액 (10 mM Sodium Acetate pH 4.5, 5% Trehalose)으로 바꿔준 후 RP-HPLC, peptide mapping 분석을 통해 순도를 측정하였다. 측정된 순도가 80% 이상이면 실험에 사용하였다.
실시예 5: 인터루킨 2 아날로그의 알파 수용체 결합력 평가
상기 실시예 4에서 얻은 인터루킨 2 아날로그들의 인터루킨 2 알파 수용체 결합력을 측정하기 위하여 표면 플라스몬 공명 측정(surface plasmon resonance, SPR, BIACORE T200, GE healthcare사)을 사용하였다.
먼저 CM5칩(GE healthcare사)에 아민 결합법(amine coupling)을 통해 항 인간 면역글로불린 항체(Abcam사, #ab97221)를 약 5,000 RU (resonance unit)만큼 고정화한 후, 항원 항체 결합 반응을 이용하여 인간 면역글로불린 Fc부위가 결합된 인터루킨 2 알파 수용체(SYMANSIS사, #4102H)를 각각 면역글로불린 항체에 결합시켜 최종 고정화 하였다. 그 다음으로 상기에서 재조한 재조합 인터루킨 2 아날로그들을 농도별로 희석하고 인터루킨 2 알파 수용체가 최종 고정된 CM5칩에 흘려주어 인터루킨 2 알파 수용체의 결합력을 측정하였다. 결합력은 결합 속도 상수(Ka)와 해리 속도 상수(Kd)를 이용하여 측정하였으며, 10 μL/분의 유속으로 인터루킨 2 아날로그들을 3분간 흘려 결합 속도를 측정하고, 동일한 시간과 유속으로 실험 버퍼만 흘려 주어 인터루킨 2 알파 수용체로부터의 해리 속도를 측정하였다. 측정이 완료되면, Biaevaluation 프로그램에서 1:1 binding fitting model에 따라 수용체의 결합력 평가를 진행하였다. 평가된 결합력은 하기의 식에 따라 아날로그 #1(서열번호 2)의 결합력 대비 상대적 결합력으로 표시하였다.
[식 1]
Figure PCTKR2022021040-appb-img-000001
시험 결과(도 1 및 표 4)에서 명시된 바와 같이 인터루킨 2 아날로그 2번, 3번, 4번, 5번, 6번, 7번, 8번의 인터루킨 2 알파 수용체 결합력은 대조군으로 사용한 서열번호 2의 아날로그 1에 비하여 높은 결합력이 확인되었다.
아날로그 #1 (알데스루킨) 대비 인터루킨 2 아날로그의 인터루킨 2 알파 수용체 상대적 결합력
인터루킨 2 수용체 시험 물질 상대적 결합력 (%)
알파 수용체 아날로그 #1 100.0
아날로그 #2 591.6
아날로그 #3 532.3
아날로그 #4 524.0
아날로그 #5 544.1
아날로그 #6 836.6
아날로그 #7 665.4
아날로그 #8 127.5
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있음을 이해할 수 있다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 제한적인 것이 아닌 것으로 이해하여야 한다. 본 발명의 범위는 전술한 상세한 설명보다는 후술되는 특허 청구범위의 의미 및 범위, 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (17)

  1. 알데스루킨에 비해 인터루킨 2 알파 수용체 결합력이 증가된 인터루킨 2 아날로그로서, 상기 인터루킨 2 아날로그는 천연형 인터루킨 2에서 1번, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 위치에 상응하는 아미노산 중 하나 이상의 아미노산이 변이된 서열을 포함하는 인터루킨 2 아날로그.
  2. 제1항에 있어서, 상기 인터루킨 2 아날로그는 하기 일반식 1의 아미노산 서열을 포함하는 것인, 인터루킨 2 아날로그:
    X1-PTSSSTKKTQLQLEHLL-X19-X20-LQMILNGINNYKNPKLTRMLT-X42-KFYMPKKATELKHLQCLE-X61-ELKPLE-X68-X69-LNLAQSKNFHLRPRDLISNIN-X91-IVLELKGSETTFMCEYADETATIVEFLNRWITFS-X126-SII-X130-TLT (일반식 1, 서열번호 38)
    상기 일반식 1에서,
    X1은 결실이고,
    X19는 루신(L), 또는 발린(V)이고,
    X20은 페닐알라닌(F), 또는 아스파르트산(D)이고,
    X42는 페닐알라닌(F), 또는 트립토판(W)이고,
    X61은 아스파르트산(D), 또는 글루탐산(E)이고,
    X68은 아스파르트산(D)이고,
    X69는 발린(V), 또는 글리신(G)이고,
    X91은 발린(V), 또는 트레오닌(T)이고,
    X126은 글루타민(Q), 또는 트레오닌(T)이고,
    X130은 세린(S) 또는 아르기닌(R)임.
  3. 제1항에 있어서, 상기 변이는 천연형 인터루킨 2 중 하나 이상의 아미노산이 치환(substitution), 추가(addition), 제거(deletion), 수식(modification) 및 이들의 조합으로 이루어지는 군에서 선택된 변이인, 인터루킨 2 아날로그.
  4. 제1항 내지 제3항 중 어느 한 항에 있어서, 상기 인터루킨 2 아날로그는 천연형 인터루킨 2 중 1번 아미노산이 변이되거나, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 아미노산으로 이루어진 군에서 선택된 하나 또는 그 이상의 아미노산이 다른 아미노산으로 변이된 것인, 인터루킨 2 아날로그.
  5. 제1항 내지 제4항 중 어느 한 항에 있어서, 상기 인터루킨 2 아날로그는 하기 아날로그 중 어느 하나인 것인 인터루킨 2 아날로그:
    (a) 천연형 인터루킨 2 중 1번 아미노산이 변이된, 인터루킨 2 아날로그;
    (b) 천연형 인터루킨 2 중 19번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
    (c) 천연형 인터루킨 2 중 20번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
    (d) 천연형 인터루킨 2 중 42번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
    (e) 천연형 인터루킨 2 중 61번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
    (f) 천연형 인터루킨 2 중 68번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
    (g) 천연형 인터루킨 2 중 69번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
    (h) 천연형 인터루킨 2 중 91번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
    (i) 천연형 인터루킨 2 중 126번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그;
    (j) 천연형 인터루킨 2 중 130번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그; 및
    (l) 천연형 인터루킨 2 중 125번 아미노산이 다른 아미노산으로 변이된, 인터루킨 2 아날로그.
  6. 제1항 내지 제5항 중 어느 한 항에 있어서, 상기 인터루킨 2 아날로그는 하기 아날로그 중 어느 하나인 것인 인터루킨 2 아날로그:
    (a) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 20번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
    (b) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 20번, 61번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
    (c) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번, 126번 및 130번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
    (d) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번 및 69번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
    (e) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 68번 및 91번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그;
    (f) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 19번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그; 및
    (g) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번, 42번 및 68번 아미노산이 다른 아미노산으로 치환된, 인터루킨 2 아날로그.
  7. 제1항 내지 제6항 중 어느 한 항에 있어서, 상기 인터루킨 2 아날로그는 하기 아날로그 중 어느 하나인 것인 인터루킨 2 아날로그:
    (a) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 20번 아미노산이 페닐알라닌으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그;
    (b) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 20번 아미노산이 페닐알라닌으로, 61번 아미노산이 아스파르트산으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그;
    (c) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 126번 아미노산이 트레오닌으로, 130번 아미노산이 아르기닌으로 치환된, 인터루킨 2 아날로그;
    (d) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 69번 아미노산이 글리신으로 치환된, 인터루킨 2 아날로그;
    (e) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 68번 아미노산이 아스파르트산으로, 91번 아미노산이 트레오닌으로 치환된, 인터루킨 2 아날로그;
    (f) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 19번 아미노산이 발린으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그; 및
    (g) 천연형 인터루킨 2 중 1번 아미노산이 제거되고, 125번 아미노산이 세린으로, 42번 아미노산이 트립토판으로, 68번 아미노산이 아스파르트산으로 치환된, 인터루킨 2 아날로그.
  8. 제1항 내지 제7항 중 어느 한 항에 있어서, 상기 인터루킨 2 아날로그는 서열번호 3 내지 9의 아미노산 서열로 이루어진 군에서 선택된 것인, 인터루킨 2 아날로그.
  9. 제1항 내지 제8항 중 어느 한 항에 있어서, 상기 인터루킨 2 알파 수용체 결합력의 증가는 알데스루킨과 비교하여 결합력이 500% 이상 증가된 것인, 인터루킨 2 아날로그.
  10. 제1항 내지 제9항 중 어느 한 항에 있어서, 상기 인터루킨 2 아날로그는 서열번호 3 내지 8의 아미노산 서열 중 어느 하나의 서열을 포함하는 것인, 인터루킨 2 아날로그.
  11. 제 1항 내지 제10항 중 어느 한 항에 있어서, 상기 인터루킨 2 아날로그는 C-말단에 하나 이상의 아미노산이 추가로 포함되는 것인, 인터루킨 2 아날로그.
  12. 제1항 내지 제11항 중 어느 한 항의 인터루킨 2 아날로그를 코딩하는, 분리된 핵산.
  13. 제12항에 따른 핵산을 포함하는, 재조합 발현 벡터.
  14. 제13항에 따른 재조합 발현 벡터를 포함하는, 인간을 제외한 형질전환체.
  15. 천연형 인터루킨 2에서 하나 이상의 아미노산을 변이시키는 단계를 포함하는, 알데스루킨과 비교하여 인터루킨 2 아날로그의 인터루킨 2 알파 수용체 결합력을 증가시키는 방법.
  16. 제15항에 있어서, 상기 변이는 천연형 인터루킨 2 중 1번을 변이시키거나, 19번, 20번, 42번, 61번, 68번, 69번, 91번, 125번, 126번 및 130번 아미노산으로 이루어진 군에서 선택된 하나 또는 그 이상의 아미노산을 다른 아미노산으로 변이시키는 것인 방법.
  17. 제15항 또는 제16항에 있어서, 상기 변이는
    (a) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 20번 및 68번 아미노산을 다른 아미노산으로 치환시키거나;
    (b) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 20번, 61번 및 68번 아미노산을 다른 아미노산으로 치환시키거나;
    (c) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번, 126번 및 130번 아미노산을 다른 아미노산으로 치환시키거나;
    (d) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번 및 69번 아미노산을 다른 아미노산으로 치환시키거나;
    (e) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 68번 및 91번 아미노산을 다른 아미노산으로 치환시키거나;
    (f) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 19번 및 68번 아미노산을 다른 아미노산으로 치환시키거나; 또는
    (g) 천연형 인터루킨 2 중 1번 아미노산을 제거하고, 125번, 42번 및 68번 아미노산을 다른 아미노산으로 치환시키는 것인, 방법.
PCT/KR2022/021040 2021-12-22 2022-12-22 신규 면역 억제 인터루킨 2 (interleukin 2) 아날로그 WO2023121328A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0185260 2021-12-22
KR1020210185260A KR20230095612A (ko) 2021-12-22 2021-12-22 신규 면역 억제 인터루킨 2 (Interleukin 2) 아날로그

Publications (1)

Publication Number Publication Date
WO2023121328A1 true WO2023121328A1 (ko) 2023-06-29

Family

ID=86903132

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/021040 WO2023121328A1 (ko) 2021-12-22 2022-12-22 신규 면역 억제 인터루킨 2 (interleukin 2) 아날로그

Country Status (2)

Country Link
KR (1) KR20230095612A (ko)
WO (1) WO2023121328A1 (ko)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050142106A1 (en) * 2003-07-18 2005-06-30 Wittrup K. D. Mutant interleukin-2 (IL-2) polypeptides
KR20130118363A (ko) * 2011-02-10 2013-10-29 로슈 글리카트 아게 돌연변이 인터루킨-2 폴리펩티드
KR20190083656A (ko) * 2016-11-08 2019-07-12 데리니아, 인크. 자가면역 질환의 치료를 위한 il-2 변이체
KR20200078312A (ko) * 2018-12-21 2020-07-01 한미약품 주식회사 신규 면역 억제 인터루킨 2 (Interleukin 2) 아날로그
KR20210122200A (ko) * 2020-03-31 2021-10-08 한미약품 주식회사 신규한 면역 활성 인터루킨 2 아날로그

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20050142106A1 (en) * 2003-07-18 2005-06-30 Wittrup K. D. Mutant interleukin-2 (IL-2) polypeptides
KR20130118363A (ko) * 2011-02-10 2013-10-29 로슈 글리카트 아게 돌연변이 인터루킨-2 폴리펩티드
KR20190083656A (ko) * 2016-11-08 2019-07-12 데리니아, 인크. 자가면역 질환의 치료를 위한 il-2 변이체
KR20200078312A (ko) * 2018-12-21 2020-07-01 한미약품 주식회사 신규 면역 억제 인터루킨 2 (Interleukin 2) 아날로그
KR20210122200A (ko) * 2020-03-31 2021-10-08 한미약품 주식회사 신규한 면역 활성 인터루킨 2 아날로그

Also Published As

Publication number Publication date
KR20230095612A (ko) 2023-06-29

Similar Documents

Publication Publication Date Title
WO2021201615A1 (ko) 신규한 면역 활성 인터루킨 2 아날로그
WO2017116204A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체
WO2018056764A1 (ko) 인슐린 수용체와의 결합력이 감소된, 인슐린 아날로그 및 이의 용도
WO2015108398A1 (ko) 지속형 인슐린 및 그 용도
AU2016317449B2 (en) Novel insulin analogs and use thereof
WO2011142514A1 (ko) Pias3을 유효성분으로 포함하는 암 또는 면역질환의 예방 또는 치료용 조성물
WO2010064764A1 (en) Method of preparing piceatannol using bacterial cytochrome p450 and composition therefor
WO2019125059A1 (ko) 신규한 구조를 갖는 치료학적 효소 융합단백질 및 이의 용도
WO2019066586A1 (ko) 글루카곤 유사 펩타이드-2(glp-2) 유도체의 지속형 결합체
WO2019066570A1 (ko) 지속형 단쇄 인슐린 아날로그 및 이의 결합체
WO2020130300A1 (ko) 신규 면역 억제 인터루킨 2
WO2023121328A1 (ko) 신규 면역 억제 인터루킨 2 (interleukin 2) 아날로그
WO2015199386A1 (ko) 가용성 단백질 발현량이 증대된 헬리코박터 파일로리 유래 α-1,2 푸코실 전달효소의 유전자와 단백질 및 α-1,2 푸코실올리고당 생산에의 응용
WO2016122058A1 (ko) 세포성점균을 이용한 인간 페닐알라닌 수산화효소의 활성분석 방법
WO2019031804A9 (ko) 목적 유전자 발현 조절을 위한 대장균 및 코리네박테리움 글루타미쿰 셔틀 벡터
WO2022139493A1 (ko) TGF-β 신호전달을 억제할 수 있는 신규한 펩타이드 및 이의 용도
WO2022119380A1 (ko) 신규한 ace2 변이체 및 그의 이용
WO2021107519A1 (en) Biotin moiety-conjugated polypeptide and pharmaceutical composition for oral administration comprising the same
WO2022211537A1 (ko) 신규한 면역 활성 인터루킨 2 아날로그 결합체 및 이의 제조 방법
WO2022124708A1 (ko) 신규한 분지 연쇄 아미노산 아미노트렌스퍼라아제 변이체 및 이를 이용한 이소류신 생산 방법
WO2019132610A1 (ko) Baf57 재조합 융합 단백질 및 이의 용도
WO2019035672A1 (ko) 아실화 옥신토모듈린 펩타이드 유사체
WO2023038250A1 (ko) 폴리올 또는 점액성 고분자의 생성능이 조절된 재조합 미생물
WO2022065899A1 (ko) 글루카곤, glp-1 및 gip 수용체 모두에 활성을 갖는 삼중 활성체의 지속형 결합체의 다발성 경화증의 치료 용도
WO2024080824A1 (ko) 신규한 glp-1 수용체 길항제 및 이를 포함하는 선천성 고인슐린증 또는 저혈당증의 예방 또는 치료용 약학적 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22911961

Country of ref document: EP

Kind code of ref document: A1