WO2023058972A1 - 항 c-met 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물 - Google Patents

항 c-met 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물 Download PDF

Info

Publication number
WO2023058972A1
WO2023058972A1 PCT/KR2022/014294 KR2022014294W WO2023058972A1 WO 2023058972 A1 WO2023058972 A1 WO 2023058972A1 KR 2022014294 W KR2022014294 W KR 2022014294W WO 2023058972 A1 WO2023058972 A1 WO 2023058972A1
Authority
WO
WIPO (PCT)
Prior art keywords
vocal cord
antibody
met
pharmaceutical composition
amino acid
Prior art date
Application number
PCT/KR2022/014294
Other languages
English (en)
French (fr)
Inventor
김청수
Original Assignee
가톨릭대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭대학교 산학협력단 filed Critical 가톨릭대학교 산학협력단
Publication of WO2023058972A1 publication Critical patent/WO2023058972A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00—Drugs for disorders of the respiratory system
    • A61P11/04—Drugs for disorders of the respiratory system for throat disorders
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies

Definitions

  • the present invention relates to a pharmaceutical composition for the treatment of glottic insufficiency or vocal cord damage. More specifically, the present invention relates to a pharmaceutical composition for the treatment of glottic insufficiency or vocal cord damage, comprising an anti c-Met antibody as an active ingredient.
  • Glottic closure is important for voice production and airway protection.
  • vocal fold paralysis is caused by damage to the recurrent laryngeal nerve (RLN).
  • the recurrent laryngeal nerve innervates most of the intrinsic muscles.
  • damage to the recurrent laryngeal nerve also causes atrophy of the intrinsic muscles.
  • Laryngeal reinnervation surgery can prevent intrinsic muscle atrophy, but this treatment is technically difficult, requires a neck incision, and induces synchronous movement.
  • Some growth factors such as hepatocyte growth factor or fibroblast growth factor, have anti-fibrotic effects as well as prevent muscle atrophy.
  • HGF was unstable in form and had a short half-life, repeated injections were required to obtain good results.
  • C-MET is the transmembrane tyrosine kinase receptor for HGF. Since the antibody is more stable and has a longer half-life than HGF and can activate the C-MET receptor like HGF, the present inventors confirmed whether the C-Met agonist antibody can be used for muscle regeneration of the vocal cords.
  • the present inventors have made intensive research efforts to develop a pharmaceutical composition for treating glottic insufficiency or vocal cord damage.
  • the present invention was completed by identifying that the anti-c-Met antibody of the present invention has a better therapeutic effect on glottic insufficiency and vocal cord damage than HGF.
  • an object of the present invention is to provide a pharmaceutical composition for the treatment of glottic insufficiency or vocal cord damage, comprising an anti-c-Met antibody as an active ingredient.
  • Another object of the present invention is to provide a method for treating glottic insufficiency or vocal cord damage, comprising administering an anti-c-Met antibody to a subject.
  • the present invention provides a pharmaceutical composition for treating glottic insufficiency or vocal cord damage, comprising an anti c-Met antibody or an antigen-binding fragment as an active ingredient.
  • the anti-c-Met antibody or antigen-binding fragment is an antibody or antigen-binding fragment that specifically binds to c-Met.
  • the antibody or antigen-binding fragment specifically binding to c-Met includes:
  • CDR-H1 comprising the amino acid sequence of SEQ ID NO: 1
  • CDR-H2 comprising the amino acid sequence of SEQ ID NO: 2
  • CDR-H3 comprising the amino acid sequence of SEQ ID NO: 3
  • a light chain variable region comprising CDR-L1 comprising the amino acid sequence of SEQ ID NO: 4, CDR-L2 comprising the amino acid sequence of SEQ ID NO: 5, and CDR-L3 comprising the amino acid sequence of SEQ ID NO: 6.
  • the antibody or antigen-binding fragment specifically binding to c-Met includes:
  • a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 7 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 8.
  • the antibody or antigen-binding fragment thereof is scFv, but is not limited thereto.
  • c-Met (mesenchymal-epithelial transition factor) is a receptor tyrosine kinase encoded by the Met proto-oncogene expressed on the cell surface.
  • c-Met is a disulfide-linked dimer composed of an extracellular alpha subunit (50 kDa) and a transmembrane beta subunit (140 kDa).
  • c-Met contains an extracellular domain for ligand binding, a transmembrane portion, and a tyrosine kinase catalytic motif involved in the phosphorylation of tyrosine residues within the intracellular domain (Dean et al., Nature, 4: 318 (6044): 385, 1985; Park et al., PNAS, 84 (18): 6379, 1976; Maggiora et al., J. Cell Physiol., 173:183, 1997). Since c-Met's ligand is hepatocyte growth factor (HGF), c-Met can be expressed as a receptor for HGF.
  • HGF hepatocyte growth factor
  • c-Met activation induces a variety of biological effects leading to increases in cell growth, scattering and motility, invasion, protection from apoptosis, branching morphogenesis and angiogenesis. cause a reaction
  • c-Met protein has become a versatile therapeutic target.
  • Antibodies of the present invention can be produced using various phage display methods known in the art [Brinkman et al., 1995, J. Immunol. Methods, 182:41-50]; [Ames et al., 1995, J. Immunol. Methods, 184, 177-186]; [Kettleborough et al. 1994, Eur. J. Immunol, 24, 952-958]; [Persic et al., 1997, Gene, 187, 9-18]; and [Burton et al., 1994, Adv.
  • antibody is a specific antibody to c-Met, and includes antigen binding fragments of antibody molecules as well as complete antibody forms.
  • a complete antibody has a structure having two full-length light chains and two full-length heavy chains, and each light chain is linked to the heavy chain by disulfide bonds.
  • the heavy chain constant region has gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ), and epsilon ( ⁇ ) types, and subclasses include gamma 1 ( ⁇ 1), gamma 2 ( ⁇ 2), and gamma 3 ( ⁇ 3). ), gamma 4 ( ⁇ 4), alpha 1 ( ⁇ 1) and alpha 2 ( ⁇ 2).
  • the constant region of the light chain has kappa and lambda types (Cellular and Molecular Immunology, Wonsiewicz, M. J., Ed., Chapter 45, pp. 41-50, W. B. Saunders Co. Philadelphia, PA (1991); Nisonoff, A., Introduction to Molecular Immunology, 2nd Ed., Chapter 4, pp. 45-65, Sinauer Associates, Inc., Sunderland, MA (1984)).
  • the term "antigen-binding fragment” refers to a fragment having an antigen-binding function, such as Fab, F(ab'), F(ab') 2 , chemically linked F(ab') 2 and Fv, etc. includes Among antibody fragments, Fab has a structure having variable regions of light and heavy chains, constant regions of light chains, and a first constant region (CH1) of heavy chains, and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region containing one or more cysteine residues at the C-terminus of the heavy chain CH1 domain.
  • the F(ab') 2 antibody is produced by forming a disulfide bond between cysteine residues in the hinge region of Fab'.
  • Fv is a minimal antibody fragment having only the heavy chain variable region and the light chain variable region. Recombinant technology for generating Fv fragments is described in PCT International Publication Patent Applications WO 88/10649, WO 88/106630, WO 88/07085, WO 88/07086 and WO 88/09344.
  • the heavy chain variable region and the light chain variable region are connected by a non-covalent bond
  • the heavy chain variable region and the short chain variable region are generally shared through a peptide linker.
  • antibody fragments are linked by bonds or directly linked at the C-terminus, so that they can form a dimer-like structure like double-chain Fv.
  • Such antibody fragments can be obtained using proteolytic enzymes (eg, restriction digestion of whole antibodies with papain yields Fab and digestion with pepsin yields F(ab') 2 fragments), or It can be produced through genetic recombination technology.
  • the antibody is specifically scFv form or complete antibody form.
  • the heavy chain constant region may be selected from any one isotype of gamma ( ⁇ ), mu ( ⁇ ), alpha ( ⁇ ), delta ( ⁇ ) or epsilon ( ⁇ ).
  • the constant regions are gamma 1 (IgG1), gamma 2 (IgG2), gamma 3 (IgG3) and gamma 4 (IgG4).
  • the light chain constant region may be of the kappa or lambda type, specifically kappa type.
  • the term “heavy chain” refers to a full-length heavy chain comprising a variable region domain VH and three constant region domains CH1, CH2 and CH3 comprising an amino acid sequence having sufficient variable region sequence for conferring specificity to an antigen and a full-length heavy chain thereof I mean all fragments.
  • the term “light chain” as used herein refers to both a full-length light chain and fragments thereof comprising a variable region domain VL and a constant region domain CL comprising an amino acid sequence having sufficient variable region sequence to impart specificity to an antigen.
  • CDR complementarity determining region
  • the antibody or antigen-binding fragment thereof refers to a full-length or intact polyclonal or monoclonal antibody, as well as antigen-binding fragments thereof (eg, Fab, Fab', F(ab')2, Fab3 , Fv and variants thereof), fusion proteins comprising one or more antibody portions, human antibodies, humanized antibodies, chimeric antibodies, minibodies, diabodies, triabodies, tetrabodies, linear antibodies, single chain antibodies (scFv) , scFv-Fc, bispecific antibodies, multispecific antibodies, glycosylation variants of antibodies, amino acid sequence variants of antibodies and other modified configurations of immunoglobulin molecules containing antigen recognition sites of the necessary specificity, and covalent modifications containing antibodies.
  • antigen-binding fragments thereof eg, Fab, Fab', F(ab')2, Fab3 , Fv and variants thereof
  • fusion proteins comprising one or more antibody portions, human antibodies, humanized antibodies, chimeric
  • modified antibodies and antigen-binding fragments thereof include nanobodies, AlbudAbs, dual affinity re-targeting (DARTs), bispecific T-cell engagers (BiTEs), tandem diabodies (TandAbs), dual acting Fabs (DAFs), two- These include in-one antibodies, small modular immunopharmaceuticals (SMIPs), fynomers fused to antibodies (FynomAbs), dual variable domain immunoglobulins (DVD-Igs), peptide modified antibodies (CovX-bodies), duobodies and triomAbs.
  • SMIPs small modular immunopharmaceuticals
  • FynomAbs fused to antibodies
  • DVD-Igs dual variable domain immunoglobulins
  • CovX-bodies duobodies and triomAbs.
  • the list of such antibodies and antigen-binding fragments thereof is not limited to the above.
  • FR refers to variable domain residues other than hypervariable region (HVR) residues.
  • HVR hypervariable region
  • the FRs of a variable domain generally consist of four FR domains FR1, FR2, FR3 and FR4.
  • HVR and FR sequences generally appear in the following order in VH and VL/Vk:
  • the antibody or antigen-binding fragment may appear in the following order:
  • variable region refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to an antigen.
  • the variable domains of the heavy and light chains of native antibodies (VH and VL, respectively) generally have similar structures, each domain having four conserved framework regions (FR) and three hypervariable regions (HVR) ).
  • FR conserved framework regions
  • HVR hypervariable regions
  • a single VH or VL domain may be sufficient to confer antigen-binding specificity.
  • an antibody that binds to a particular antigen can be separated using a VH or VL domain from an antibody that binds the antigen and screens a library of complementary VL or VH domains, respectively.
  • the term "specifically binds" or the like means that an antibody or antigen-binding fragment thereof, or other construct such as an scFv, forms a complex with an antigen that is relatively stable under physiological conditions.
  • Specific binding is at least about 1 x 10 -6 M or less (eg, 9 x 10 -7 M, 8 x 10 -7 M, 7 x 10 -7 M, 6 x 10 -7 M , 5 x 10 -7 M , 4 x 10 -7 M, 3 x 10 -7 M, 2 x 10 -7 M, or 1 x 10 -7 M), specifically 1 x 10 -7 M or less (eg 9 x 10 -8 M , 8 x 10 -8 M, 7 x 10 -8 M, 6 x 10 -8 M, 5 x 10 -8 M, 4 x 10 -8 M, 3 x 10 -8 M, 2 x 10 -8 M , or 1 x 10 -8 M), more specifically 1 x 10 -8 M or less (eg 9 x
  • affinity refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (eg antibody) and its binding partner (eg antigen).
  • binding affinity refers to an intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen). indicates The affinity of a molecule Y with its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein.
  • human antibody refers to an amino acid sequence of an antibody produced by a human or a human cell, or an antibody derived from a non-human source that utilizes human antibody repertoires or other human antibody coding sequences. It has the corresponding amino acid sequence. This definition of a human antibody excludes humanized antibodies comprising non-human antigen-binding moieties.
  • a "chimeric" antibody is one in which a portion of the heavy and/or light chain is from a particular source or species and the remainder of the heavy and/or light chain is from a different source or species. means antibody.
  • humanized antibody refers to a chimeric immunoglobulin containing minimal sequence derived from a non-human immunoglobulin of a non-human (eg, mouse, chicken) antibody, an immunoglobulin chain or fragment thereof (e.g. eg Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequence of an antibody).
  • a humanized antibody is obtained in which residues of a complementarity-determining region (CDR) of the recipient are selected from a non-human species (donor antibody) having the desired specificity, affinity, and capacity, such as mouse, chicken, rat, or rabbit. It is a human immunoglobulin (recipient antibody) replaced by residues from the CDRs of
  • humanized antibodies may contain residues found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further improve and optimize antibody performance.
  • the humanized antibody will comprise at least one, and typically both, variable domains in which all or substantially all of the CDR regions correspond to CDR regions of a non-human immunoglobulin, and wherein the FR All or substantially all of the region has the sequence of the FR region of a human immunoglobulin.
  • the humanized antibody includes, in an immunoglobulin constant region (Fc region), at least a portion or substantial human immunoglobulin constant region (Fc region) sequence.
  • Variants of the antibody or antigen-binding fragment have "substantial similarity", i.e. at least about 90% sequence identity when the two peptide sequences are optimally aligned, such as by the programs GAP or BESTFIT using default gap weights; More specifically, it means sharing at least about 95%, 98% or 99% sequence identity.
  • residue positions that are not identical differ by conservative amino acid substitutions.
  • a "conservative amino acid substitution” is one in which an amino acid residue is replaced by another amino acid residue having a side chain (R group) with similar chemical properties (eg, charge or hydrophobicity). In general, conservative amino acid substitutions do not substantially alter the functionality of the protein. Where two or more amino acid sequences differ from each other by conservative substitutions, the percentage or degree of similarity can be adjusted up to correct for the conservative nature of the substitutions.
  • amino acid variations are made based on the relative similarity of amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, size, etc.
  • Analysis of the size, shape and type of amino acid side chain substituents revealed that arginine, lysine and histidine are all positively charged residues; Alanine, glycine and serine have similar sizes; It can be seen that phenylalanine, tryptophan and tyrosine have similar shapes. Accordingly, based on these considerations, arginine, lysine and histidine; alanine, glycine and serine; And phenylalanine, tryptophan and tyrosine are biologically functional equivalents.
  • each amino acid is given a hydrophobicity index according to its hydrophobicity and charge: Isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cysteine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); Tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); Lysine (-3.9); and arginine (-4.5).
  • the hydrophobic amino acid index is very important in conferring the interactive biological function of proteins. It is a known fact that amino acids having similar hydrophobicity indexes should be substituted to retain similar biological activities. In the case of introducing a mutation with reference to the hydrophobicity index, substitution is made between amino acids exhibiting a hydrophobicity index difference, specifically within ⁇ 2, more specifically within ⁇ 1, and even more specifically within ⁇ 0.5.
  • Amino acid exchanges in proteins that do not entirely alter the activity of the molecule are known in the art (H. Neurath, R.L. Hill, The Proteins, Academic Press, New York, 1979).
  • the most commonly occurring exchanges are amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/ Exchange between Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly.
  • Antibodies or antigen-binding fragments thereof of the present invention include antibodies or antigen-binding fragments thereof that include minor changes to the amino acid sequence described above, that is, modifications that hardly affect the tertiary structure and function of the antibody. Thus, in some embodiments, even if they do not match the sequence described above, they may have at least 100%, 93%, 95%, 96%, 97%, or 98% similarity.
  • the antibody or antigen-binding fragment thereof of the present invention is a monoclonal antibody, bispecific antibody, or multispecific antibody comprising a heavy chain variable region and a light chain variable region comprising the CDRs of the above-described sequence.
  • human antibodies, humanized antibodies, chimeric antibodies, single chain antibodies (scFv), Fab fragments, F (ab') fragments, disulfide-linked Fvs (sdFV) and anti-idiotypic (anti-Id) antibodies and the above epitope-binding fragments of antibodies; and the like.
  • the antibody or antigen-binding fragment thereof of the present invention is a scFv.
  • the heavy chain variable region and the light chain variable region included in the antibody or antigen-binding fragment thereof are (Gly-Ser)n, (Gly 2 -Ser)n, (Gly 3 -Ser)n or ( linked by a linker such as Gly 4 -Ser)n.
  • n is an integer of 1 to 6, specifically 3 to 4, but is not limited thereto.
  • the light chain variable region and heavy chain variable region of the scFv may exist, for example, in the following orientation: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are commonly used in formulation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, including, but not limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil; it is not going to be
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetening agent, a flavoring agent, an emulsifying agent, a suspending agent, a preservative, and the like in addition to the above components. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
  • the pharmaceutical composition of the present invention is preferably administered parenterally, such as intravenous administration, intraperitoneal administration, subcutaneous administration, intradermal administration, intrathecal administration, intrathecal administration, intraventricular administration, intracerebral parenchymal administration, intracranial administration, intramuscular administration. It can be administered using administration or topical administration. Specifically, it can be administered intramuscularly, specifically into the vocal fold muscle, and more specifically into the physeal muscle.
  • the pharmaceutical composition of the present invention may be formulated and administered by injection.
  • the suitable dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, severity of disease symptoms, administration time, administration route, excretion rate and reaction sensitivity, A ordinarily skilled physician can readily determine and prescribe effective dosages for the desired treatment.
  • the daily dosage of the pharmaceutical composition of the present invention is 0.0001-100 mg/kg.
  • the pharmaceutical composition of the present invention is prepared in unit dosage form by formulating using pharmaceutically acceptable carriers and/or excipients according to a method that can be easily performed by those skilled in the art. or it may be prepared by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, or capsule, and may additionally include a dispersing agent or a stabilizer.
  • the glottal insufficiency is glottal insufficiency caused by vocal cord paralysis, vocal cord muscle atrophy, geriatric larynx, etc., but is not limited thereto.
  • the vocal cord damage is vocal cord damage caused by laryngeal microsurgery due to a cause selected from the group consisting of laryngeal cancer, vocal cord nodule, polyp, cyst removal, etc., but is not limited thereto.
  • prevention refers to any action that inhibits glottic regurgitation or vocal cord damage by administering the pharmaceutical composition of the present invention, or delays its progression.
  • treatment refers to inhibiting the development of the glottic insufficiency or vocal cord damage, alleviating the glottal insufficiency or vocal cord damage, or eliminating the glottal insufficiency or vocal cord damage.
  • the pharmaceutical composition of the present invention promotes strengthening and growth of muscles constituting the vocal cords, and suppresses muscle atrophy to prevent or treat glottic insufficiency.
  • the pharmaceutical composition of the present invention inhibits the deposition of collagen and promotes the production of hyaluronic acid in the case of damage to tissues constituting the vocal cords, thereby promoting healing, thereby enabling the treatment of vocal cord damage.
  • the present invention includes the step of administering to a subject in need of treatment a pharmaceutical composition comprising the above-described anti c-Met agonistic antibody as an active ingredient It provides a method for treating glottic insufficiency or vocal cord damage.
  • Glottic insufficiency or vocal cord damage which is a target disease of the treatment method of the present invention, is the same as defined in relation to the target disease of the pharmaceutical composition.
  • the subject is a mammal or a human.
  • the anti-c-Met antibody which is an active ingredient of the present invention, increases the expression of c-Met and genes related to vocal cord muscle generation, thereby exhibiting excellent effects of strengthening vocal cord muscles and inhibiting vocal cord muscle atrophy, and producing collagen in case of vocal cord damage.
  • By inhibiting and promoting the production of hyaluronic acid the effect of treating vocal cord damage is very excellent, so it can be usefully used as a treatment for glottic insufficiency or vocal cord damage.
  • FIG. 1 is a diagram showing the results of H&E staining of a cross-section of vocal cord muscle after 3 weeks of anti-c-Met antibody injection after damaging the vocal cord nerve in order to show the effects of anti-c-Met antibody on strengthening vocal cord muscle and reducing vocal muscle atrophy ( X200).
  • FIG. 2 is a diagram showing the results of myosin heavy chain staining of a cross-section of vocal cord muscles after 3 weeks of anti-c-Met antibody injection after damaging vocal cord nerves in order to show the effects of anti-c-Met antibody on vocal cord muscle strengthening and vocal cord muscle atrophy reduction.
  • A X200
  • B and C Cross-sectional area (CSA) of all muscle fibers
  • D Number of muscle fibers quantified by counting single muscle fibers
  • E Cross-sectional area of a single muscle fiber.
  • FIG. 3 shows the result of c-Met staining of a cross-section of the vocal cord muscle after 3 weeks of anti-c-Met antibody injection after damaging the vocal cord nerve in order to confirm the mechanism of the vocal cord muscle strengthening and vocal cord muscle atrophy reduction effect of the anti-c-Met antibody.
  • A X200; B: relative intensity of c-Met staining. * P ⁇ 0.05 vs Nor (Normal), # P ⁇ 0.05 vs PBS, $ P ⁇ 0.05 vs HGF).
  • Figure 4 shows the expression level of genes related to muscle generation of vocal cord muscles after 3 weeks of anti-c-Met antibody injection after injuring vocal cord nerves to confirm the mechanism of vocal cord muscle strengthening and vocal cord muscle atrophy reduction effect of anti-c-Met antibody. It is shown through real-time PCR test results (* P ⁇ 0.05 vs Nor (Normal), # P ⁇ 0.05 vs PBS, $ P ⁇ 0.05 vs HGF).
  • Figure 5 shows the expression levels of genes related to muscle generation of vocal cord muscles after 1 week of vocal cord damage and anti-c-Met antibody injection through real-time PCR test results to confirm the effect of anti-c-Met antibody on vocal cord damage.
  • Figure 6 shows the expression levels of genes related to vocal cord muscle generation 2 weeks after vocal cord damage and anti-c-Met antibody injection through real-time PCR test results to confirm the effect of anti-c-Met antibody on vocal cord damage.
  • FIG. 7 is a view showing histological findings of laryngeal tissue 3 weeks after vocal cord damage and anti-c-Met antibody injection (AD: H&E staining, EH: Masson's trichrome) to confirm the effect of anti-c-Met antibody on vocal cord damage treatment.
  • staining IL: Alcian blue staining
  • M degree of collagen deposition
  • N degree of hyaluronic acid deposition
  • % used to indicate the concentration of a particular substance is (weight/weight) % for solids/solids, (weight/volume) % for solids/liquids, and liquid/liquid is (volume/volume) %.
  • the anti-c-Met antibody used in the present invention is the VH4/Vk2 antibody described in WO2020/101365A1.
  • the amino acid sequence of this antibody is shown in SEQ ID NO: 1 to SEQ ID NO: 8.
  • the affinity of the anti-c-Met antibody to the c-Met antigen was confirmed using BIAcore (GE healthcare). Human-derived C-Met protein was used as the antigen, and affinity (KD) was measured based on the measured values of Ka and Kd, and the value was 4.23 x 10 -10 M.
  • the present inventors performed experiments as in Examples 1 and 2 below to confirm the effect of the anti-c-Met antibody of the present invention on diseases causing atrophy of vocal cord muscles.
  • Example 1 Construction of recurrent nerve resection rabbit model and histological findings
  • Example 1-1 Construction of a recurrent nerve ablation rabbit model
  • a recurrent nerve ablation model was constructed using 15 New Zealand white rabbits weighing 3 kg as follows. The production of the recurrent nerve ablation rabbit model was approved by the Animal Ethics Committee of The Catholic University of Korea and was performed according to institutional guidelines.
  • each rabbit was pre-anaesthetized with xylazine (Rompun 10 mg/kg; Bayer, Berlin, Germany), and anesthesia was induced by intramuscular injection with ketamine (50 mg/kg).
  • the rabbit was laid in the prone position, and after removing the hair on the neck, a vertical incision was made along the midline of the neck.
  • the strap muscle was incised until the thyroid and trachea were visible.
  • the right hypothyroid nerve was identified around the hypothyroid artery inside the thyroid gland. After cutting the right recurrent laryngeal nerve, it was confirmed that paralysis occurred in the right vocal cords in all rabbits using an endoscope.
  • Example 1-2 Histopathological and immunohistochemical examination on rabbit tissue
  • sections were diluted 1:200 with anti-Fast Myosin Skeletal Heavy chain antibody (Abcam, Cambridge, MA) or anti-Met (c-Met) antibody (Abcam) at 1% (v/v). ) in PBS containing normal goat serum and 1% (w/v) BSA and incubated overnight at 4°C. After washing in PBS, sections were incubated with Alexa fluor 488-conjugated anti-mouse IgG antibodies (Cell signaling Technology, Beverly, MA) or Alexa fluor 594-conjugated anti-mouse IgG antibodies diluted 1:500 for 1 hour at room temperature and reacted in cows.
  • Alexa fluor 488-conjugated anti-mouse IgG antibodies Cell signaling Technology, Beverly, MA
  • Alexa fluor 594-conjugated anti-mouse IgG antibodies diluted 1:500 for 1 hour at room temperature and reacted in cows.
  • Sections were stained with hematoxylin, rehydrated with a gradient alcohol/water mixture and xylene, and covered with a cover slip.
  • the stained samples were observed with an inverted microscope equipped with a digital camera (Eclipse TE300; Nikon, Tokyo, Japan).
  • the staining area was evaluated for the degree of immunostaining chemistry by calculating the area of the stained pixel using ImageJ software (National Institutes of Health, Bethesda, Maryland).
  • the present inventors confirmed histological findings of the rabbit's right thyroarytenoid muscle (TA muscle) 3 weeks after injection. The results are shown in Figures 1 to 3.
  • the cross-sectional area of the endogenous muscle in the PBS-injected group was greatly reduced compared to the normal control group.
  • the muscle cross-sectional area increased compared to the group injected with PBS, but it was still decreased compared to the normal group.
  • the muscle cross-sectional area increased compared to the group injected with PBS and HGF, and there was no significant difference compared to the normal group.
  • FIG. 3 results of measuring the expression level of C-MET in the same slide are shown in FIG. 3 .
  • the expression level of C-MET was decreased in the PBS-injected group compared to the normal control group.
  • the expression level of C-MET showed a tendency to increase.
  • Example 2 Construction of recurrent nerve resection rat model and gene expression level
  • Example 2-1 Construction of recurrent nerve ablation rat model
  • a recurrent nerve ablation rat model was prepared as follows. The production of the recurrent nerve ablation rat model was approved by the Animal Ethics Committee of The clergy University of Korea and was performed according to the institutional guidelines.
  • Example 2-2 Gene expression levels in mice using RNA isolation and real-time RT-PCR
  • the present inventors measured the expression levels of genes related to myogenesis in the right dorsiformis muscle of mice 2 weeks after the injection. The results are shown in Figure 4.
  • the expression level of Myosin heavy chain type IIA was greatly increased in the PBS injection group, and decreased in the HGF and anti-c-MET antibody injection group compared to the PBS injection group.
  • the expression level of MyoD was decreased in the PBS injection group compared to the normal control group, but there was no significant difference.
  • the expression level of MyoD was significantly increased only in the anti-c-MET antibody injection group compared to the PBS injection group.
  • the anti-c-MET agonistic antibody was more effective than HGF in regenerating the vocal fold muscle in the vocal cord paralysis animal model in which the recurrent nerve was resected.
  • the present inventors performed experiments as in Example 3 below to confirm the effect of the anti-c-Met antibody of the present invention on vocal cord damage caused by various causes.
  • Example 3 Production of vocal cord injury rat model and gene expression level
  • Example 3-1 Construction of vocal cord injury rat model and injection of anti-c-MET antibody
  • the vocal cord injury rat model of the present invention was produced as follows. The production of the vocal cord injury rat model was approved by the Animal Ethics Committee of The Catholic University of Korea and was performed according to the institutional guidelines.
  • Example 3-2 Gene expression levels in rats with vocal cord damage
  • HAS 1 hyaluronan synthase 1
  • HAS2, HAS3, and COL III a gene encoding procollagen III
  • FN and MMP2 a gene encoding fibronectin
  • the mRNA expression level of COL III a gene encoding procollagen type III, was decreased in the anti-c-MET antibody injection group compared to the PBS injection group.
  • the expression level of the FN gene was upregulated in the PBS injection group and the HGF injection group compared to the normal control group, and decreased in the anti-c-Met antibody administration group compared to the PBS injection group.
  • MMP2 matrix metalloproteinase-2, type IV collagenase
  • a gene encoding collagen and FN lyase was not different between the normal, PBS-injected, HGF-injected, and anti-c-MET antibody-injected groups.
  • the expression levels of mRNA encoding HAS1, HAS2, and HAS3 were increased in the HGF injection group and the anti-c-MET antibody injection group compared to the PBS injection group 2 weeks after the vocal cord injury.
  • the expression level of FN gene was also up-regulated in the PBS, HGF injection group and the anti-c-MET antibody-administered group compared to the normal control group, similar to the results after 1 week of vocal cord damage, but the anti-c-Met antibody-administered group was significantly higher than the PBS injection group. showed declining results.
  • MMP2 matrix metalloproteinase-2, type IV collagenase
  • a gene encoding collagen and FN degrading enzyme were similar to the results 1 week after vocal cord injury in normal, PBS, HGF, and anti-c-MET antibody injection groups. did not show much difference.
  • the anti-c-Met antibody injection group of the present invention showed a better anti-fibrotic effect than the PBS injection group.
  • Masson's trichrome staining showed that collagen deposition was significantly reduced in the c-Met antibody-injected group compared to the PBS-injected group.
  • the HGF injection group also showed less collagen deposition compared to the PBS injection group, but there was no significance.
  • Hyaluronic acid was identified by alcian blue staining. Hyaluronic acid deposition was significantly increased in the anti-c-MET antibody injection group compared to the PBS injection group. In the HGF injection group, hyaluronic acid deposition was increased compared to the PBS injection group, but there was no significant difference.
  • the anti-c-Met antibody of the present invention has an excellent anti-fibrotic effect and is effective in restoring damaged vocal cords by promoting collagen degradation and increasing hyaluronic acid synthesis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pulmonology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Genetics & Genomics (AREA)
  • Otolaryngology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Microbiology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

본 발명은 항 c-Met 어고니스틱 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물에 관한 것이다. 본 발명의 유효성분인 항 c-Met 어고니스틱 항체는 c-Met, 및 성대 근육 생성과 관련된 유전자의 발현을 증가시킴으로써 성대 근육 강화, 성대 근위축을 저해하는 효과가 우수하고, 성대 손상에 있어 콜라겐의 생성을 저해하고 히알루론산의 생성을 촉진함으로써 성대 손상 치료 효과가 매우 우수하므로, 성문 폐쇄 부전증 또는 성대 손상 치료제로 유용하게 사용될 수 있다.

Description

항 C-MET 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물
본 특허출원은 2021년 10월 08일에 대한민국 특허청에 제출된 대한민국 특허출원 제10-2021-0133932호에 대하여 우선권을 주장하며, 상기 특허출원의 개시사항은 본 명세서에 참조로서 삽입된다.
본 발명은 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물에 관한 것이다. 본 발명은 보다 구체적으로 항 c-Met 항체(anti c-Met antibody)를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물에 관한 것이다.
성문 폐쇄(Glottic closure)는 음성 생성 및 기도 보호에 중요하다. 그러나 여러 병리학적 상태, 성대 마비(vocal fold paralysis), 성대 위축(vocal fold atrophy) 및 노인성 후두(presbylarynx)는 성문 기능 부전(glottic insufficiency)을 유발한다. 성대 마비는 반회 후두 신경(recurrent laryngeal nerve, RLN)의 손상으로 인해 발생한다. 반회 후두 신경은 대부분의 내재 근육(intrinsic muscle)을 자극한다. 따라서 반회 후두 신경의 손상은 또한 내재성 근육의 위축을 유발한다.
성문 기능 부전을 치료하기 위해, 후두 골조 수술(laryngeal frame work surgery)이나 주사 후두 성형술(injection laryngoplasty)과 같은 공간 점유 치료법(space occupying treatment)이 사용되고 있지만 이러한 치료는 후두 내재성 근육 위축을 개선하거나 예방하지 못한다.
후두 신경 재식법(Laryngeal reinnervation surgery)은 내재성 근육 위축을 예방할 수 있지만, 이 치료법은 기술적으로 어렵고 목 절개가 필요하며 동기 운동을 유발한다. 여러 연구에서 간세포 성장 인자 또는 섬유아세포 성장 인자와 같은 일부 성장 인자가 항섬유화 효과뿐만 아니라 근육 위축을 예방한다고 보고했다. 그러나 HGF는 형태가 불안정하고 반감기가 짧아 효과가 짧았으므로 좋은 결과를 얻으려면 반복 주입이 필요하였다.
C-MET은 HGF에 대한 막횡단 티로신 키나아제 수용체이다. 항체는 HGF보다 더 안정적이고 반감기가 길고, HGF와 같이 C-MET 수용체를 활성화시킬 수 있으므로 본 발명자들은 C-Met 아고니스트 항체를 성대의 근 재생을 위해 사용할 수 있을지를 확인하였다.
본 발명자들은 성문 폐쇄 부전증 또는 성대 손상을 치료하기 위한 약제학적 조성물을 개발하고자 예의 연구 노력하였다. 그 결과 본 발명의 항 c-Met 항체가 HGF 보다 성문 폐쇄 부전증 및 성대 손상의 치료효과가 더 우수함을 규명함으로써, 본 발명을 완성하게 되었다.
따라서, 본 발명의 목적은 항 c-Met 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 항 c-Met 항체를 대상체에 투여하는 단계를 포함하는 성문 폐쇄 부전증 또는 성대 손상의 치료방법을 제공하는 것이다.
본 발명의 일 양태에 따르면, 본 발명은 항 c-Met 항체 (anti c-Met antibody) 또는 항원 결합 단편을 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물을 제공한다.
본 발명의 일 구현예에 있어서, 상기 항 c-Met 항체 또는 항원 결합 단편은 c-Met에 특이적으로 결합하는 항체 또는 항원 결합 단편이다.
본 발명의 일 구현예에 있어서, 상기 c-Met에 특이적으로 결합하는 항체 또는 항원 결합 단편은 다음을 포함한다:
i) 서열번호 1의 아미노산 서열을 포함하는 CDR-H1, 서열번호 2의 아미노산 서열을 포함하는 CDR-H2, 서열번호 3의 아미노산 서열을 포함하는 CDR-H3를 포함하는 중쇄가변영역; 및
ii) 서열번호 4의 아미노산 서열을 포함하는 CDR-L1, 서열번호 5의 아미노산 서열을 포함하는 CDR-L2, 서열번호 6의 아미노산 서열을 포함하는 CDR-L3를 포함하는 경쇄가변영역.
본 발명의 일 구현예에 있어서, 상기 c-Met에 특이적으로 결합하는 항체 또는 항원 결합 단편은 다음을 포함한다:
서열번호 7의 아미노산 서열을 포함하는 중쇄가변영역 및 서열번호 8의 아미노산 서열을 포함하는 경쇄가변영역.
본 발명의 일 구현예에 있어서, 상기 항체 또는 그의 항원 결합 단편은scFv이나, 이에 한정되는 것은 아니다.
본 명세서에서, 용어 "c-Met(mesenchymal-epithelial transition factor)"은 세포 표면에서 발현되는 Met 원발암유전자(proto-oncogene)에 의해 코딩되는 수용체 티로신 키나아제이다. 구조적으로 c-Met는 세포외 알파 서브유닛(extracellular alpha subunit, 50 kDa)과 막관통 베타 서브유닛(transmembrane beta subunit, 140 kDa)으로 구성된 디설파이드-결합된 이합체이다. c-Met는 리간드 결합을 위한 세포외 도메인, 막관통 부분, 및 세포내 도메인 내의 티로신 잔기의 인산화에 관여하는 티로신 키나아제 촉매 모티프를 포함한다(Dean et al., Nature, 4: 318 (6044): 385, 1985; Park et al., PNAS, 84 (18): 6379, 1976; Maggiora et al., J. Cell Physiol., 173:183, 1997). c-Met의 리간드는 HGF (hepatocyte growth factor)이므로, c-Met은 HGF의 수용체로 표현될 수 있다. HGF가 c-Met에 결합하면, c-Met의 세포질 티로신 잔기가 이량화되고 자가 인산화되며(autophosphorylate), 이어 하위 신호전달 경로를 매개하는 다양한 단백질과 상호 작용한다. c-Met 활성화는 세포 성장, 분산(scattering) 및 운동성(motility), 침습(invasion), 세포사멸로부터의 보호, 분지형태 형성(branching morphogenesis) 및 신생혈관 형성(angiogenesis)의 증가를 유도하는 다양한 생물학적 반응을 초래한다. c-Met 활성에 의해 영향을 받는 다양한 생물학적, 생리학적 기능을 고려할 때, c-Met 단백질은 다용도의 치료 표적이 되었다.
본 발명의 항체는 당 업계에 알려져 있는 다양한 파지 디스플레이(phage display)방법을 사용하여 생성될 수 있고, [Brinkman et al., 1995, J. Immunol. Methods, 182:41-50]; [Ames et al., 1995, J. Immunol. Methods, 184, 177-186]; [Kettleborough et al. 1994, Eur. J. Immunol, 24, 952-958]; [Persic et al., 1997, Gene, 187, 9-18]; 및 [Burton et al., 1994, Adv. Immunol., 57, 191-280]; WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; 및 WO 95/20401; 및 US 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743; 및 5,969,108 에 게시된 것을 포함한다.
본 명세서에서, 용어 “항체(antibody)”는 c-Met 에 대한 특이 항체로서, 완전한 항체 형태 뿐만 아니라 항체 분자의 항원 결합 단편(antigen binding fragment)을 포함한다.
완전한 항체는 2개의 전체 길이의 경쇄 및 2개의 전체 길이의 중쇄를 가지는 구조이며 각각의 경쇄는 중쇄와 다이설파이드 결합으로 연결되어 있다. 중쇄 불변 영역은 감마(γ), 뮤(μ), 알파(α), 델타(δ) 및 엡실론(ε) 타입을 가지고 서브클래스로 감마1(γ1), 감마2(γ2), 감마3(γ3), 감마4(γ4), 알파1(α1) 및 알파2(α2)를 가진다. 경쇄의 불변영역은 카파(kappa) 및 람다(lambda) 타입을 가진다 (Cellular and Molecular Immunology, Wonsiewicz, M. J., Ed., Chapter 45, pp. 41-50, W. B. Saunders Co. Philadelphia, PA(1991); Nisonoff, A., Introduction to Molecular Immunology, 2nd Ed., Chapter 4,pp. 45-65, sinauer Associates, Inc., Sunderland, MA (1984)).
본 명세서에서, 용어 "항원 결합 단편"은 항원 결합 기능을 보유하고 있는 단편을 의미하며, Fab, F(ab'), F(ab')2, 화학적으로 연결된 F(ab')2 및 Fv 등을 포함한다. 항체 단편 중 Fab는 경쇄 및 중쇄의 가변영역과 경쇄의 불변 영역 및 중쇄의 첫 번째 불변 영역(CH1)을 가지는 구조로 1개의 항원 결합 부위를 가진다. Fab'는 중쇄 CH1 도메인의 C-말단에 하나 이상의 시스테인 잔기를 포함하는 힌지 영역(hinge region)을 가진다는 점에서 Fab와 차이가 있다. F(ab')2 항체는 Fab'의 힌지 영역의 시스테인 잔기가 다이설파이드 결합을 이루면서 생성된다. Fv는 중쇄 가변부위 및 경쇄 가변부위만을 가지고 있는 최소의 항체조각으로 Fv 단편을 생성하는 재조합 기술은 PCT 국제 공개특허출원 WO 88/10649, WO 88/106630, WO 88/07085, WO 88/07086 및 WO 88/09344에 개시되어 있다. 이중쇄 Fv(two-chain Fv)는 비공유 결합으로 중쇄 가변부위와 경쇄 가변부위가 연결되어 있고 단쇄 Fv(single-chain Fv)는 일반적으로 펩타이드 링커를 통하여 중쇄의 가변 영역과 단쇄의 가변 영역이 공유 결합으로 연결되거나 또는 C-말단에서 바로 연결되어 있어서 이중쇄 Fv와 같이 다이머와 같은 구조를 이룰 수 있다. 이러한 항체 단편은 단백질 가수분해 효소를 이용해서 얻을 수 있고(예를 들어, 전체 항체를 파파인으로 제한 절단하면 Fab를 얻을 수 있고 펩신으로 절단하면 F(ab')2 단편을 얻을 수 있다), 또는 유전자 재조합 기술을 통하여 제작할 수 있다.
본 발명에서 항체는 구체적으로 scFv 형태이거나 완전한 항체 형태이다. 또한, 중쇄 불변 영역은 감마(γ), 뮤(μ), 알파(α), 델타(δ) 또는 엡실론(ε) 중의 어느 한 이소타입으로부터 선택될 수 있다. 구체적으로는, 불변영역은 감마1(IgG1), 감마 2(IgG2), 감마 3(IgG3) 및 감마 4(IgG4)이다. 경쇄 불변 영역은 카파 또는 람다 형일 수 있으며, 구체적으로는 카파형이다.
본 명세서에서, 용어 “중쇄”는 항원에 특이성을 부여하기 위한 충분한 가변 영역 서열을 갖는 아미노산 서열을 포함하는 가변 영역 도메인 VH 및 3 개의 불변 영역 도메인 CH1, CH2 및 CH3를 포함하는 전체길이 중쇄 및 이의 단편을 모두 의미한다. 또한 본 명세서에서 용어“경쇄”는 항원에 특이성을 부여하기 위한 충분한 가변영역 서열을 갖는 아미노산 서열을 포함하는 가변 영역 도메인 VL 및 불변 영역 도메인 CL을 포함하는 전체길이 경쇄 및 이의 단편을 모두 의미한다.
본 명세서에서, 용어 “CDR(complementarity determining region)”은 면역글로불린 중쇄 및 경쇄의 고가변 영역(hypervariable region)의 아미노산 서열을 의미한다(Kabat et al., Sequences of Proteins of Immunological Interest, 4th Ed., U.S. Department of Health and Human Services, National Institutes of Health (1987)). 중쇄(CDR-H1, CDR-H2 및 CDR-H3) 및 경쇄(CDR-L1, CDR-L2 및 CDR-L3)에는 각각 3개의 CDR이 포함되어 있다. CDR은 항체가 항원 또는 에피토프에 결합하는 데 있어서 주요한 접촉 잔기를 제공한다.
본 명세서에서 상기 항체 또는 이의 항원 결합 단편은 전장 또는 원래 그대로의 폴리클로날 또는 모노클로날 항체뿐만 아니라, 이의 항원 결합 단편들(예를 들어, Fab, Fab', F(ab')2, Fab3, Fv 및 이의 변이체들), 하나 또는 그 이상의 항체 부분을 포함하는 융합 단백질, 인간항체, 인간화 항체, 키메라 항체, 미니바디, 다이아바디, 트리아바디, 테트라바디, 선형 항체, 단일 체인 항체(scFv), scFv-Fc, 이중특이적 항체, 다중특이적 항체, 필요한 특이성의 항원 인식 부위를 포함하는 면역 글로불린 분자의 다른 변형된 배열형태로서 항체의 글리코실화 변이체, 항체의 아미노산 서열 변이체 및 공유결합으로 변형된 항체를 포함한다. 변형된 항체 및 이의 항원 결합 단편의 구체적인 예에는 나노바디, AlbudAbs, DARTs(dual affinity re-targeting), BiTEs(bispecific T-cell engager), TandAbs(tandem diabodies), DAFs(dual acting Fab), two-in-one antibodies, SMIPs(small modular immunopharmaceuticals), FynomAbs(fynomers fused to antibodies), DVD-Igs(dual variable domain immunoglobulin), CovX-bodies(peptide modified antibodies), 듀오바디 및 triomAbs이 포함된다. 이와 같은 항체 및 이의 항원 결합 단편들의 목록은 상기에 한정되는 것은 아니다.
본 명세서에서, 용어 "프레임 워크(Framework)" 또는 "FR"은 초가변 영역 (hypervariable region, HVR) 잔기 이외의 가변 도메인 잔기를 나타낸다. 가변 도메인의 FR은 일반적으로 4 개의 FR 도메인 FR1, FR2, FR3 및 FR4로 구성된다. 따라서, HVR 및 FR 서열은 일반적으로 VH 및 VL/Vk에서 다음의 순서로 나타난다:
(a) FRH1(Framework region 1 of Heavy chain)-CDRH1 (complementarity determining region 1 of Heavy chain)-FRH2-CDRH2-FRH3-CDRH3-FRH4; 및
(b) FRL1(Framework region 1 of Light chain)-CDRL1(complementarity determining region 1 of Light chain)-FRL2-CDRL2-FRL3-CDRL3-FRL4.
본 발명의 다른 구현예에 있어서, 상기 항체 또는 항원 결합 단편은 다음과 같은 순서로 나타날 수 있다:
(a) FRL1(Framework region 1 of Light chain)-CDRL1(complementarity determining region 1 of Light chain)-FRL2-CDRL2-FRL3-CDRL3-FRL4; 및
(b) FRH1(Framework region 1 of Heavy chain)-CDRH1 (complementarity determining region 1 of Heavy chain)-FRH2-CDRH2-FRH3-CDRH3-FRH4.
본 명세서에서, 용어 "가변 영역(variable region)" 또는 "가변 도메인(variable domain)"은 항체를 항원에 결합시키는 것과 관련되는 항체 중쇄 또는 경쇄의 도메인을 의미한다. Native 항체의 중쇄 및 경쇄의 가변 도메인(각각 VH 및 VL)은 일반적으로 유사한 구조를 가지며, 각 도메인은 4 개의 보존된 프레임워크 영역 (framework regions, FR) 및 3 개의 초가변 영역 (hypervariable regions, HVR)을 포함한다. (Kindt et al., Kuby Immunology, 제 6 판, W.H. Freeman and Co., page 91 (2007)). 단일 VH 또는 VL 도메인은 항원-결합 특이성을 부여하기에 충분할 수 있다. 또한, 특정 항원에 결합하는 항체는, 항원과 결합하여 각각 상보적인 VL 또는 VH 도메인의 라이브러리를 스크리닝하는 항체로부터, VH 또는 VL 도메인을 사용하여 분리될 수 있다.
본 명세서에서, 용어 "특이적으로 결합한다" 또는 이와 같은 것은, 항체 또는 그의 항원 결합 단편, 또는 scFv와 같은 다른 구성물이 생리적 조건 하에서 비교적 안정한 항원과 복합체를 형성한다는 것을 의미한다. 특이적 결합은 적어도 약 1 x 10-6 M 이하(예컨대, 9 x 10-7 M, 8 x 10-7 M, 7 x 10-7 M, 6 x 10-7 M, 5 x 10-7 M, 4 x 10-7 M, 3 x 10-7 M, 2 x 10-7 M, 또는 1 x 10-7 M), 구체적으로는 1 x 10-7 M 이하(예컨대, 9 x 10-8 M, 8 x 10-8 M, 7 x 10-8 M, 6 x 10-8 M, 5 x 10-8 M, 4 x 10-8 M, 3 x 10-8 M, 2 x 10-8 M, 또는 1 x 10-8 M), 보다 구체적으로는 1 x 10-8 M 이하(예컨대, 9 x 10-9 M, 8 x 10-9 M, 7 x 10-9 M, 6 x 10-9 M, 5 x 10-9 M, 4 x 10-9 M, 3 x 10-9 M, 2 x 10-9 M, 또는 1 x 10-9 M)의 평형 해리 상수 (예를 들어, 이보다 작은 KD는 보다 단단한 결합을 나타냄)로 특성화될 수 있다. 2 개의 분자가 특이적으로 결합하는지 여부를 결정하는 방법은 당 업계에 잘 알려져 있으며, 예를 들어 평형 투석, 표면 플라스몬 공명, 및 효소결합면역흡착검사(Enzyme linked Immunosorbent assay, ELISA) 등을 포함한다.
본 명세서에서, 용어 "친화도(Affinity)"는 분자(예를 들어, 항체)의 단일 결합 부위와 그 결합 파트너 (예를 들어, 항원) 사이의 비공유 상호 작용의 총합의 강도를 의미한다. 달리 명시하지 않는 한, 본원에 사용된 바와 같이, "결합 친화력(binding affinity)"은 결합 쌍 (예를 들어, 항체 및 항원)의 구성원 간의 1:1 상호 작용을 반영하는 내인성(intrinsic) 결합 친화력을 나타낸다. 분자 Y와 그의 파트너 Y의 친화도는 일반적으로 해리 상수 (Kd)로 나타낼 수 있다. 친화도는 본원에 기술된 것들을 포함하여 당업계에 공지된 통상적인 방법에 의해 측정될 수 있다.
또한 본 명세서에서 용어, "인간 항체(human antibody)"는 인간 또는 인간 세포에 의해 생성된 항체, 또는 인간 항체 레퍼토리(repertoires) 또는 다른 인간 항체 코딩 서열을 이용하는 비인간 근원으로부터 유래된 항체의 아미노산 서열에 상응하는 아미노산 서열을 보유한다. 인간 항체의 이러한 정의는 비인간 항원 결합 잔기를 포함하는 인간화(humanized) 항체를 배제한다.
본 명세서에서 용어, "키메라(chimeric)" 항체는 중쇄 및/또는 경쇄의 일부가 특정 근원(source) 또는 종(species)으로부터 유래되고, 중쇄 및/또는 경쇄의 나머지가 상이한 근원 또는 종에서 유래한 항체를 의미한다.
본 명세서에서 용어 "인간화 항체"란, 비-인간(예를 들어, 마우스, 닭) 항체의 비-인간 면역글로불린으로부터 유래된 최소 서열을 함유하는 키메릭 면역글로불린, 그의 면역글로불린 쇄 또는 단편(예를 들어 Fv, Fab, Fab', F(ab')2 또는 항체의 다른 항원-결합 하위서열)이다. 대부분의 경우에, 인간화 항체는 수용자의 상보성-결정 영역(CDR)의 잔기가, 목적하는 특이성, 친화성 및 능력을 갖는 비-인간 종(공여자 항체), 예를 들어 마우스, 닭, 랫트 또는 토끼의 CDR의 잔기에 의해 대체된 인간 면역글로불린(수용자 항체)이다.
또한, 인간화 항체는 수용자 항체에서도 또는 수입된 CDR 또는 프레임워크 서열에서도 발견되지 않는 잔기를 포함할 수 있다. 이러한 변형은 항체 성능을 추가로 개선 및 최적화하기 위해 이루어진다. 일반적으로, 상기 인간화 항체는 적어도 하나, 및 전형적으로는 2개의 모든 가변 도메인을 포함할 것이며, 상기 도메인에서 상기 CDR 영역의 전부 또는 실질적 전부는 비-인간 면역글로불린의 CDR 영역에 상응하고, 상기 FR 영역의 전부 또는 실질적 전부는 인간 면역글로불린의 FR 영역의 서열을 가진다. 상기 인간화 항체는 면역글로불린 불변 영역(Fc region)에, 적어도 일부 또는 실질적인 인간 면역글로불린의 불변 영역(Fc region)서열을 포함한다.
상기 항체 또는 항원 결합 단편의 변이체는 "실질적 유사성"을 가지는 것으로, 2개의 펩타이드 서열이 디폴트 갭 가중치를 사용하는 프로그램 GAP 또는 BESTFIT에 의해서와 같이 최적으로 정렬되는 경우에 적어도 약 90%의 서열 동일성, 더욱 구체적으로는 적어도 약 95%, 98% 또는 99%의 서열 동일성을 공유함을 의미한다. 구체적으로는, 동일하지 않은 잔기 위치는 보존적 아미노산 치환에 의해 상이하다. "보존적 아미노산 치환"은 아미노산 잔기가 유사한 화학적 특성(예: 전하 또는 소수성)을 갖는 측쇄(R 기)를 갖는 또 다른 아미노산 잔기에 의해 치환된 것이다. 일반적으로, 보존적 아미노산 치환은 단백질의 기능성을 실질적으로 변화시키지 않는다. 2개 이상의 아미노산 서열이 보존적 치환에 의해 서로 상이한 경우에, 유사성의 퍼센트 또는 정도는 치환의 보존적 성질을 보정하기 위해 상향 조절될 수 있다.
이러한 아미노산 변이는 아미노산 곁사슬 치환체의 상대적 유사성, 예컨대, 소수성, 친수성, 전하, 크기 등에 기초하여 이루어진다. 아미노산 곁사슬 치환체의 크기, 모양 및 종류에 대한 분석에 의하여, 아르기닌, 라이신과 히스티딘은 모두 양전하를 띤 잔기이고; 알라닌, 글라이신과 세린은 유사한 크기를 갖으며; 페닐알라닌, 트립토판과 타이로신은 유사한 모양을 갖는다는 것을 알 수 있다. 따라서, 이러한 고려 사항에 기초하여, 아르기닌, 라이신과 히스티딘; 알라닌, 글라이신과 세린; 그리고 페닐알라닌, 트립토판과 타이로신은 생물학적으로 기능적 균등물이라 할 수 있다.
변이를 도입하는 데 있어서, 아미노산의 소수성 인덱스(hydropathic idex)가 고려될 수 있다. 각각의 아미노산은 소수성과 전하에 따라 소수성 인덱스가 부여되어 있다: 아이소루이신(+4.5); 발린(+4.2); 루이신(+3.8); 페닐알라닌(+2.8); 시스테인/시스타인(+2.5); 메티오닌(+1.9); 알라닌(+1.8); 글라이신(-0.4); 쓰레오닌(-0.7); 세린(-0.8); 트립토판(-0.9); 타이로신(-1.3); 프롤린(-1.6); 히스티딘(-3.2); 글루타메이트(-3.5); 글루타민(-3.5); 아스파르테이트(-3.5); 아스파라긴(-3.5); 라이신(-3.9); 및 아르기닌(-4.5).
단백질의 상호적인 생물학적 기능(interactive biological function)을 부여하는 데 있어서 소수성 아미노산 인덱스는 매우 중요하다. 유사한 소수성 인덱스를 가지는 아미노산으로 치환하여야 유사한 생물학적 활성을 보유할 수 있다는 것은 공지된 사실이다. 소수성 인덱스를 참조하여 변이를 도입시키는 경우, 구체적으로는 ± 2 이내, 보다 구체적으로는 ± 1 이내, 보다 더 구체적으로는 ± 0.5 이내의 소수성 인덱스 차이를 나타내는 아미노산 사이에서 치환을 한다.
한편, 유사한 친수성 값(hydrophilicity value)을 가지는 아미노산 사이의 치환이 균등한 생물학적 활성을 갖는 단백질을 초래한다는 것도 잘 알려져 있다. 미국 특허 제4,554,101호에 개시된 바와 같이, 다음의 친수성 값이 각각의 아미노산 잔기에 부여되어 있다: 아르기닌(+3.0); 라이신(+3.0); 아스팔테이트(+3.0± 1); 글루타메이트(+3.0± 1); 세린(+0.3); 아스파라긴(+0.2); 글루타민(+0.2); 글라이신(0); 쓰레오닌(-0.4); 프롤린(-0.5 ± 1); 알라닌(-0.5); 히스티딘(-0.5); 시스테인(-1.0); 메티오닌(-1.3); 발린(-1.5); 루이신(-1.8); 아이소루이신(-1.8); 타이로신(-2.3); 페닐알라닌(-2.5); 트립토판(-3.4).
친수성 값을 참조하여 변이를 도입시키는 경우, 구체적으로는 ± 2 이내, 보다 구체적으로는 ± 1 이내, 보다 더 구체적으로는 ± 0.5 이내의 친수성 값 차이를 나타내는 아미노산 사이에서 치환을 한다.
분자의 활성을 전체적으로 변경시키지 않는 단백질에서의 아미노산 교환은 당해 분야에 공지되어 있다(H. Neurath, R.L.Hill, The Proteins, Academic Press, New York, 1979). 가장 통상적으로 일어나는 교환은 아미노산 잔기 Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly 간의 교환이다.
본 발명의 항체 또는 그의 항원 결합 단편은 상술한 아미노산 서열에 대하여 소폭의 변화, 즉, 3차 구조 및 항체의 기능에 거의 영향을 미치지 않는 변형을 포함하는 항체 또는 그의 항원 결합 단편을 포함한다. 따라서 어떤 구현예의 경우 상술한 서열과 일치하지 않더라도 적어도 100%, 93%, 95%, 96%, 97%, 또는 98% 이상의 유사성을 가질 수 있다.
본 발명의 일 구현예에 따르면, 본 발명의 항체 또는 그의 항원 결합 단편은 상술한 서열의 CDR을 포함하는 중쇄 가변영역 및 경쇄가변영역을 포함하는 단일클론 항체, 이중특이적 항체, 다중특이적 항체, 인간 항체, 인간화 항체, 키메라 항체, 단일 체인 항체(scFv), Fab 단편, F(ab')단편, 다이설파이드-결합 Fvs(sdFV) 및 항-이디오타입(항-Id) 항체, 그리고 상기 항체들의 에피토프-결합 단편 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 다른 구현예에서 본 발명의 항체 또는 그의 항원 결합 단편은 scFv이다.
본 발명의 구체적인 구현예에서, 상기 항체 또는 그의 항원 결합 단편에 포함되는 중쇄가변영역 및 경쇄가변영역은 (Gly-Ser)n, (Gly2-Ser)n, (Gly3-Ser)n 또는 (Gly4-Ser)n 등의 링커에 의해 연결된다. 여기서 n은 1 내지 6의 정수이고, 구체적으로는 3 내지 4이나 이에 한정되는 것은 아니다. 상기 scFv의 경쇄가변영역 및 중쇄가변영역은 예를 들어 다음의 배향으로 존재할 수 있다: 경쇄가변영역-링커-중쇄가변영역 또는 중쇄가변영역-링커-경쇄가변영역.
본 발명의 약제학적 조성물은 약제학적으로 허용되는 담체를 포함할 수 있다.
본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서, 락토스, 덱스트로스, 수크로스, 솔비톨,　만니톨, 전분, 아카시아 고무, 인산 칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세결정성 셀룰로스, 폴리비닐피롤리돈, 셀룰로오스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트 , 프로필히드록시벤조에이트, 활석 , 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나, 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington's Pharmaceutical Sciences (19th ed . , 1995)에 상세히 기재되어 있다.
본 발명의 약제학적 조성물은 비경구 투여가 바람직하고 예컨대 정맥내 투여, 복강내 투여, 피하 투여, 피내투여, 척수내 투여, 척수강내 투여, 뇌실내 투여, 뇌실질내 투여, 두개강내 투여, 근육내 투여 또는 국부 투여를 이용하여 투여할 수 있다. 구체적으로는 근육내 투여할 수 있고, 구체적으로는 성대근, 보다 구체적으로는 갑상피열근 내에 투여할 수 있다.
본 발명의 약제학적 조성물은 주사로 제제화되어 투여될 수 있다. 본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 질병 증상의 정도, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양하며, 보통으로 숙련된 의사는 목적하는 치료에 효과적인 투여량을 용이하게 결정 및 처방할 수 있다.
본 발명의 바람직한 구현예에 따르면, 본 발명의 약제학적 조성물의 1일 투여량은 0.0001-100 mg/kg이다.
본 발명의 약제학적 조성물은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약제학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화 됨으로써 단위 용량 형태로 제조되거나 또는 다용량 용기 내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질증의 용액, 현탁액 또는 유화액 형태이거나 액스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제　또는 안정화제를 추가적으로 포함할 수 있다.
본 발명의 일 구현예에 있어서, 상기 성문 폐쇄 부전증은 성대 마비, 성대근 위축, 노인성 후두 등으로 인한 성문 폐쇄 부전증이나, 이에 한정되는 것은 아니다.
본 발명의 일 구현예에 있어서, 상기 성대 손상은 후두암, 성대결절, 폴립, 낭종 제거 등로 이루어진 군으로부터 선택된 원인에 의한 후두 미세 수술로 인하여 발생하는 성대 손상이나, 이에 한정되는 것은 아니다.
본 명세서에서 사용되는 용어 "예방"은 본 발명의 약제학적 조성물의 투여로 성문 폐쇄 부전증 또는 성대 손상을 억제시키거나, 진행을 지연시키는 모든 행위를 의미한다.
본 명세서에서 사용되는 용어 "치료"는 상기 성문 폐쇄 부전증 또는 성대 손상의 발전의 억제, 성문 폐쇄 부전증 또는 성대 손상의 경감, 또는 성문 폐쇄 부전증 또는 성대 손상의 제거를 의미한다.
본 발명의 약제학적 조성물은 성대를 구성하는 근육의 강화 및 근육 성장을 촉진하고, 근육 위축을 억제하여 성문 폐쇄 부전증을 예방 또는 치료할 수 있도록 한다.
본 발명의 약제학적 조성물은 성대를 구성하는 조직의 손상에 있어서, 콜라겐의 침착을 저해하고, 히알루론산의 생성을 촉진함으로써 치유를 촉진함으로써 성대 손상을 치료할 수 있도록 한다.
본 발명의 다른 일 양태에 따르면, 본 발명은 상술한 항 c-Met 어고니스틱 항체(anti c-Met agonistic antibody)를 유효성분으로 포함하는 약제학적 조성물을 치료가 필요한 대상체에 투여하는 단계를 포함하는 성문 폐쇄 부전증 또는 성대 손상의 치료방법을 제공한다.
본 발명의 치료방법의 대상 질병인 성문 폐쇄 부전증 또는 성대 손상은 상기 약학적 조성물의 치료 대상 질병과 관련하여 정의한 것과 같다.
본 발명의 일 구현예에서, 상기 대상체는 포유동물 또는 인간이다.
본 발명의 성문 폐쇄 부전증 또는 성대 손상의 치료방법은 유효성분으로서 상술한 항체를 공통적으로 사용하는 방법이므로, 중복되는 내용에 대해서는 본 명세서의 과도한 복잡성을 피하기 위하여 그 기재를 생략한다.
본 발명의 유효성분인 항 c-Met 항체는 c-Met, 및 성대 근육 생성과 관련된 유전자의 발현을 증가시킴으로써 성대 근육 강화, 성대 근위축을 저해하는 효과가 우수하고, 성대 손상에 있어 콜라겐의 생성을 저해하고 히알루론산의 생성을 촉진함으로써 성대 손상 치료 효과가 매우 우수하므로, 성문 폐쇄 부전증 또는 성대 손상 치료제로 유용하게 사용될 수 있다.
도 1은 항 c-Met 항체의 성대 근육 강화, 성대 근육 위축 저하 효과를 나타내기 위하여 성대 신경을 손상시키고, 항 c-Met 항체 주사 3주 후의 성대 근육 단면을 H&E 염색한 결과를 나타낸 도이다(X200).
도 2는 항 c-Met 항체의 성대 근육 강화, 성대 근육 위축 저하 효과를 나타내기 위하여 성대 신경을 손상시키고, 항 c-Met 항체 주사 3주 후의 성대 근육 단면을 myosin heavy chain staining한 결과를 나타낸 도이다(A: X200; B 및 C: 전체 근육 섬유의 단면적(Cross-sectional area, CSA); D: 단일 근육 섬유를 계수하여 정량화한 근육 섬유의 수; E: 단일 근육섬유의 단면적. *P < 0.05 vs Nor (Normal), # P < 0.05 vs PBS, $ P < 0.05 vs HGF).
도 3은 항 c-Met 항체의 성대 근육 강화, 성대 근육 위축 저하 효과의 기전을 확인하기 위하여 성대 신경을 손상시키고, 항 c-Met 항체 주사 3주 후의 성대 근육 단면을 c-Met staining한 결과를 나타낸 도이다(A: X200; B: c-Met staining의 상대적인 강도. *P < 0.05 vs Nor (Normal), # P < 0.05 vs PBS, $ P < 0.05 vs HGF).
도 4는 항 c-Met 항체의 성대 근육 강화, 성대 근육 위축 저하 효과의 기전을 확인하기 위하여 성대 신경을 손상시키고, 항 c-Met 항체 주사 3주 후의 성대 근육의 근육 생성과 관련된 유전자의 발현 정도를 실시간 PCR 검사 결과를 통하여 나타낸 것이다 (*P < 0.05 vs Nor (Normal), # P < 0.05 vs PBS, $ P < 0.05 vs HGF).
도 5는 항 c-Met 항체의 성대 손상 치료 효과를 확인하기 위하여 성대의 손상 및 항 c-Met 항체 주사 1주 후의 성대 근육의 근육 생성과 관련된 유전자의 발현 정도를 실시간 PCR 검사 결과를 통하여 나타낸 것이다 (*P < 0.05 vs Nor (Normal), # P < 0.05 vs PBS, $ P < 0.05 vs HGF).
도 6은 항 c-Met 항체의 성대 손상 치료 효과를 확인하기 위하여 성대의 손상 및 항 c-Met 항체 주사 2주 후의 성대 근육의 근육 생성과 관련된 유전자의 발현 정도를 실시간 PCR 검사 결과를 통하여 나타낸 것이다 (*P < 0.05 vs Nor (Normal), # P < 0.05 vs PBS, $ P < 0.05 vs HGF).
도 7은 항 c-Met 항체의 성대 손상 치료 효과를 확인하기 위하여 성대의 손상 및 항 c-Met 항체 주사 3주 후의 후두 조직의 조직학적 소견을 나타낸 도이다(A-D:H&E 염색, E-H: Masson's trichrome staining, I-L: Alcian blue staining, M: 콜라겐 침착 정도, N: 히알루론산 침착 정도, *P < 0.05 vs Nor (Normal), # P < 0.05 vs PBS, $ P < 0.05 vs HGF)
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.
실시예
본 명세서 전체에 걸쳐, 특정 물질의 농도를 나타내기 위하여 사용되는 "%"는 별도의 언급이 없는 경우, 고체/고체는 (중량/중량) %, 고체/액체는 (중량/부피) %, 그리고 액체/액체는 (부피/부피) %이다.
실험재료 및 방법
항 c-Met 항체의 준비
본 발명에 사용된 항 c-Met 항체는 WO2020/101365A1에 기재된 VH4/Vk2 항체이다. 이 항체의 아미노산 서열은 서열번호 1 내지 서열번호 8에 나타내었다.
상기 항 c-Met 항체의 c-Met 항원에 대한 친화력을 BIAcore (GE healthcare)를 이용하여 확인하였다. 항원으로는 인간 유래 C-Met단백질을 사용하였고, Ka 및 Kd 측정 값에 기초하여 친화력(KD)을 측정하였고 그 값은 4.23 x 10-10 M이었다.
통계 분석
이하의 모든 실험 데이터는 적어도 3회 반복하였다. 데이터는 평균± SEM로 나타내었다. 모든 통계적 분석은 Graph Pad Prism 5 software (GraphPad, Inc., La Jolla, CA, USA)을 이용하여 수행되었다. 다중 그룹간 비교는 one-way analysis of variance 및 post-hoc Tukey's tests를 이용하여 이루어졌다. P <0.05인 경우 통계적으로 유의성이 있는 것으로 해석되었다.
<실시예 1 내지 실시예 4>
본 발명자들은 성대 근육에 위축을 야기하는 질환에 있어, 본 발명의 항 c-Met 항체의 효과를 확인하기 위하여 하기 실시예 1 및 2와 같은 실험을 수행하였다.
실시예 1: 반회신경 절제 토끼 모델의 제작 및 조직학적 소견
실시예 1-1. 반회 신경 절제 토끼 모델의 제작
체중 3 kg의 뉴질랜드 백색 토끼 15마리를 사용하여 다음과 같이 반회신경 절제 모델을 제작하였다. 상기 반회신경 절제 토끼 모델의 제작은 가톨릭대학교 동물윤리 위원회의 승인을 받고, 기관 내 가이드라인에 따라 수행되었다.
먼저 각 토끼를 xylazine (Rompun 10 mg/kg; Bayer, Berlin, Germany)으로 전 마취하고, 케타민 (50 mg/kg)으로 근육 내 주사하여 마취를 유도하였다. 토끼를 복와위로 눕히고, 목 부의 털을 제거한 후, 목의 정중선을 따라 수직 절개하였다. 갑상선과 기관이 나타날때까지 스트랩 근육을 절개하였다. 갑상선의 협부를 분할하자, 우측 하갑상선 신경이 갑상선 내측의 하갑상동맥 주위에서 확인되었다. 우측의 반회신경( right recurrent laryngeal nerve)을 자른 후, 내시경을 사용하여 모든 토끼에서 우측 성대에 마비가 발생한 것을 확인하였다.
신경 절제 1 개월 후 후, 모든 토끼를 마취하고, 100 ng의 재조합 HGF 단백질(Millipore, Bedford, MA)를 포함하는 150 uL PBS, 100 ng의 항 c-MET 항체를 포함하는 150 uL PBS를 각각 실험군을 나누어 성대근(thyroarytenoid muscle)에 주사하였다. 대조군에는 150 uL PBS를 주사하였다. 주사는 0o 내시경으로 시야를 확보하고, 25 게이지의 니들이 구비된 주사기를 이용하여 수행되었다. 정확한 주사 위치는 성대근육이 주사되는 부피에 따라 팽창되는 것을 통해 확인하였다.
실시예 1-2. 조직병리적 검사 및 면역조직화학 검사 (Histopathological and immunohistochemical examination on rabbit tissue)
주사 주입술 후 3주후에 안락사 시킨 토끼의 각 그룹에서 5개의 후두를 채취하고, 조직학 검사를 수행하였다. 검체를 파라핀 블록에 포매하고, 4 μm 두께로 절편을 제작한 뒤 H&E 염색을 하였다. 염색이 완료된 샘플을 광학 현미경(Eclipse TE300; Nikon, Tokyo, Japan)으로 관찰하였다.
면역조직화학 검사를 위하여, 절편을 1:200로 희석한 anti-Fast Myosin Skeletal Heavy chain antibody (Abcam, Cambridge, MA) 또는 anti-Met (c-Met) antibody (Abcam)를 1% (v/v) 일반 염소 혈청, 및 1% (w/v) BSA를 포함하는 PBS에 넣고 4℃에서 하룻밤 배양하였다. PBS로 세척한 후, 절편을 1:500으로 희석한 Alexa fluor 488-접합 항-마우스 IgG antibodies (Cell signaling Technology, Beverly, MA) 또는 Alexa fluor 594-접합 항-마우스 IgG 항체와 1시간동안 실온 및 암소에서 반응시켰다. 절편을 헤마톡실린으로 염색하고, 농도구배의 알코올/물의 혼합물과 자일렌으로 재수화시킨 후, 커버 슬립을 덮었다. 염색된 샘플은 디지털 카메라가 구비된 도립현미경(Eclipse TE300; Nikon, Tokyo, Japan)으로 관찰하였다. 염색부위는 ImageJ software (National Institutes of Health, Bethesda, Maryland)를 이용하여 염색된 픽셀의 넓이를 계산함으로써 면역염색화학의 정도를 평가하였다.
토끼 우측 갑상피열근 조직 소견
본 발명자들은 주사 3주 후 토끼의 우측 갑상피열근(thyroarytenoid muscle, TA muscle)의 조직 소견을 확인하였다. 결과는 도 1 내지 도 3에 나타내었다.
도 1에 나타낸 바와 같이, PBS를 주사한 군에서는 내인성 근육의 단면적이 정상대조군과 비교하여 크게 감소하였다. HGF를 주사한 군에서는 PBS를 주사한 군에 비하여 근육 단면적이 증가하였으나, 여전히 정상군과 비교하여서는 감소하였다. 그러나, 항 c-MET 항체를 주사한 군에서는 PBS 및 HGF를 주사한 군에 비하여 근육 단면적이 증가하였으며, 정상군과 비교하여 유의적인 차이가 없었다.
또한, 도 2에 나타낸 바와 같이, 근섬유의 수는 그룹간에 유의적인 차이가 없었으나, 단일 근섬유의 단면적은 HGF와 항 c-MET 항체를 주사한 군에서 PBS를 주사한 군에 비하여 증가되었다.
또한, 같은 슬라이드에서 C-MET의 발현 수준을 측정한 결과를 도 3에 나타내었다. 도 3에 나타낸 바와 같이, C-MET의 발현 수준은 정상대조군에 비하여 PBS를 주사한 군에서 감소하였다. HGF와 항 c-MET 항체를 주사한 군에서는 C-MET의 발현 수준은 증가하는 경향을 나타내었다.
실시예 2: 반회신경 절제 랫트 모델의 제작 및 유전자 발현 수준
실시예 2-1. 반회신경 절제 랫트 모델의 제작
본 발명의 항 c-Met 아고니스틱 항체의 성대 근재생 효과를 확인하기 위하여, 다음과 같이 반회신경 절제 랫트 모델을 제작하였다. 상기 반회신경 절제 랫트 모델의 제작은 가톨릭대학교 동물윤리 위원회의 승인을 받고, 기관 내 가이드라인에 따라 수행되었다.
24마리의 SD 랫트(Sprague-Dawley rat)를 마취시키고 케타민(ketamine hydrochloride) (100 mg/kg) 및 자일라진 (xylazine hydrochloride) (10 mg/kg)을 복강내 투여하였다. 각 동물을 눕히고 목의 정중선을 따라 절개하였다. 갑상선과 기관이 나타날 때까지 스트랩 근육을 절개하였다. 갑상선의 협부를 분할하자, 우측 하갑상선 신경이 갑상선 내측의 하갑상동맥 주위에서 확인되었다. 우측의 반회신경( right recurrent laryngeal nerve)을 자른 후, 소아과용 내시경을 사용하여 모든 랫트에서 우측 성대에 마비가 발생한 것을 확인하였다.
신경 절제 1개월 후, 모든 랫트를 마취하고, 100 ng의 재조합 HGF 단백질(Millipore, Bedford, MA)를 포함하는 50 uL PBS, 100 ng의 항 c-MET 항체를 포함하는 50 uL PBS를 각각 실험군을 나누어 성대근(thyroarytenoid muscle)에 주사하였다. 대조군에는 50 uL PBS를 주사하였다. 주사는 소아과용 후두경으로 시야를 확보하고, 30 게이지의 니들이 구비된 주사기를 이용하여 수행되었다.
실시예 2-2. RNA 분리 및 실시간 RT-PCR을 이용한 마우스의 유전자 발현 수준
상기 각 시험물질의 주사 2주 후에 성대를 채취하고, TissueLyser II (Qiagen, Valencia, CA)를 이용하여 균질화하였다. 총 RNA를 TRIzol 시약 (Invitrogen, Carlsbad, CA)을 이용해 추출하였다. 그런 다음 1-μg의 RNA로부터 Reverse Transcriptase Premix Kit (Elpis Biotech, Daejeon, Korea)를 이용하여 cDNA를 합성하였다. 실시간 PCR은 Power SYBR Green PCR Master Mix (Applied Biosystems), 500 nM forward 프라이머 및 reverse 프라이머, 및 1 μL의 cDNA를 포함하는 20-μL 반응 혼합물 내에서 ABI 7500 FAST (Applied Biosystems, Forster City, CA)를 이용하여 수행하였다. 유전자 발현 수준은 2-DDCT 법을 사용하여 GAPDH로 정규화하였다. 프라이머 서열은 표 1에 나타내었다:
구분 서열 SEQ ID NO:
GAPDH Forward ACCACAGTCCATGCCATCAC 9
GAPDH Reverse TCCACCACCCTGTTGCTGTA 10
MHC type IIA Forward TTGCTCTACCCAACCCTAAGGATG 11
MHC type IIA Reverse TTGTGTTTCTGCCTGAAGGTGC 12
MyoD Forward CGACTGCCTGTCCAGCATAG 13
MyoD Reverse GGACACTGAGGGGTGGAGTC 14
본 발명자들은 주사 2주 후 마우스의 우측 갑상피열근에서 근생성과 관련된 유전자의 발현 수준을 측정하였다. 결과는 도 4에 나타내었다.
도 4에 나타낸 바와 같이, Myosin heavy chain type IIA의 발현 수준은 PBS 주사 그룹에서 크게 증가하였고, HGF 및 항 c-MET 항체 주사 군에서는 PBS 주사군에 비하여 감소하였다. MyoD의 발현 수준은 PBS 주사군에서 정상 대조군에 비하여 감소하였으나 유의적 차이는 없었다. MyoD의 발현 수준은 항 c-MET 항체 주사군에서만 PBS 주사군에 비하여 유의성 있게 증가되었다.
상기 결과로부터, 반회 신경을 절제한 성대마비 동물 모델에서 항 c-MET agonistic antibody는 성대근 재생에 있어 HGF 보다 효과적임을 알 수 있었다.
<실시예 3>
본 발명자들은 다양한 원인에 의한 성대의 손상에 대하여, 본 발명의 항 c-Met 항체의 효과를 확인하기 위하여 하기 실시예 3과 같은 실험을 수행하였다.
실시예 3: 성대 손상 랫트 모델의 제작 및 유전자 발현 수준
실시예 3-1. 성대 손상 랫트 모델의 제작 및 항 c-MET 항체의 주사
본 발명의 성대 손상 랫트 모델은 다음과 같이 제작되었다. 상기 성대 손상 랫트 모델의 제작은 가톨릭대학교 동물윤리 위원회의 승인을 받고, 기관 내 가이드라인에 따라 수행되었다.
총 45 마리의 SD 랫트가 본 연구에 사용되었다. 각 실험군(HGF 주사군, 항 c-MET 항체 주사군)마다 15마리의 랫트가 사용되었고, 15마리는 대조군(PBS 주사군)에 사용되었다. 각 군마다 3마리의 랫트는 조직학적 검사에 사용되었다.
모든 동물들은 케타민 (ketamine hydrochloride) (100 mg/kg)과 자일라진 (xylazine hydrochloride) (10 mg/kg)으로 마취된 후 눕혀졌다. 후두는 소아과용 내시경우로 시각화되었고, 우측 성대를 미세가위로 갑상피열근(thyroarytenoid muscle, TA muscle)이 노출될 때까지 손상되었다. 좌측 성대는 무처리군(정상대조군)으로 사용되었다. 성대근의 손상 직후, 100 ng의 재조합 HGF 단백질(Millipore, Bedford, MA)를 포함하는 50 uL PBS, 100 ng의 항 c-Met 항체를 포함하는 50 uL PBS를 우측 성대에 주사하였다. 성대 손상 대조군(scar control group)에는 50 uL PBS를 우측 성대에 주사하였다. 주사는 30-게이지의 니들을 구비한 주사기로 소아과용 후두경으로 시야를 확보하여 이루어졌다.
실시예 3-2. 성대 손상 랫트의 유전자 발현 수준
우측성대를 손상시키고 1주 후와 2주 후에 각 군에서 6마리의 후두를 적출하여 상기 실시예 2-2와 같은 방법으로 총 RNA를 추출하고 cDNA를 합성하였고, 실시간 PCR 검사를 통하여 hyaluronan synthase 1 (HAS 1), HAS2, HAS3, 및 프로콜라겐 III를 인코딩하는 유전자인 COL III, 파이브로넥틴을 인코딩하는 유전자 FN 및 MMP2의 발현 수준을 측정하였다. 유전자의 상대적인 발현 수준은 glyceraldehyde-3-phosphate dehydrogenase (GAPDH)을 기준으로 측정되었다.
상기 유전자 수준 측정에 사용된 프라이머의 서열은 표 2에 나타내었다.
구분 서열(5' to 3') SEQ ID NO:
GAPDH Forward ACCACAGTCCATGCCATCAC 9
GAPDH Reverse TCCACCACCCTGTTGCTGTA 10
HAS1 Forward TAGGTGCTGTTGGAGGAGATGTGA 15
HAS1 Reverse AAGCTCGCTCCACATTGAAGGCTA 16
HAS2 Forward CCAATGCAGTTTCGGTGATG 17
HAS2 Reverse ACTTGGACCGAGCCGTGTAT 18
HAS3 Forward CCTCATCGCCACAGTCATACAA 19
HAS3 Reverse CCACCAGCTGCACCGTTAG 20
FN Forward CGAGGTGACAGAGACCACAA 21
FN Reverse CTGGAGTCAAGCCAGACACA 22
MMP2 Forward GTCACTCCGCTGCGCTTTTCTCG 23
MMP2 Reverse GACACATGGGGCACCTTCTGA 24
COL III Forward CACTGGGGAATGGAGCAAAAC 25
COL III Reverse ATCAGGACCACCAATGTCATAGG 26
성대 손상 1주 후 및 2주 후의 유전자 발현 수준의 결과는 도 5 및 도 6에 각각 나타내었다.
성대 손상 1주 후 유전자 발현 수준 (도 5)
도 5에 나타낸 바와 같이, PBS 주사군과 HGF 주사군, 정상군 사이에는 HAS 1, HAS 2, 및 HAS3의 mRNA 발현 수준에서는 유의적인 변화가 관찰되지 않았다.
프로콜라겐 타입 III를 인코딩하는 유전자 COL III의 mRNA 발현 수준은 PBS 주사군에 비하여 항 c-MET 항체 주사군에서 감소하였다.
반면, FN 유전자의 발현 수준은 정상대조군에 비하여 PBS 주사군 및 HGF 주사군에서 상향조절되었고, 항 c-Met 항체 투여군에서는 PBS 주사군에 비하여 감소하였다.
마지막으로 콜라겐 및 FN 분해효소 인코딩 하는 유전자 MMP2 (matrix metalloproteinase-2, type IV collagenase)의 mRNA 발현 수준은 정상, PBS 주사군, HGF 주사군, 그리고 항 c-MET 항체 주사군에서 차이가 없었다.
성대 손상 2주 후 유전자 발현 수준 (도 6)
도 6에 나타낸 바와 같이, 성대 손상 2주 후 HAS1, HAS2, HAS3를 인코딩하는 mRNA의 발현 수준은 PBS 주사군에 비하여 HGF 주사군 및 항 c-MET 항체 주사군에서 증가되었다.
프로콜라겐 타입 III를 인코딩하는 유전자 COL III의 mRNA 발현 수준은 성대 손상 1주 후의 결과와 유사하게 PBS 주사군에 비하여 항 c-MET 항체 주사군에서 감소하였다.
FN 유전자의 발현 수준도 성대 손상 1주 후의 결과와 유사하게 정상대조군에 비하여 PBS,HGF 주사군 및 항 c-MET 항체 투여군에서 상향 조절되었으나, 항 c-Met 항체 투여군에서는 PBS 주사군에 비하여 유의하게 감소하는 결과를 보였다.
마지막으로 콜라겐 및 FN 분해효소를 인코딩하는 유전자 MMP2 (matrix metalloproteinase-2, type IV collagenase)의 mRNA 발현 수준은 성대 손상 1주후의 결과와 유사하게 정상, PBS, HGF 및 항 c-MET 항체 주사군에서 큰 차이를 보이지 않았다.
상기 결과로부터 본 발명의 항 c-Met 항체의 투여는 COL III 및 FN의 mRNA 발현을 억제하여 항섬유화 효과가 우수하다는 점을 확인할 수 있었고, 항 c-Met 항체의 투여 후 2주 후부터 콜라겐의 분해를 촉진하면서, 히알루론산의 합성을 증가시켜 성대의 손상을 회복시키는 효과가 우수하다는 점을 알 수 있었다.
실시예 3-3. 성대 손상 랫트의 조직병리학적 분석
우측 성대 손상 3주 후, 각 군의 랫트에서 3마리씩을 안락사하여 후두를 적출하였다. 후두 조직을 파라핀 블록에 포매한 후 40 um의 두께로 세절하고, H&E, Masson's trichrome (콜라겐 염색용), 또는 Verhoeff-Van Giesen stain (탄력섬유 염색용)으로 염색하였다. 염색이 완료된 샘플은 광학현미경 (Eclipse TE300; Nikon, Tokyo, Japan)으로 염색하였다. 또한, 면역 염색으로 염색된 세포외 기질의 면적을 측정하여 밀도계 분석을 수행하였다. 염색 면적은 ImageJ software (National Institutes of Health, Bethesda, Maryland)를 이용하여 측정되었다. 결과는 도 7에 나타내었다.
도 7에 나타낸 바와 같이, 밀도계 분석 결과, 본 발명의 항 c-Met 항체 주사군은 PBS 주사군과 비교하여 더 우수한 항-섬유화 효과를 나타내었다.
Masson's trichrome 염색은 c-Met 항체 주사군에서 콜라겐의 침착이 PBS 주사군과 비교하여 유의적으로 감소하였음을 보여주었다. HGF 주사군도 PBS 주사군에 비하여 적은 콜라겐의 침착을 나타내었으나, 유의성은 없었다.
히알루론산은 alcian blue 염색에 의해 확인되었다. 항 c-MET 항체 주사군에서는 히알루론산의 침착이 PBS 주사군에 비해 유의적으로 증가되었다. HGF 주사군에서도 PBS 주사군에 비해 히알루론산의 침착이 증가되었으나 유의적 차이는 없었다.
상기 결과로부터. 본 발명의 항 c-Met 항체는 항섬유화 효과가 우수하고 콜라겐의 분해를 촉진하면서, 히알루론산의 합성을 증가시켜 손상된 성대의 회복에 효과적이라는 것을 확인하였다.

Claims (7)

  1. 항 c-Met 어고니스틱 항체(anti c-Met agonistic antibody)를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물.
  2. 제1항에 있어서, 상기 항 c-Met 어고니스틱 항체는 c-Met에 특이적으로 결합하는 항체인, 약제학적 조성물.
  3. 제2항에 있어서, 상기 c-Met에 특이적으로 결합하는 항체는 다음을 포함하는 것인, 약제학적 조성물:
    i) 서열번호 1의 아미노산 서열을 포함하는 CDR-H1, 서열번호 2의 아미노산 서열을 포함하는 CDR-H2, 서열번호 3의 아미노산 서열을 포함하는 CDR-H3를 포함하는 중쇄가변영역; 및
    ii) 서열번호 4의 아미노산 서열을 포함하는 CDR-L1, 서열번호 5의 아미노산 서열을 포함하는 CDR-L2, 서열번호 6의 아미노산 서열을 포함하는 CDR-L3를 포함하는 경쇄가변영역.
  4. 제2항에 있어서, 상기 c-Met에 특이적으로 결합하는 항체는 다음을 포함하는 것인, 약제학적 조성물:
    서열번호 7의 아미노산 서열을 포함하는 중쇄가변영역 및 서열번호 8의 아미노산 서열을 포함하는 경쇄가변영역.
  5. 제1항에 있어서, 상기 성문 폐쇄 부전증은 성대 마비, 성대근 위축, 노인성 후두로 인한 성문 폐쇄 부전증인, 약제학적 조성물.
  6. 제1항에 있어서, 상기 성대 손상은 후두암, 성대결절, 폴립, 낭종 제거로 이루어진 군으로부터 선택된 원인에 의한 후두 미세 수술로 인하여 발생하는 성대 손상인, 약제학적 조성물.
  7. 제1항 내지 제6항 중 어느 한 항의 약제학적 조성물을 치료가 필요한 대상체에 투여하는 단계를 포함하는 성문 폐쇄 부전증 또는 성대 손상의 치료방법.
PCT/KR2022/014294 2021-10-08 2022-09-23 항 c-met 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물 WO2023058972A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210133932A KR20230050747A (ko) 2021-10-08 2021-10-08 항 c-Met 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물
KR10-2021-0133932 2021-10-08

Publications (1)

Publication Number Publication Date
WO2023058972A1 true WO2023058972A1 (ko) 2023-04-13

Family

ID=85804462

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/014294 WO2023058972A1 (ko) 2021-10-08 2022-09-23 항 c-met 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물

Country Status (2)

Country Link
KR (1) KR20230050747A (ko)
WO (1) WO2023058972A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150118785A (ko) * 2014-04-15 2015-10-23 인하대학교 산학협력단 약물 전달체 및 이를 포함하는 성대 재생을 위한 약학적 조성물
KR101615619B1 (ko) * 2014-08-07 2016-04-26 주식회사 파멥신 c-Met 특이적 인간 항체 및 그 제조방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20150118785A (ko) * 2014-04-15 2015-10-23 인하대학교 산학협력단 약물 전달체 및 이를 포함하는 성대 재생을 위한 약학적 조성물
KR101615619B1 (ko) * 2014-08-07 2016-04-26 주식회사 파멥신 c-Met 특이적 인간 항체 및 그 제조방법

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHOI HYUNSU, CHOUNG-SOO KIM: "Novel c-Met injection for the vocalis muscle regeneration", 제27차 이비인후과 종합학술대회 (THE 27TH OTORHINOLARYNGOLOGY GENERAL ACADEMIC CONFERENCE). 21-22 OCTOBER 2021, 1 October 2021 (2021-10-01), XP093056910, Retrieved from the Internet <URL:https://www.korl.or.kr/workshop/abstract_view/view_abstract.php?code=27&number=270172> [retrieved on 20230622] *
CHOI HYUNSU, YU SEUNG-SHIN, CHOI JIWON, KIM CHOUNG-SOO: "The Regenerative Effects of c-Met Agonistic Antibodies in Vocal Fold Atrophy", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 23, no. 14, 15 July 2022 (2022-07-15), pages 7818, XP093056865, DOI: 10.3390/ijms23147818 *
HANSEN, J.K. THIBEAULT, S.L.: "Current Understanding and Review of the Literature: Vocal Fold Scarring", JOURNAL OF VOICE, ELSEVIER SCIENCE, US, vol. 20, no. 1, 1 March 2006 (2006-03-01), US , pages 110 - 120, XP005301793, ISSN: 0892-1997, DOI: 10.1016/j.jvoice.2004.12.005 *
HIRANO SHIGERU, THIBEAULT SUSAN, CHARLES N, FORD, MADISON, DIANE M, BLESS, SHIN-ICHI KANEMARU: "HEPATOCYTE GROWTH FACTOR AND ITS RECEPTOR C-MET IN RAT AND RABBIT VOCAL FOLDS", ANNALS OF OTOLOGY, RHINOLOGY & LARYNGOLOGY, vol. 111, 1 January 2002 (2002-01-01), pages 661 - 666, XP093056836 *
KISHIMOTO YO, HIRANO SHIGERU, SUEHIRO ATSUSHI, TATEYA ICHIRO, KANEMARU SHIN-ICHI, NAKAMURA TATSUO, ITO JUICHI: "Effect of Exogenous Hepatocyte Growth Factor on Vocal Fold Fibroblasts", ANNALS OF OTOLOGY, RHINOLOGY AND LARYNGOLOGY, ANNALS PUBL., ST. LOUIS, MO, US, vol. 118, no. 8, 1 August 2009 (2009-08-01), US , pages 606 - 611, XP093056861, ISSN: 0003-4894, DOI: 10.1177/000348940911800813 *

Also Published As

Publication number Publication date
KR20230050747A (ko) 2023-04-17

Similar Documents

Publication Publication Date Title
US11680097B2 (en) Antibodies against canine PD-1
WO2014119969A1 (ko) 보체 관련 질환의 예방 및 치료를 위한 c5 항체 및 방법
WO2011030935A1 (en) Antibodies against glucagon receptor and their use
TWI772904B (zh) Ｃｄ３９的高親和力抗體及其用途
IL183541A (en) TLR3 antagonists, methods and uses
RU2013125459A (ru) АНТИТЕЛА ПРОТИВ БЕЛКА РЕЦЕПТОРА c-Met
KR20110103431A (ko) 미오스타틴 결합 단백질
HUE024996T2 (en) Anti-MASP-2 antibodies
RU2770209C2 (ru) Терапевтические антитела против лиганда cd40
CN113166241A (zh) 人类znt8抗体
KR102599010B1 (ko) 항-herv-k 엔벨로프 항체 및 그 용도
WO2023058972A1 (ko) 항 c-met 항체를 유효성분으로 포함하는 성문 폐쇄 부전증 또는 성대 손상 치료용 약제학적 조성물
WO2017074013A1 (ko) 인간 및 마우스 sema3a에 교차결합하는 항체 및 그의 용도
WO2018124851A1 (ko) L1cam 단백질에 특이적으로 결합하는 항체; 및 피리미딘 유사체 및/또는 플라틴계 항암제를 포함하는 암의 예방 또는 치료용 약학적 조성물
WO2023027507A1 (ko) 자가면역질환의 예방 또는 치료를 위한 항체의약품
WO2023014128A1 (ko) Api5에 특이적으로 결합하는 항체 및 이의 용도
WO2022098173A1 (ko) 코로나바이러스 스파이크 단백질에 특이적인 항체 및 이의 용도
KR101914227B1 (ko) 아세틸화된 인간 BubR1에 특이적으로 결합하는 항체 및 그 용도
US9951146B2 (en) Anti-CD20− / anti-BAFF bispecific antibodies
AU2012241182A1 (en) Toll like receptor 3 antagonists, methods and uses

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22878793

Country of ref document: EP

Kind code of ref document: A1