WO2023055198A1 - 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 치료용 조성물 - Google Patents

반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 치료용 조성물 Download PDF

Info

Publication number
WO2023055198A1
WO2023055198A1 PCT/KR2022/014816 KR2022014816W WO2023055198A1 WO 2023055198 A1 WO2023055198 A1 WO 2023055198A1 KR 2022014816 W KR2022014816 W KR 2022014816W WO 2023055198 A1 WO2023055198 A1 WO 2023055198A1
Authority
WO
WIPO (PCT)
Prior art keywords
alzheimer
disease
composition
apoe4
present
Prior art date
Application number
PCT/KR2022/014816
Other languages
English (en)
French (fr)
Inventor
고영훈
김부윤
김재광
최장기
오태우
박맑은
박여진
서진수
이혜인
Original Assignee
한국한의학연구원
재단법인대구경북과학기술원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국한의학연구원, 재단법인대구경북과학기술원 filed Critical 한국한의학연구원
Priority to CN202280066673.XA priority Critical patent/CN118103053A/zh
Publication of WO2023055198A1 publication Critical patent/WO2023055198A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A61K36/888—Araceae (Arum family), e.g. caladium, calla lily or skunk cabbage
    • A61K36/8888—Pinellia
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/105—Plant extracts, their artificial duplicates or their derivatives
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/25—Araliaceae (Ginseng family), e.g. ivy, aralia, schefflera or tetrapanax
    • A61K36/258—Panax (ginseng)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/48—Fabaceae or Leguminosae (Pea or Legume family); Caesalpiniaceae; Mimosaceae; Papilionaceae
    • A61K36/484—Glycyrrhiza (licorice)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/53—Lamiaceae or Labiatae (Mint family), e.g. thyme, rosemary or lavender
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/71—Ranunculaceae (Buttercup family), e.g. larkspur, hepatica, hydrastis, columbine or goldenseal
    • A61K36/718—Coptis (goldthread)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/185—Magnoliopsida (dicotyledons)
    • A61K36/72—Rhamnaceae (Buckthorn family), e.g. buckthorn, chewstick or umbrella-tree
    • A61K36/725—Ziziphus, e.g. jujube
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18—Magnoliophyta (angiosperms)
    • A61K36/88—Liliopsida (monocotyledons)
    • A61K36/906—Zingiberaceae (Ginger family)
    • A61K36/9068—Zingiber, e.g. garden ginger
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/322—Foods, ingredients or supplements having a functional effect on health having an effect on the health of the nervous system or on mental function
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • the present invention is Banha, jujube, licorice, ginseng, health, gold and barberry mixed extract containing as an active ingredient, a pharmaceutical composition for preventing or treating Alzheimer's; Banha, jujube, licorice, ginseng, health, gold, and barberry extract containing as an active ingredient, a health functional food composition for preventing or improving Alzheimer's disease; A quasi-drug composition for preventing or improving Alzheimer's, containing a mixed extract of banha, jujube, licorice, ginseng, health, golden, and barberry as an active ingredient; Or it relates to a method for treating Alzheimer's, comprising administering the pharmaceutical composition to a subject.
  • Alzheimer's disease is a progressively progressive deterioration of cognitive functions, including memory, and is the most common degenerative brain disease.
  • the main symptoms of Alzheimer's are so-called psychobehavioral symptoms such as memory loss, decline in language ability, decline in time and space awareness, decline in judgment and daily life performance, personality change, agitated behavior, depression, delusion, etc., as well as fecal incontinence and behavioral disorders.
  • physical symptoms such as
  • Alzheimer's The incidence of Alzheimer's is continuously increasing worldwide due to the increase in the elderly population due to the increase in life expectancy. Experts predict that in 2050, the number of patients with Alzheimer's will reach 13.8 million in the United States and 2.37 million in Korea, so the severity is getting higher. Accordingly, research for the treatment and improvement of Alzheimer's disease is being actively conducted worldwide.
  • Alzheimer's disease is caused by various mechanisms such as hyperphosphorylation of tau protein, inflammatory response, deposition in the brain due to excessive production of beta amyloid, and oxidative damage. All causes of these mechanisms have not yet been accurately identified, but among them, genetic causes are reported to explain about 40-50% of all Alzheimer's disease.
  • mutations in the amyloid precursor protein gene and presenilin gene are genetic factors that increase the risk of early onset Alzheimer's disease, in which symptoms begin at the age of less than 65 years, and the ApoE4 allele of the apolipoprotein E gene is mainly It is known to be a genetic factor that increases the risk of late onset Alzheimer's disease, which symptoms begin after the age of 65.
  • Korean Patent Publication No. 10-2010-0126326 A discloses a composition containing superoxide dismutase and S-adenosylmethionine for the treatment of Alzheimer's caused by overexpression of presenilin 1 and BACE. are starting As such, although some studies exist, research on a specific therapeutic agent according to a specific cause of Alzheimer's disease has not yet been actively conducted.
  • the ApoE gene refers to a gene encoding a sequence of apolipoprotein E (ApoE).
  • the ApoE gene encodes a component protein of lipoproteins, which are normal components of plasma, such as HDL (High Density Lipoprotein), LDL (Low Density Lipoprotein), and VLDL (Very Low Density Lipoprotein), and is located on chromosome 19 to transport fat. It is known to play a key role in regulating fat metabolism after damage to the central and peripheral nervous system.
  • the ApoE gene has three allelic genotypes, E2, E3 and E4. Among the allelic genotypes, E2 and E4 are known to be associated with Alzheimer's disease.
  • the E4 allele of apolipoprotein (ApoE4) is a risk factor for the development of Alzheimer's disease, and the E2 allele of apolipoprotein (ApoE2) is Alzheimer's disease. It is known to be a protective factor in the onset of disease. It is known that about 10-15% of all patients with Alzheimer's disease develop the disease due to the ApoE4 genetic mutation.
  • the ApoE4 genotype is one of the main causes of Alzheimer's disease, and the present inventors have made intensive research efforts to develop a composition specifically active against Alzheimer's disease caused by genetic mutation of ApoE4.
  • the amyloid beta-reducing effect specific to ApoE4-induced Alzheimer's of Banha, jujube, licorice, ginseng, health, golden, and barberry extract (hereinafter referred to as Banha Sasim-tang) was identified, and the ApoE4 genetic mutation of Banha Sasim-tang was the cause.
  • Banha Sasim-tang amyloid beta-reducing effect specific to ApoE4-induced Alzheimer's of Banha, jujube, licorice, ginseng, health, golden, and barberry extract
  • One object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of Alzheimer's, containing a mixed extract of banha, jujube, licorice, ginseng, health, golden and barberry as an active ingredient.
  • Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of Alzheimer's disease caused by ApoE4 gene mutation, comprising a mixed extract of Banha, jujube, licorice, ginseng, health, golden and barberry as an active ingredient.
  • Another object of the present invention is to provide a health functional food composition for preventing or improving Alzheimer's disease, containing a mixed extract of banha, jujube, licorice, ginseng, health, golden and barberry rhizome as an active ingredient.
  • Another object of the present invention is to provide a quasi-drug composition for preventing or alleviating Alzheimer's disease, containing a mixed extract of banha, jujube, licorice, ginseng, health, golden and barberry rhizome as an active ingredient.
  • Another object of the present invention is to provide a method for treating Alzheimer's, comprising administering the composition to a non-human subject.
  • the present invention relates to the use of a composition comprising banha, jujube, licorice, ginseng, health, golden and barberry mixed extracts as an active ingredient for preventing, improving or treating Alzheimer's disease.
  • Banha, jujube, licorice, ginseng, health, golden and barberry mixed extracts as an active ingredient in one aspect of the present invention for achieving the above object provides a pharmaceutical composition.
  • Banhasasimtang ( ⁇ ) refers to a mixed extract of Banha, jujube, licorice, ginseng, health, golden and barberry, and may be used interchangeably herein.
  • the banha sasimtang can be prepared by a method commonly used in the art.
  • Banhasasimtang is generally known to be used for symptoms such as gastritis, gastric dilatation, gastroduodenal ulcer, and gastroenteritis in oriental medicine.
  • the banha sasimtang may be a mixture of banha, jujube, health, gold, ginseng, licorice, and barberry extract or a mixture of each component extract, but is not limited thereto.
  • the ratio of Banha:Jujube:Licorice:Ginseng;Health:Golden:Hwangryun contained in the Banhasasimtang is about 1.2 - 2.0: 0.8 - 1.2: 0.8 - 1.2: 0.8 - 1.2: 0.6 - 1.0: 0.8 - 1.2 : 0.2 - 0.5, but is not limited thereto.
  • the banha sasimtang is about 1.2 - 2.0 g of banha, about 0.8 - 1.2 g of jujube, about 0.8 - 1.2 g of licorice, about 0.8 - 1.2 g of ginseng, about 0.6 - 1.0 g of health, about 0.8 - about golden.
  • 1.2 g, and about 0.2 - 0.5 g of barberry rhizome may be a mixed extract, but is not limited thereto.
  • the banha sasimtang is a mixture of about 1.67 g of banha, about 1 g of jujube, about 1 g of licorice, about 1 g of ginseng, about 0.83 g of health, about 1 g of gold, and about 0.33 g of barberry or a similar ratio. It may be an extract of a mixed solution in which only the mass is different, but is not limited thereto.
  • Bossh in the present invention generally refers to the de-corked tuber of Pinellia ternata Popebach. It is also known by names such as Jimun( ⁇ ) and Banha( ⁇ ). It has almost no odor, is slightly mucilaginous, has a very pleasant taste and is warm in nature. It is used for phlegm, seawater, and asthma against oriental medicine, and can be used for symptoms such as headache, dizziness, chest tightness, full symptoms, vomiting, sore throat, boils on the back, mastitis, and vomiting of pregnancy due to phlegm. It is reported to have expectorant, antitussive, soothing vomiting, prevention of silicosis, and anticancer activity as pharmacological actions.
  • jube in the present invention means the fruit of a jujube tree, and its scientific name is Ziziphus . jujuba var. It is inermis . It is also known as millet or wood wheat. It has a reddish-brown surface, an oval shape, and a length of 1.5 to 2.5 cm. When ripe, it tastes sweet. In oriental medicine, jujube is reported to be used as a diuretic, tonic, and laxative.
  • licorice ( ⁇ ) is a perennial herbaceous plant belonging to the leguminous family, and the scientific name is Glycyrrhiza uralensis FISCH.
  • the licorice is also named Gukro, Micho, Mandarin, cafeo, Youngtong, Chomcho, Rocho, and the like.
  • the outer skin of licorice is reddish brown or dark brown and has vertical wrinkles.
  • licorice is reported to be used as a component that harmonizes the toxicity of medicine to make the medicinal effect appear well, control the heat and morale of the ledger, improve the communication of all blood vessels, and strengthen muscles and bones.
  • ginseng in the present invention means the root of ginseng Panax ginseng C. A. Meyer (Araliaceae).
  • the ginseng is also called Gwigae, Geumjeongokran, Shincho, Okjeong, Inmi, Inham, Jeongji, Tojeong, Haesam, Bloodsam, Bloodsam, Hwangsam, Yasansam, Byeojiksam, and the like.
  • Ginseng has a peculiar smell, tastes sweet and slightly bitter, and is warm in nature.
  • ginseng provides energy, is used for physical weakness, boredom, fatigue, anorexia, vomiting, and diarrhea, and has been reported to enhance renal function.
  • Health in the present invention is ginger ( Zingiber officinale Roscoe) means dried rhizomes. Health is also called baekgang ( ⁇ ), gyungang ( ⁇ ), and has a peculiar smell, and the medicine is spicy and hot. Health has pharmacological effects such as anti-inflammation, pain relief, and antibacterial action.
  • golden in the present invention refers to the root of Scutellaria baicalensis belonging to the genus Scutellaria of the Lamiaceae family or with the perianth removed. Gold has almost no odor and tastes slightly bitter. Gold is reported to have pharmacological effects such as anticancer, liver protection, and antioxidant.
  • the term "Quantum rhizome” refers to an evergreen perennial plant of the dicotyledonous plant Buttercupaceae Buttercupaceae.
  • the scientific name of the yellow lotus is Coptis chinensis , bitter in taste and cold in nature.
  • Berberine a major component of Barberry, is reported to pharmacologically exhibit antibacterial action against intestinal bacteria, soothing and antispasmodic action, anti-arteriosclerosis action, anti-inflammatory action, choleretic action, and pancreatic juice secretion promoting action.
  • extract refers to an extract obtained by extracting Banha, jujube, licorice, ginseng, health, golden, and barberry, a diluted or concentrated liquid of the extract, a dried product obtained by drying the extract, It includes extracts of all formulations that can be formed using the extract itself and the extract, such as a refined product or a purified product of the extract, or a mixture thereof.
  • the extract of the present invention may be prepared and used in the form of a dry powder after extraction.
  • the banha, jujube, licorice, ginseng, health, gold, or barberry can be purchased commercially, or grown or collected in nature, without limitation.
  • the banha, jujube, licorice, ginseng, health, gold, and barberry mixed extracts are extracted and mixed with each plant, or the banha, jujube, licorice, ginseng, health, gold, and barberry are all mixed.
  • a post-extraction method may be used, and the mixing process may be performed before or after extraction, and preferably, a step of mixing each plant after extraction may be performed, but is not limited thereto.
  • the type of extraction solvent used to extract the extract in the present invention is not particularly limited, and any solvent known in the art may be used.
  • Non-limiting examples of the extraction solvent include water; lower alcohols having 1 to 4 carbon atoms such as methanol, ethanol, propyl alcohol and butyl alcohol; polyhydric alcohols such as glycerin, butylene glycol, and propylene glycol; and hydrocarbon solvents such as methyl acetate, ethyl acetate, acetone, benzene, hexane, diethyl ether, and dichloromethane; or mixtures thereof may be used.
  • the extract may be water or a lower alcohol extract having 1 to 4 carbon atoms, but is not limited thereto.
  • a method for extracting the extract is not particularly limited, and may be extracted according to a method commonly used in the art.
  • Non-limiting examples of the extraction method include a hot water extraction method, an ultrasonic extraction method, a filtration method, a reflux extraction method, and the like, which may be performed alone or in combination of two or more methods.
  • the banha, jujube, licorice, ginseng, health, golden and barberry mixed extracts are extracted by conventional additional processes that can be applied to plant extracts such as concentration, filtration, fractionation, drying, grinding, etc. prepared, concentrates, filtrates, fractions, dried products, pulverized products, and the like.
  • the 'concentrate' may refer to a substance in which the concentration of the main solid component is increased by removing a solvent or the like from a chemical substance, and the 'filtrate' is a mixture of liquid and solid using the difference in particle size.
  • the 'fraction' refers to a product obtained by a fractionation method for separating a specific component or a specific group from a mixture containing various constituents
  • the 'dry matter' refers to a material containing a small amount of water.
  • the result obtained by the method of removing the 'pulverized material' may refer to a result obtained by a method of crushing or cutting solid particles into small particles by applying force to solid particles.
  • the concentrate, filtrate, fraction, dried product, pulverized product, etc. can be obtained by a conventional method for obtaining the corresponding product, and is not particularly limited.
  • the pharmaceutical composition of the present invention may include Banhasasimtang as an active ingredient as described above.
  • the Banhasasimtang may be included in the composition at a concentration of 50 - 800 ug/ml, but is not limited thereto.
  • the Banhasasimtang may be included in the composition at a concentration of 100 - 700 ug/ml, but is not limited thereto.
  • the Banhasasimtang may be included in the composition at a concentration of 200 - 500 ug/ml, but is not limited thereto. More preferably, the Banhasasimtang may be included in the composition at a concentration of about 300 ug/ml.
  • the pharmaceutical composition of the present invention may contain at least one additional active ingredient in addition to Banhasasimtang.
  • the pharmaceutical composition of the present invention may further include a pharmaceutically acceptable carrier, excipient, or diluent commonly used in the preparation of pharmaceutical compositions, and the carrier includes a non-naturally occurring carrier. can do.
  • pharmaceutically acceptable in the present invention means that it exhibits non-toxic properties to cells or humans exposed to the composition.
  • carrier examples include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum acacia, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, Microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil may be used, but is not limited thereto. These may be used alone or in combination of two or more.
  • compositions may be formulated into tablets, pills, powders, granules, capsules, suspensions, internal solutions, emulsions, syrups, sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried agents, and suppositories, respectively, according to conventional methods. It may have any one formulation selected from the group consisting of, and may be various oral or parenteral formulations. When formulated, it is prepared using diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Solid preparations for oral administration may include tablets, pills, powders, granules, capsules, etc., and the solid preparations may contain at least one excipient such as starch, calcium carbonate, sucrose or lactose, Gelatin and the like may be used. In addition to simple excipients, lubricants such as magnesium stearate and talc may be used.
  • Liquid formulations for oral administration may include suspensions, internal solutions, emulsions, syrups, etc., and various excipients such as wetting agents, sweeteners, aromatics, and preservatives in addition to water and liquid paraffin, which are commonly used simple diluents can be used Sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized formulations or suppositories may be used as preparations for parenteral administration. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for the suppository, witepsol, macrogol, tween 61, cacao butter, laurin paper, glycerogelatin, etc. may be used, but is not limited thereto.
  • a pharmaceutical composition for preventing or treating Alzheimer's disease caused by ApoE4 gene mutation comprising Banhasasimtang as an active ingredient, can be provided.
  • Alzheimer's disease in the present invention refers to a degenerative brain disease, which gradually develops and progressively deteriorates cognitive functions including memory.
  • ApolipoE4 As one of the causes of Alzheimer's disease, mutation of the E4 allele of Apolipoprotein (ApoE4) is known.
  • the ApoE gene is a gene encoding the sequence of apolipoprotein E (ApoE), and the ApoE4 genotype is known to be a risk factor for the development of Alzheimer's disease.
  • the incidence of Alzheimer's is about 50% for those who have one APOE4 allele (heterozygous) and about 91% for those who have two (homozygous) alleles.
  • the onset of Alzheimer's is also accelerated in the case of carrying the APOE4 allele.
  • the Alzheimer's in the present invention may be Alzheimer's caused by ApoE4 gene mutation.
  • the term "Alzheimer's caused by ApoE4 gene mutation" in the present invention may refer to Alzheimer's caused by ApoE4 expression in individuals having the ApoE4 genotype, but is not limited thereto.
  • Alzheimer's caused by the ApoE4 gene mutation may be Alzheimer's dementia caused by the ApoE4 gene mutation, but is not limited thereto.
  • the term "Alzheimer's dementia” in the present invention means a dementia disease caused by Alzheimer's disease.
  • the Alzheimer's disease may be, for example, late onset Alzheimer's disease.
  • treatment refers to all activities that improve or beneficially change symptoms of Alzheimer's caused by ApoE4 gene mutation by administration of the composition.
  • prevention in the present invention refers to all activities that inhibit or delay the occurrence, progression, and recurrence of Alzheimer's caused by ApoE4 gene mutation by using the composition of the present invention.
  • phagocytosis of amyloid beta is activated in an individual with Alzheimer's disease caused by ApoE4 gene mutation, thereby inhibiting the precipitation of amyloid beta or removing amyloid beta effect has been confirmed.
  • composition of the present invention may inhibit hyperphosphorylation of tau protein in an Alzheimer's disease subject caused by ApoE4 gene mutation.
  • composition of the present invention may improve the cognitive function of an individual with Alzheimer's disease caused by ApoE4 gene mutation by promoting phagocytosis of amyloid beta or inhibiting hyperphosphorylation of tau protein.
  • composition containing Banhasasimtang of the present invention as an active ingredient is highly applicable as a composition for treatment specific to Alzheimer's disease caused by ApoE4 gene mutation.
  • Another aspect of the present invention provides a method for treating Alzheimer's caused by ApoE4 gene mutation.
  • the treatment method may include determining whether an ApoE4-positive individual having Alzheimer's disease is a target for treatment by examining whether or not the individual has an ApoE4 genotype.
  • the treatment method may include administering the pharmaceutical composition containing Banhasasimtang as an active ingredient to a subject.
  • the treatment method of the present invention may include testing whether or not the ApoE4 genotype is possessed.
  • the term "examination of whether or not the ApoE4 genotype is possessed” means an act of examining whether or not the ApoE4 allele is present in an individual.
  • 'ApoE4 genotype possession test' may be interpreted as the same as 'ApoE4 positive test.
  • ApoE4-positive in the present invention refers to a case in which an individual has at least one allele of ApoE4.
  • the test may be performed by an isoelectric focusing method, an immunological method, an immunochemical method, or a sequence analysis method, but is not limited thereto.
  • the test may be performed by polymerase chain reaction (PCR).
  • the treatment method of the present invention may also include determining an individual who is ApoE4-positive and has Alzheimer's disease as a subject for treatment. That is, an individual who has an ApoE4-positive result in the above-described test step and has Alzheimer's disease can be determined as a treatment target.
  • the treatment target may be a carrier of Alzheimer's disease caused by ApoE4 gene mutation.
  • the treatment target may be a carrier of Alzheimer's disease caused by the expression of the ApoE4 gene.
  • the term "individual" in the present invention means all animals such as rats, mice, livestock, including humans.
  • the animal may be not only humans but also mammals such as cattle, horses, sheep, pigs, goats, camels, antelopes, dogs, and cats, but is not limited thereto.
  • the treatment subject may be an individual having an ApoE4 genotype heterozygous and suffering from Alzheimer's disease.
  • the subject to be treated may be an individual who is homozygous for the ApoE4 genotype and suffers from Alzheimer's disease.
  • the treatment target may be an Alzheimer's patient induced by expression of the ApoE4 gene.
  • the treatment target may be an individual suffering from Alzheimer's dementia caused by ApoE4 gene mutation.
  • the treatment method of the present invention may include administering to the subject a pharmaceutical composition containing Banhasasimtang as an active ingredient.
  • the pharmaceutical composition can be understood as the same as the 'pharmaceutical composition for preventing or treating Alzheimer's caused by ApoE4 gene mutation containing Banhasasimtang as an active ingredient' as described above.
  • composition of the present invention can be administered orally or parenterally depending on the desired method, and in the case of parenteral administration, external skin or intraperitoneal injection, rectal injection, subcutaneous injection, intravenous injection, intramuscular injection or intrathoracic injection injection method can choose
  • administration means providing a predetermined substance to a patient by any suitable method, and the administration route of the composition of the present invention is administration through any general route as long as it can reach the target tissue. It can be.
  • the dosage of the composition may vary depending on the patient's weight, age, sex, health condition, diet, administration time, administration method, excretion rate, and severity of the disease.
  • composition of the present invention can be used alone or in combination with methods using surgery, hormone therapy, drug therapy, and biological response modifiers for the prevention and treatment of cognitive disorders.
  • the composition according to the present invention may be administered in combination with one or more additional drugs commonly used for Alzheimer's disease.
  • a health functional food composition for preventing or improving Alzheimer's disease containing Banhasasimtang as an active ingredient is provided.
  • a health functional food composition for preventing or improving Alzheimer's caused by ApoE4 gene mutation, containing Banhasasimtang as an active ingredient, is provided.
  • Banhasasimtang As described above, the terms “Banhasasimtang”, “Alzheimer's disease” and “caused by ApoE4 gene mutation” may be defined the same as described above.
  • the weight ratio or concentration of Banhasasimtang in the health functional food composition can be understood as the same as defined in the pharmaceutical composition.
  • prevention in the present invention may be defined as the same as described in the pharmaceutical composition, and “improvement” means that the symptoms of the subject suspected of or having the disease are improved or advantageously by using the composition of the present invention. It means any action that changes.
  • the functional food is the same term as food for special health use (FoSHU), and is a food manufactured and/or processed using raw materials or ingredients having useful functions for the human body.
  • Food in addition to nutritional supply, it means food with high medical and medical effects processed so that bioregulatory functions appear efficiently.
  • function (sex) means to obtain useful effects for health purposes such as regulating nutrients for the structure and function of the human body or physiological functions.
  • food containing useful ingredients for the human body and recognized for its function and safety by the Ministry of Food and Drug Safety is called health functional food. It is classified as (supplementary) food.
  • the food of the present invention can be prepared by a method commonly used in the art, and can be prepared by adding raw materials and ingredients commonly added in the art during the preparation.
  • the formulation of the food may also be prepared without limitation as long as the formulation is recognized as a food.
  • the health food composition of the present invention may include, without limitation, food-acceptable additives, additives, and other ingredients in addition to Banhasasim-tang.
  • the food composition of the present invention may contain herbal extracts, food auxiliary additives, or natural carbohydrates as additional ingredients in addition to Banhasasimtang, which is an essential ingredient.
  • the health functional food composition may further include a food-acceptable carrier, which may be appropriately selected and used by those skilled in the art.
  • a food-acceptable carrier for example, various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH regulators , stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages, etc. are included, but the types are not limited by the above examples.
  • the health functional food composition may include additional components that are commonly used in food compositions to improve odor, taste, and visual properties.
  • vitamins A, C, D, E, B1, B2, B6, B12, niacin, biotin, folate, panthotenic acid, and the like may be included.
  • minerals such as zinc (Zn), iron (Fe), calcium (Ca), chromium (Cr), magnesium (Mg), manganese (Mn), and copper (Cu) may be included.
  • amino acids such as lysine, tryptophan, cysteine, and valine may be included.
  • preservatives can be added.
  • disinfectants bleaching powder, high bleaching powder, sodium hypochlorite, etc.
  • antioxidants butylhydroxyanisole (BHA), butylhydroxytoluene ( BHT), etc.
  • coloring agents tar color, etc.
  • coloring agents sodium nitrite, sodium nitrite, etc.
  • bleaching agents sodium sulfite, etc.
  • seasonings MSG sodium glutamate, etc.
  • sweeteners dulcin, cyclemate, saccharin, sodium, etc.
  • Food additives such as flavoring agents (vanillin, lactones, etc.), expanding agents (alum, D-potassium hydrogen tartrate, etc.), strengthening agents, emulsifiers, thickeners (thickeners), coating agents, gum base agents, foam inhibitors, solvents, improvers, etc. ) can be added.
  • a quasi-drug composition for preventing or improving Alzheimer's comprising Banhasasimtang as an active ingredient.
  • a quasi-drug composition for preventing or alleviating Alzheimer's caused by ApoE4 gene mutation containing Banhasasimtang as an active ingredient, is provided.
  • Banhasasimtang As described above, the terms “Banhasasimtang”, “Alzheimer's disease”, “caused by ApoE4 gene mutation”, “prevention” and “improvement” may be defined the same as described above.
  • the weight ratio or concentration of Banhasasimtang in the quasi-drug composition can be understood as the same as defined in the pharmaceutical composition.
  • quasi-drugs in the present invention refers to articles with milder effects than pharmaceuticals among articles used for the purpose of diagnosing, treating, improving, mitigating, treating, or preventing human or animal diseases.
  • quasi-drugs under the Pharmaceutical Affairs Act exclude items used for pharmaceutical purposes, and include products used for the treatment or prevention of human/animal diseases, products with minor or no direct action on the human body, and the like.
  • the quasi-drug composition can be used by adding the composition containing Banhasasim-tang as an active ingredient according to the present invention or together with other quasi-drugs or quasi-drug ingredients, and can be appropriately used according to conventional methods.
  • the mixing amount of the active ingredient may be appropriately determined according to the purpose of use (prevention, health or therapeutic treatment).
  • the quasi-drug composition includes, but is not particularly limited to, personal hygiene products, disinfectant cleansers or ointments.
  • the personal hygiene products are not particularly limited thereto, but may specifically include storage agents for prosthetics such as toothpaste, gargles, cleaning gels, or dentures.
  • the quasi-drug composition is not particularly limited thereto, but may be specifically prepared and used in the form of an ointment, lotion, spray, patch, cream, powder, suspension, gel or gel.
  • a composition comprising banha, jujube, licorice, ginseng, health, golden and barberry mixed extract for the prevention or treatment of Alzheimer's as an active ingredient.
  • the Alzheimer's may be caused by ApoE4 gene mutation.
  • the Alzheimer's disease may be late onset Alzheimer's disease.
  • the terms "Banhasasimtang”, “Alzheimer's disease”, “caused by ApoE4 gene mutation”, “prevention” and “treatment” may be defined the same as described above.
  • Banha, jujube, licorice, ginseng, health, gold and barberry extract for the prevention or treatment of Alzheimer's provide a use of a health functional food composition containing a mixed extract as an active ingredient.
  • the Alzheimer's may be caused by ApoE4 gene mutation.
  • the Alzheimer's disease may be late onset Alzheimer's disease.
  • a quasi-drug composition comprising a mixed extract of banha, jujube, licorice, ginseng, health, golden and barberry for the prevention or treatment of Alzheimer's as an active ingredient.
  • the Alzheimer's may be caused by ApoE4 gene mutation.
  • the Alzheimer's disease may be late onset Alzheimer's disease.
  • composition and treatment method comprising Banhasasim-tang of the present invention as an active ingredient show excellent reduction and precipitation inhibitory effects of amyloid beta protein specifically for Alzheimer's disease caused by genetic mutation of ApoE4. It is highly applicable as a therapeutic composition specific to Alzheimer's disease.
  • the above effects are clearly identified by confirming the ApoE4-specific amyloid beta-reducing effect of the composition of the present invention using ApoE4 human brain astrocytes and brain organoids in the following examples.
  • composition and treatment method of the present invention will provide more effective and customized treatment for Alzheimer's patients due to the ApoE4 genotype.
  • FIG. 1 is a diagram showing an ApoE4 Alzheimer's dementia human induced pluripotent stem cell model constructed through CRISPR/Cas9 genome editing.
  • Figure 2a shows the differentiation process of astrocytes
  • Figure 2b shows the result of differentiating human induced pluripotent stem cells into astrocytes via neural progenitor cells and verifying the successful differentiation of astrocytes by fluorescence staining.
  • Figure 3 shows a protocol for exploring the recovery of amyloid beta phagocytosis in Alzheimer's dementia astrocytes by oriental medicine-based treatment materials.
  • Figure 4 shows the results of measuring A ⁇ 42 phagocytosis in ApoE3 and ApoE4 astrocytes (Fig. 4a), the recovery effect of Banha Sasim-tang treatment in ApoE4 astrocytes with reduced degradation function (Fig. 4c), and the results in the ApoE3 control group (Fig. 4b). indicates
  • FIG. 5 is a diagram showing a process of producing a human induced pluripotent stem cell (APPswe) model for dementia through CRISPR/Cas9 gene editing technique.
  • APPswe human induced pluripotent stem cell
  • FIG. 6 is a diagram showing the timeline of an experiment measuring the amyloid beta phagocytosis effect of Banha Sasim-tang in APPswe astrocytes (FIG. 6a) and the results of measuring the amyloid beta phagocytosis effect of Banha Sasim-tang in APPswe astrocytes ( Fig. 6b).
  • Figure 8 shows the effect of increasing amyloid beta precipitation in ApoE4 brain organoids and reducing it by Banha Sasim-tang. Specifically, the results of western blotting for the confirmation of amyloid beta are shown in FIG. 8a, and the results are graphically quantified and shown in FIG. 8b.
  • Roots and rhizomes of Glycyrrhiza uralensis Fischer, Glycyrrhiza glabra Linne or Glycyrrhiza inflata Batal. (Leguminosae) intact or with pericarp removed) 1. 00 g, healthy (ginger ( Zingiber officinale Roscoe ) (dried rhizome of ginger family Zingiberaceae) 0. 83 g, jujube ( Zizyphus jujuba Miller var. inermis Rehder) or Boeun jujuba (Zizyphus jujuba Miller var.
  • Ripe fruit of Rhamnaceae 1.00 g
  • Panha tubular of Pine/lia ternata Breednbach (Araceae) with pericarp completely removed
  • ginseng Panax ginseng CAMeyer (Araliaceae) root
  • intact or with thin roots and cork layer removed 1 .00 g.
  • Example 1 Culture of human induced pluripotent stem cells
  • a human induced pluripotent stem cell model for Alzheimer's disease having ApoE4 mutation was constructed using CRISPR/Cas9 genome editing technique (FIG. 1), and the human induced pluripotent stem cell model for Alzheimer's dementia was produced.
  • FOG. 1 CRISPR/Cas9 genome editing technique
  • ApoE3 / ApoE4 homozygous induced pluripotent stem cells were cultured in a matrigel-coated 6 well plate in TeSR1 media.
  • an ApoE4 Alzheimer's dementia human induced pluripotent stem cell model was constructed through CRISPR/Cas9 genome editing.
  • neuronal induction media [DMEM/F-12 GlutaMAX (Gibco), Neurobasal (Gibco), 0.5 x N-2 (Gibco), 0.5x B27 (Gibco), 0.5x GlutaMAX (ThermoFisher Scientific), 5 ⁇ g/ml insulin (Sigma-Aldrich), 0.5x NEAA (Thermo Fisher Scientific), 100 ⁇ M 2-mercaptoethanol (Sigma- Aldrich), 1xPenicillin/Streptomycin (Gibco)] together with SMAD signal inhibitors 1 ⁇ M Dorsomorphin (Tocris) and 10 ⁇ M SB431542 (Tocris) for 11 days.
  • the culture medium was treated with 20 ng/ml FGF2 (Peprotech) until a rosette structure appeared.
  • the produced neural progenitor cells are plated at a density of 1.5 x 10 5 cells, then cultured in Astrocyte Media (Sciencell) and the culture medium is replaced once every two days. After one month of culture, the cells are removed with TrypLE (Gibco) and astrocytes After staining with the marker GLAST-PE antibody (MiltenylBiotec), only GLAST-positive cells were separately collected and cultured through a flow cytometer (Sony SH800) (FIG. 2a). To verify the differentiation of astrocytes, fluorescence staining was performed using antibodies that stain GFAP and AQP4, which are other markers of astrocytes (FIG. 2b).
  • the synthesized amyloid beta (A ⁇ 42 ) was treated with ApoE4 astrocytes and control ApoE3 astrocytes with Banhasasim-tang, and then cultured for two days, and the amount of amyloid beta remaining in the culture medium was measured by ELISA technique (FIG. 3). .
  • APP is an amyloid precursor protein gene, and is known as a representative causative gene of familial Alzheimer's disease.
  • the present applicants inserted the Alzheimer's dementia-inducing mutation APPswe (KM670/671NL double mutation of the APP gene) into human induced pluripotent stem cells of a normal person by CRISPR/Cas9 gene editing technique, A model (APPswe)' was produced (FIG. 5).
  • APPswe Alzheimer's dementia-inducing mutation
  • the differentiation process of astrocytes was performed in the same manner as in Example 2.
  • the synthesized amyloid beta (A ⁇ 42 ) was treated with APPswe astrocytes together with Banhasasim-tang, and then cultured for two days, and the amount of amyloid beta remaining in the culture medium was measured by ELISA technique.
  • the approximate timeline of this experiment is shown in FIG. 6a and the results are shown in FIG. 6b.
  • Banha Sasim-tang has a specific amyloid beta-reducing effect on ApoE4-bearing cells.
  • Example 5 Confirmation of alleviation of pathological symptoms associated with Alzheimer's disease by Banhasasimtang treatment in brain organoids
  • Banhasasimtang was treated with ApoE4 brain organoids cultured for 4 months at a concentration of 300 ug/ml for 7 days, and the changes in amyloid beta accumulation were confirmed (FIG. 7).
  • the present invention has excellent effects on amyloid beta inhibition and phagocytosis in Alzheimer's disease induced by ApoE4, and that the present invention is a specific therapeutic agent for Alzheimer's caused by ApoE4 or late Alzheimer's disease (Late This suggests that it can be usefully used as a specific treatment for onset Alzheimer's disease.

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Botany (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medical Informatics (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Nutrition Science (AREA)
  • Hospice & Palliative Care (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Psychiatry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicines Containing Plant Substances (AREA)

Abstract

본 발명은 반하사심탕을 유효성분으로 포함하는 조성물의, ApoE4 유전자변이를 원인으로 한 알츠하이머에 대한 치료, 개선 또는 예방 용도에 관한 것이다. 본 발명의 반하사심탕을 유효성분으로 포함하는 조성물 및 치료방법은 ApoE4의 유전자 변이를 원인으로 한 알츠하이머에 특이적으로 아밀로이드 베타 단백질의 우수한 감소 효과 및 침전 저해 효과를 나타내어, ApoE4 유전자 변이를 원인으로 한 알츠하이머에 특이적인 예방, 개선 또는 치료용 조성물로서의 활용도가 높다.

Description

반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 치료용 조성물
본 발명은 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 예방 또는 치료용 약학적 조성물; 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 예방 또는 개선용 건강기능식품 조성물; 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 예방 또는 개선용 의약외품 조성물; 또는 상기 약학적 조성물을 개체에 투여하는 단계를 포함하는, 알츠하이머의 치료 방법에 관한 것이다.
알츠하이머(alzheimer's disease)란 기억력을 포함한 인지기능의 악화가 점진적으로 진행되는 병으로, 가장 흔한 퇴행성 뇌질환에 해당한다. 알츠하이머의 주된 증상으로는 기억력 감퇴, 언어능력 저하, 시공간파악능력의 저하, 판단력 및 일상생활 수행능력의 저하, 성격변화, 초조행동, 우울증, 망상 등의 이른바 정신행동증상, 및 대소변 실금, 거동 장애 등의 신체 증상이 나타난다.
이러한 알츠하이머는 기대 수명 증가에 따른 노인 인구 증가로 인해 전세계적으로 발병률이 지속적으로 증가하고 있다. 전문가들은 2050년에 알츠하이머 병을 앓는 환자가 미국 기준으로 1380만 명에 이를 것이며, 한국 기준으로 237만명에 이를 것으로 예상하고 있어 점점 심각성이 높아지고 있다. 그에 따라, 전세계적으로 알츠하이머병의 치료 및 개선을 위한 연구가 활발하게 진행되고 있다.
한편, 알츠하이머병은 타우 단백질의 과인산화, 염증반응, 베타 아밀로이드의 과도 생성에 따른 뇌에서의 침착 및 산화적 손상 등의 다양한 기전에 의해 발병하는 것이 알려져 있다. 이러한 기전들의 발생의 모든 원인에 대해서는 아직까지 정확히 규명된 바는 없으나, 그 중 유전적인 원인이 전체 알츠하이머병 발병의 약 40-50%를 설명하는 것으로 보고된다.
대표적으로, 아밀로이드 전구 단백질 유전자, 프리세닐린 유전자 변이는 65세 미만에서 증상이 시작되는 조발성 알츠하이머병(Early onset Alzheimer's disease)의 위험을 높이는 유전 요인이며, 아포리포단백질 E 유전자의 ApoE4 대립 유전자는 주로 65세 이후에 증상이 시작되는 만발성 알츠하이머병(Late onset Alzheimer's disease) 의 위험을 높이는 유전요인임으로 알려져 있다.
이렇듯 알츠하이머는 다양한 원인에 의해 발병된다. 알츠하이머병을 유발하는 이러한 구체적 원인에 따른 특이적인 치료제에 대한 연구가 일부 있어왔다. 일 예로, 한국공개특허 제10-2010-0126326 A호에는 프리세닐린1 및 BACE의 과다발현에 의해 유발된 알츠하이머의 치료를 위한 슈퍼옥시드 디스뮤타아제와 S-아데노실메티오닌을 포함하는 조성물을 개시하고 있다. 이와 같이 일부 연구들이 존재하지만, 아직까지는 알츠하이머의 구체적 유발 원인에 따른 특이적인 치료제에 대한 연구가 활발하지는 않은 실정이다.
ApoE 유전자란 아포리포단백질 E(apolipoprotein E, ApoE)의 서열을 암호화하는 유전자를 의미한다. 상기 ApoE 유전자는 HDL(High Density Lipoprotein), LDL(Low Density Lipoprotein), VLDL(Very Low Density Lipoprotein) 같은 혈장의 정상 구성성분인 리포단백질의 구성단백질을 암호화하며, 19번 염색체에 위치하여 지방 운반 물질로서 중추 및 말초 신경계의 손상 후 지방대사를 조절하는 핵심적 역할을 하는 것으로 알려져 있다. 상기 ApoE 유전자는 3가지의 대립 유전형인 E2, E3 및 E4가 존재한다. 상기 대립 유전형 중에서 E2 및 E4 알츠하이머성 치매와 연관된다고 알려져 있는데, 아포리포단백질의 E4 대립형질 (ApoE4)은 알츠하이머성 치매 발병의 위험인자로, 아포리포단백질의 E2 대립형질 (ApoE2)은 알츠하이머성 치매 발병의 보호인자로 알려져 있다. 전체 알츠하이머성 치매 환자의 약 10 - 15%가 상기 ApoE4 유전변이가 원인이 되어 발병하는 것으로 알려져 있다.
이처럼 ApoE4 유전형은 알츠하이머의 주요한 원인 중 하나이며, 본 발명자들은 구체적으로 ApoE4 유전변이를 원인으로 한 알츠하이머에 대해 특이적으로 활성을 갖는 조성물을 개발하고자 예의 연구 노력하였다. 그 결과, 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물(이하, 반하사심탕)의 ApoE4 유발 알츠하이머에 특이적인 아밀로이드 베타 감소 효과를 규명하여, 반하사심탕의 ApoE4 유전변이를 원인으로 한 알츠하이머 치료의 용도를 개발하고, 본 발명을 완성하였다.
본 특허 출원의 이전에는, 반하사심탕의 용도에 대해, ApoE4 유전자변이에 의해 유발된 알츠하이머 질병의 개선에 특이적으로 적용될 수 있다는 사실을 나타내는 문헌 및 기술이 전혀 존재하지 않았다.
본 발명의 하나의 목적은 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, ApoE4 유전자 변이를 원인으로 한 알츠하이머 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 알츠하이머 예방 또는 개선용 건강기능식품 조성물을 제공하는 것이다.
본 발명의 다른 목적은 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 알츠하이머 예방 또는 개선용 의약외품 조성물을 제공하는 것이다.
본 발명의 또 다른 목적은 상기 조성물을 인간을 제외한 개체에 투여하는 단계를 포함하는, 알츠하이머의 치료 방법을 제공하는 것이다.
본 발명에서 개시되는 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술되는 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 할 수 없다.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 발명에 기재된 본 발명의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 발명에 포함되는 것으로 의도된다.
아울러, 본 발명의 명세서 전체에 있어서, 어떤 부분이 어떤 구성 요소를 "포함"한다고 할 때, 이는 특별히 반대되는 기재가 없는 한 다른 구성 요소를 제외하는 것이 아니라 다른 구성요소를 더 포함할 수 있는 것을 의미한다.
이하, 본 발명을 보다 자세히 설명한다.
본 발명은 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 조성물의 알츠하이머 예방, 개선 또는 치료 용도에 관한 것이다.
상기의 목적을 달성하기 위한 본 발명의 일 양태로 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 약학적 조성물을 제공한다.
본 발명에서의 용어 "반하사심탕(半夏瀉心湯)"은 반하, 대추, 감초, 인삼, 건강, 황금 및 황련의 혼합 추출물을 의미하며 본 명세서에서 혼용되어 사용할 수 있다. 상기 반하사심탕은 당 업계에서 통상적으로 사용되는 방법에 의해 제조 가능하다. 반하사심탕은 한방에서 일반적으로 위염, 위확장증, 위십이지장 궤양, 위장염 등의 증상에 사용되는 것으로 알려져 있다.
일 구현예에서, 상기 반하사심탕은 반하, 대추, 건강, 황금, 인삼, 감초, 및 황련을 혼합한 추출물 또는 상기 각 성분 추출물의 혼합물일 수 있으나, 이에 제한되는 것은 아니다.
일 구체예에서, 상기 반하사심탕에 포함된 반하:대추:감초:인삼;건강:황금:황련의 비율은 약 1.2 - 2.0 : 0.8 - 1.2 : 0.8 - 1.2 : 0.8 - 1.2 : 0.6 - 1.0 : 0.8 - 1.2 : 0.2 - 0.5 일 수 있으나, 이에 제한되는 것은 아니다.
다른 일 구체예에서, 상기 반하사심탕은 반하 약 1.2 - 2.0g, 대추 약 0.8 - 1.2g, 감초 약 0.8 - 1.2g, 인삼 약 0.8 - 1.2g, 건강 약 0.6 - 1.0g, 황금 약 0.8 - 1.2g, 및 황련 약 0.2 - 0.5g을 혼합한 추출물일 수 있으나, 이에 제한되는 것은 아니다.
바람직한 일 구체예에서, 상기 반하사심탕은 반하 약 1.67g, 대추 약 1g, 감초 약 1g, 인삼 약 1g, 건강 약 0.83g, 황금 약 1g, 및 황련 약 0.33g을 혼합한 추출물 또는 이와 유사한 비율로 질량만을 달리한 혼합액의 추출물일 수 있으나, 이에 제한되는 것은 아니다.
이하에서는 상기 반하사심탕의 성분들에 대해 더욱 자세히 설명한다.
본 발명에서의 용어 "반하(半夏)"는 일반적으로 천남성과의 반하(Pinellia ternata Breitenbach)의 코르크층을 제거한 덩이줄기를 지칭한다. 지문(地文), 양안반하(羊眼半夏) 등의 이름으로도 알려져 있다. 냄새가 거의 없고 약간 점액성이며, 맛이 매우며 성질은 따뜻하다. 한방에서 반하는 가래, 해수, 천식에 쓰이며 담으로 인한 두통, 어지럼증, 가슴답답증, 그득한 증상, 구토, 인후통, 등 부위에 난 종기, 유방염, 임신구토 등의 증상에 사용될 수 있다. 약리작용으로 거담, 진해, 구토진정, 규폐증 예방, 항암작용 등을 하는 것으로 보고된다.
본 발명에서의 용어 "대추(大棗)"는 대추나무의 열매를 의미하며, 그 학명은 Ziziphus 　 jujuba 　var.　 inermis이다. 조(棗) 또는 목밀(木蜜)이라고도 알려져 있다. 적갈색의 표면을 가지고 있으며, 타원형이고 길이 1.5∼2.5cm에 달하며 익으면 단맛이 난다. 한방에서 대추는 이뇨, 강장, 완화제로 사용된다고 보고된다.
본 발명에서의 용어 "감초(甘草)"는 콩과에 속하는 다년생 초본식물이며, 학명은 Glycyrrhiza　uralensis　FISCH.이다. 상기 감초는 국로, 미초, 밀감, 밀초, 영통, 첨초, 로초 등으로도 명명된다. 감초의 겉껍질은 적갈색 또는 암갈색을 띠며 세로로 주름이 있다. 한방에서 감초는 약의 독성을 조화시켜서 약효가 잘 나타나게 하며 장부의 한열과 사기를 다스리고 모든 혈맥의 소통을 잘 시키며 근육과 뼈를 튼튼히 하는 성분으로 이용된다고 보고된다.
본 발명에서의 용어 "인삼(人蔘)"은 인삼 Panax ginseng C. A. Meyer (두릅나무과 Araliaceae) 의 뿌리를 의미한다. 상기 인삼은 귀개, 금정옥란, 신초, 옥정, 인미, 인함, 지정, 토정, 해아삼, 혈삼, 혈삼, 황삼, 야산삼, 별직삼 등의 명칭으로도 불리운다. 인삼은 특이한 냄새가 있으며 맛은 달고 약간 쓰며 성질은 따듯하다. 한방에서 인삼은 원기를 보하고 신체허약, 권태, 피로, 식욕부진, 구토, 설사에 쓰이며 신기능을 높여주는 효능도 보고되어 있다.
본 발명에서의 용어 "건강(乾薑)"은 생강(Zingiber 　 officinale　Roscoe)의 뿌리줄기를 말린 것을 의미한다. 건강은 백강(白薑), 균강(均薑)이라고도 하며, 특이한 냄새가 있고 약성은 맵고 뜨겁다. 건강은 항염, 진통작용, 억균작용 등의 약리효과가 있다.
본 발명에서의 용어 "황금"은 꿀풀과(Lamiaceae) 골무꽃속(genus　Scutellaria)에 속하는 황금(Scutellaria　baicalensis)의 뿌리로 그대로 또는 주피를 제거한 것을 의미한다. 황금은 냄새가 거의 없고 맛은 약간 쓰다. 황금은 항암, 간 보호, 항산화 등의 약리효과가 있는 것으로 보고된다.
본 발명에서의 용어 "황련"은 쌍떡잎식물 미나리아재비목 미나리아재비과의 상록 여러해살이풀을 의미한다. 황련의 학명은 Coptis 　 chinensis으로, 맛은 쓰고 성질은 차다. 황련의 주요 성분인 베르베린은 약리학적으로 장내 세균에 대한 항균 작용, 진정 및 진경 작용, 항동맥경화 작용, 소염 작용, 이담 작용, 췌장액 분비 촉진 작용을 나타냄이 보고된다.
본 발명에서의 용어 "추출물" 또는 "혼합 추출물"은 상기 반하, 대추, 감초, 인삼, 건강, 황금 및 황련을 추출 처리하여 얻어지는 추출액, 상기 추출액의 희석액이나 농축액, 상기 추출액을 건조하여 얻어지는 건조물, 상기 추출액의 조정제물이나 정제물, 또는 이들의 혼합물 등, 추출액 자체 및 추출액을 이용하여 형성 가능한 모든 제형의 추출물을 포함한다. 구체적으로, 본 발명의 상기 추출물은 추출 후 건조 분말 형태로 제조되어 사용될 수 있다. 상기 본 발명에서 상기 반하, 대추, 감초, 인삼, 건강, 황금 또는 황련은 상업적으로 판매되는 것을 구입하거나, 자연계에서 재배 또는 채취한 것을 제한 없이 사용할 수 있다.
본 발명의 일 구체예로, 상기 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물은 각 식물을 추출하여 혼합하거나 또는 상기 반하, 대추, 감초, 인삼, 건강, 황금 및 황련을 모두 혼합 후 추출하는 방법을 사용할 수 있으며, 혼합 과정은 추출 전, 후 이루어질 수 있으며, 바람직하게는 각각의 식물을 추출 후 혼합하는 단계를 거칠 수 있으나 이에 제한되는 것은 아니다.
본 발명에서 상기 추출물을 추출하는데 사용되는 추출 용매의 종류는 특별히 제한되지 아니하며, 당해 기술 분야에서 공지된 임의의 용매를 사용할 수 있다. 상기 추출 용매의 비제한적인 예로는 물; 메탄올, 에탄올, 프로필알코올, 부틸알코올 등의 탄소수 1 내지 4의 저급 알코올; 글리세린, 부틸렌글리콜, 프로필렌글리콜 등의 다가 알코올; 및 메틸아세테이트, 에틸아세테이트, 아세톤, 벤젠, 헥산, 디에틸에테르, 디클로로메탄 등의 탄화수소계 용매; 또는 이들의 혼합물을 사용할 수 있다. 바람직하게는 상기 추출물은 물 또는 탄소수 1 내지 4의 저급알코올 추출물일 수 있으나, 이에 제한되지 않는다.
본 발명에서 상기 추출물을 추출하는 방법은 특별히 제한되지 아니하며, 당해 기술 분야에서 통상적으로 사용하는 방법에 따라 추출할 수 있다. 상기 추출 방법의 비제한적인 예로는, 열수 추출법, 초음파 추출법, 여과법, 환류 추출법 등을 들 수 있으며, 이들은 단독으로 수행되거나 2종 이상의 방법을 병용하여 수행될 수 있다.
본 발명의 일 구체예로, 상기 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물은 추출 이후 농축, 여과, 분획, 건조, 분쇄 등 식물의 추출물에 적용될 수 있는 통상의 추가적 공정에 의해 제조된, 농축물, 여과물, 분획물, 건조물, 분쇄물 등을 포함할 수 있다. 이때, 상기 '농축물'은 화학 물질에서 용매 등을 제거하여 주요 고체 성분의 농도를 높인 물질을 의미할 수 있으며, 상기 '여과물'은 액체와 고체가 혼합된 물질을 입자의 크기 차이를 이용해 분리하는 방법에 의해 얻어진 물질, 상기 '분획물'은 다양한 구성성분을 포함하는 혼합물로부터 특정성분 또는 특정 그룹을 분리하는 분획방법에 의하여 얻어진 결과물, 상기 '건조물'은 소량의 물을 함유하는 물질에서 물을 제거하는 방법에 의해 얻어진 결과물, 상기 '분쇄물'은 고체입자에 힘을 가해 잘게 부수거나 잘라내어 작은 입자로 만드는 방법에 의해 얻어진 결과물을 의미할 수 있다. 이때, 상기 농축물, 여과물, 분획물, 건조물, 분쇄물 등은 해당 결과물을 얻을 수 있는 통상의 방법에 의해 수득할 수 있으며, 특별히 제한되지 않는다.
본 발명의 약학적 조성물은 상기에서 설명한 바와 같은 반하사심탕을 유효성분으로 포함할 수 있다.
또한, 이 때 상기 반하사심탕은 상기 조성물에 50 - 800 ug/ml의 농도로 포함될 수 있으나, 이에 제한되는 것은 아니다. 일 예에서, 상기 반하사심탕은 상기 조성물에 100 - 700 ug/ml의 농도로 포함될 수 있으나, 이에 제한되는 것은 아니다. 바람직하게는, 상기 반하사심탕은 200 - 500 ug/ml의 농도로 조성물에 포함될 수 있으나, 이에 제한되는 것은 아니다. 더욱 바람직하게는, 상기 반하사심탕은 약 300 ug/ml의 농도로 조성물에 포함되는 것일 수 있다.
본 발명의 약학적 조성물은 반하사심탕 외에 추가적인 유효성분을 1종 이상 포함할 수 있다. 본 발명의 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 약학적으로 허용가능한 담체, 부형제 또는 희석제를 추가로 포함할 수 있고, 상기 담체는 비자연적 담체(non-naturally occuring carrier)를 포함할 수 있다.
본 발명에서의 용어 "약학적으로 허용가능한"은 상기 조성물에 노출되는 세포나 인간에게 독성이 없는 특성을 나타내는 것을 의미한다.
상기 담체, 부형제 및 희석제의 구체적인 예로는 락토즈, 덱스트로즈, 수크로스, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있으나, 이에 제한되지 않는다. 이들은 단독으로 사용되거나 2종 이상을 혼합하여 사용될 수 있다.
또한, 상기 약학적 조성물은 각각 통상의 방법에 따라 정제, 환제, 산제, 과립제, 캡슐제, 현탁제, 내용액제, 유제, 시럽제, 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결 건조제 및 좌제으로 이루어진 군으로부터 선택되는 어느 하나의 제형을 가질 수 있으며, 경구 또는 비경구의 여러 가지 제형일 수 있다. 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 사용될 수 있으며, 상기 고형제제는 적어도 하나 이상의 부형제 예를 들면, 전분, 탄산칼슘, 수크로오스(sucrose) 또는 락토오스(lactose), 젤라틴 등이 사용될 수 있다. 또한, 단순한 부형제 이외에 스테아린산 마그네슘, 탈크 등과 같은 윤활제 등이 사용될 수 있다. 경구투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 사용될 수 있으며, 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 사용될 수 있다. 비경구투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제 또는 좌제 등이 사용될 수 있다. 비수성용제, 현탁용제로는 프로필렌글리콜(propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테로 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(tween) 61, 카카오지, 라우린지, 글리세로젤라틴 등이 사용될 수 있으나, 이에 제한되지 않는다.
본 발명의 다른 양태로, 상기 반하사심탕을 유효성분으로 포함하는 ApoE4 유전자 변이를 원인으로 한 알츠하이머 예방 또는 치료용 약학적 조성물을 제공할 수 있다.
본 발명에서의 용어 "알츠하이머(alzheimer's　disease)"란 퇴행성 뇌질환으로, 서서히 발병하여 기억력을 포함한 인지기능의 악화가 점진적으로 진행되는 질환을 의미한다.
알츠하이머를 유발하는 원인 중 하나로, 아포리포단백질의 E4 대립형질(ApoE4) 유전자변이가 알려져 있다. ApoE 유전자란 아포리포단백질 E(apolipoprotein E, ApoE)의 서열을 암호화하는 유전자이며, 이 때 상기 ApoE4 유전자형은 알츠하이머성 치매 발병의 위험인자로 알려져 있다. 이전 연구들에 따르면, APOE4 대립유전자를 한 개 보유한(heterozygous) 경우의 알츠하이머 발병율이 약 50%, 두 개 보유한(homozygous) 경우의 알츠하이머 발병율은 약 91%로 보고된다. 더 나아가, APOE4 대립유전자를 보유한 경우 알츠하이머 발병 시기 또한 빨라지는 것으로 알려져 있다.
본 발명에서의 상기 알츠하이머는 ApoE4 유전자 변이를 원인으로 한 알츠하이머일 수 있다. 이 때, 본 발명에서의 용어 "ApoE4 유전자 변이를 원인으로 한 알츠하이머"란 ApoE4 유전자형을 보유한 개체의 ApoE4가 발현되어 발생한 알츠하이머를 의미할 수 있으나, 이에 제한되지 않는다.
상기 ApoE4 유전자 변이를 원인으로 한 알츠하이머는 ApoE4 유전자 변이를 원인으로 한 알츠하이머성 치매일 수 있으며, 이에 제한되지 않는다. 이 때, 본 발명에서의 용어 "알츠하이머성 치매"란 알츠하이머에 의해 유발된 치매 질환을 의미한다.
상기 알츠하이머는 일 예로, 만발성 알츠하이머병(Late onset Alzheimer's disease)일 수 있다.
본 발명에서의 용어 "치료"란 조성물의 투여에 의해 ApoE4 유전자 변이에 의한 알츠하이머의 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
본 발명에서의 용어 "예방"이란 본 발명의 조성물을 이용하여 ApoE4 유전자변이를 원인으로 한 알츠하이머의 발생, 진행 및 재발을 억제시키거나 지연시키는 모든 행위를 의미한다.
구체적으로, 상기 치료의 일 예로, 본 발명에서의 일 실시예에서 ApoE4 유전자 변이를 원인으로 한 알츠하이머 보유 개체에 대해 아밀로이드 베타의 식균작용을 활발히 하여, 아밀로이드 베타의 침전을 억제시키거나 아밀로이드 베타를 제거하는 효과를 확인한 바 있다.
다른 구체예에서, 본 발명의 조성물은 ApoE4 유전자 변이를 원인으로 한 알츠하이머 보유 개체에서 타우 단백질의 과인산화를 억제시키는 것일 수 있다.
또 다른 구체예에서, 본 발명의 조성물은 ApoE4 유전자 변이를 원인으로 한 알츠하이머 보유 개체에서 아밀로이드 베타의 식균작용의 촉진 혹은 타우 단백질의 과인산화 억제를 통해 상기 개체의 인지 기능을 향상시키는 것일 수 있다.
이와 같이 본 발명의 반하사심탕을 유효성분으로 포함하는 조성물은 ApoE4 유전자 변이를 원인으로 한 알츠하이머에 특이적인 치료용 조성물로서의 활용도가 높음을 확인하였다.
본 발명의 또 다른 양태로 ApoE4 유전자변이를 원인으로 한 알츠하이머의 치료 방법을 제공한다.
상기 치료 방법은 상기 개체에서 ApoE4 유전자형 보유여부를 검사하여 ApoE4-양성이며 알츠하이머병을 갖는 개체를 치료대상으로 결정하는 단계를 포함할 수 있다.
또한, 상기 치료 방법은 반하사심탕을 유효성분으로 포함하는 상기 약학적 조성물을 개체에 투여하는 단계를 포함할 수 있다.
상기 "반하사심탕","치료","ApoE4 유전자변이를 원인으로 한 알츠하이머", "예방", 및 "투여"는 전술한 바와 동일하게 정의될 수 있다.
이하에서 상기 치료 방법의 단계에 대해서 상세히 설명한다.
본 발명의 상기 치료방법은 ApoE4 유전자형 보유 여부를 검사하는 것을 포함할 수 있다. 본 발명에 있어서의 용어 "ApoE4 유전자형 보유 여부의 검사"란, 개체에서 상기 ApoE4 대립 유전자형의 존재 여부를 검사하는 행위를 의미한다. 'ApoE4 유전자형 보유 여부의 검사'은 'ApoE4 양성 여부의 검사'과 동일한 의미로 해석될 수 있다. 본 발명이 제공하고자 하는 조성물은 ApoE4 유전자변이에 의해 유발된 알츠하이머에 특이적 활성을 보이기에, 상기 단계를 통해 ApoE4-양성인 개체를 치료대상으로 선별하고자 하는 것이다.
본 발명에서의 용어 "ApoE4-양성"이란 개체가 적어도 하나 이상의 ApoE4 대립 유전자형을 가지는 경우를 의미한다.
이 때, 상기 ApoE4 대립 유전자형의 존재 여부를 검사하는 방법은 당 기술분야에서 일반적으로 이용되는 방법이 비제한적으로 이용될 수 있다. 상기 검사는 등전점 전기영동 방법, 면역학적 방법, 면역화학적 방법 또는 서열 분석 방법 등에 의할 수 있으나, 이에 제한되는 것은 아니다. 일 예로, 상기 검사는 중합효소 연쇄반응(PCR, polymerase chain reaction)에 의할 수 있다.
본 발명의 상기 치료 방법은 또한 ApoE4-양성이며 알츠하이머병을 갖는 개체를 치료의 대상으로 결정하는 단계를 포함할 수 있다. 즉, 전술한 검사 단계에서의 결과가 ApoE4 양성으로 나온 개체이고, 알츠하이머 병을 보유한 개체를 치료 대상으로 결정할 수 있다. 상기 치료 대상은 ApoE4 유전자 변이를 원인으로 한 알츠하이머 병의 보유자일 수 있다. 상기 치료 대상은 ApoE4 유전자의 발현을 원인으로 한 알츠하이머 병의 보유자일 수 있다.
이 때, 본 발명에서의 용어 "개체"는 인간을 포함한 쥐, 생쥐, 가축 등의 모든 동물을 의미한다. 상기 동물은 인간뿐만 아니라 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물일 수 있으나, 이에 제한되지 않는다.
이 때, 상기 치료 대상은 ApoE4 유전자형이 이형 접합성이며 알츠하이머 병을 앓는 개체일 수 있다. 상기 치료 대상은 ApoE4 유전자형이 동형 접합성이며 알츠하이머 병을 앓는 개체일 수 있다. 또한, 상기 치료 대상은 ApoE4 유전자의 발현에 의해 유도된 알츠하이머 환자일 수 있다.
구체적으로, 상기 치료 대상은 ApoE4 유전자 변이를 원인으로 한 알츠하이머성 치매를 앓는 개체일 수 있다.
본 발명의 상기 치료 방법은 반하사심탕을 유효성분으로 포함하는 약학적 조성물을 상기 대상에 투여하는 것을 포함할 수 있다.
이 때, 상기 약학적 조성물은 전술한 바와 같은 '반하사심탕을 유효성분으로 포함하는 ApoE4 유전자변이를 원인으로 한 알츠하이머 예방 또는 치료용 약학적 조성물'과 동일하게 이해될 수 있다.
본 발명의 조성물은 목적하는 방법에 따라 경구 투여하거나 비경구 투여할 수 있으며, 비경구 투여시 피부 외용 또는 복강 내 주사, 직장 내 주사, 피하주사, 정맥주사, 근육 내 주사 또는 흉부 내 주사 주입방식을 선택할 수 있다. 이 때 본 발명의 용어 "투여"란, 임의의 적절한 방법으로 환자에게 소정의 물질을 제공하는 것을 의미하며, 본 발명의 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여 투여될 수 있다. 복강 내 투여, 정맥 내 투여, 근육 내 투여, 피하 투여, 피내 투여, 경구 투여, 국소 투여, 비내 투여, 폐내 투여, 직장 내 투여될 수 있으나, 이에 제한되지는 않는다.
상기 조성물의 투여량은 환자의 체중, 연령, 성별, 건강상태, 식이, 투여시간, 투여방법, 배설율 및 질환의 중증도 등에 따라 그 범위가 다양할 수 있다.
또한 본 발명의 조성물은 인지 장애의 예방 및 치료를 위하여 단독으로, 또는 수술, 호르몬 치료, 약물 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다. 본 발명의 목적상, 본 발명에 따른 조성물은 알츠하이머성 질환에 통상적으로 사용되는 하나 이상의 추가적인 약물과 병용 투여될 수 있다.
본 명세서에서는 본 발명의 다른 양태로서, 반하사심탕을 유효성분으로 포함하는 알츠하이머 예방 또는 개선용 건강기능식품 조성물을 제공한다.
이 때, 본 발명의 구체적인 일 양태로, 반하사심탕을 유효성분으로 포함하는, ApoE4 유전자 변이를 원인으로 한 알츠하이머 예방 또는 개선용 건강기능식품 조성물을 제공한다.
이와 관련하여, 상기 용어 "반하사심탕","알츠하이머" 및 "ApoE4 유전자 변이를 원인으로 한"은 전술한 바와 동일하게 정의될 수 있다. 또한, 상기 건강기능식품 조성물에서의 반하사심탕의 중량비 또는 농도는 상기 약학적 조성물에서 정의된 바와 동일하게 이해될 수 있다.
본 발명에서의 상기 용어, "예방"이란 상기 약학적 조성물에서 설명한 바와 동일하게 정의될 수 있으며, "개선"이란 본 발명의 조성물을 이용하여 상기 질환이 의심되거나 발병된 개체의 증상이 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
상기 건강기능(성)식품(functional food)이란, 특정보건용 식품(food for special health use, FoSHU)과 동일한 용어로, 인체에 유용한 기능성을 가진 원료나 성분을 사용하여 제조 및/또는 가공한 식품으로서, 영양 공급 외에도 생체조절 기능이 효율적으로 나타나도록 가공된 의학, 의료효과가 높은 식품을 의미한다. 여기서 "기능(성)"이라 함은 인체의 구조 및 기능에 대하여 영양소를 조절하거나 생리학적 작용 등과 같은 보건용도에 유용한 효과를 얻는 것을 의미한다. 이상과 같이 인체에 유용한 성분을 포함하는 식품으로서 식약처가 그 기능과 안정성을 인정한 식품을 건강기능식품이라 하며, 이외 식약처의 허가를 받지는 않았으나, 인체에 유리한 효과를 갖는 식품으로 여겨지는 것을 건강(보조)식품이라 구분한다. 본 발명의 식품은 당 업계에서 통상적으로 사용되는 방법에 의하여 제조 가능하며, 상기 제조시에는 당 업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 식품의 제형 또한 식품으로 인정되는 제형이면 제한 없이 제조될 수 있다.
본 발명의 건강식품 조성물은 반하사심탕 외에 식품학적으로 허용가능한 보조제, 첨가제 및 다른 성분을 제한 없이 포함할 수 있다. 이 때, 본 발명의 식품 조성물은 필수적인 성분인 반하사심탕 외에 생약추출물, 식품 보조 첨가제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다.
또한, 상기 건강기능식품 조성물은 식품학적으로 허용가능한 담체를 추가로 포함할 수 있으며, 이는 당업자가 적절히 선택하여 사용할 수 있다. 예를 들어 여러 가지 영양제, 비타민, 광물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 충진제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산음료에 사용되는 탄산화제 등이 포함되지만, 상기 예들에 의해 그 종류가 제한되는 것은 아니다.
또한, 상기 건강기능식품 조성물은 식품 조성물에 통상 사용되어 냄새, 맛, 시각 등을 향상시킬 수 있는 추가 성분을 포함할 수 있다. 예를 들어, 비타민 A, C, D, E, B1, B2, B6, B12, 니아신(niacin), 비오틴(biotin), 폴레이트(folate), 판토텐산(panthotenic acid) 등을 포함할 수 있다. 또한, 아연(Zn), 철(Fe), 칼슘(Ca), 크롬(Cr), 마그네슘(Mg), 망간(Mn), 구리(Cu) 등의 미네랄을 포함할 수 있다. 또한, 라이신, 트립토판, 시스테인, 발린 등의 아미노산을 포함할 수 있다.
또한, 방부제(소르빈산 칼륨, 벤조산나트륨, 살리실산, 데히드로초산나트륨 등), 살균제(표백분과 고도 표백분, 차아염소산나트륨 등), 산화방지제(부틸히드록시아니졸(BHA), 부틸히드록시톨류엔(BHT) 등), 착색제(타르색소 등), 발색제(아질산 나트륨, 아초산 나트륨 등), 표백제(아황산나트륨), 조미료(MSG 글루타민산나트륨 등), 감미료(둘신, 사이클레메이트, 사카린, 나트륨 등), 향료(바닐린, 락톤류 등), 팽창제(명반, D-주석산수소칼륨 등), 강화제, 유화제, 증점제(호료), 피막제, 검기초제, 거품억제제, 용제, 개량제 등의 식품 첨가물(food additives)을 첨가할 수 있다.
본 발명의 또 다른 양태로, 반하사심탕을 유효성분으로 포함하는, 알츠하이머 예방 또는 개선용 의약외품 조성물을 제공한다.
이 때, 본 발명의 구체적인 일 양태로, 반하사심탕을 유효성분으로 포함하는, ApoE4 유전자 변이를 원인으로 한 알츠하이머 예방 또는 개선용 의약외품 조성물을 제공한다.
이와 관련하여, 상기 용어 "반하사심탕", "알츠하이머", "ApoE4 유전자 변이를 원인으로 한", "예방" 및 "개선"은 전술한 바와 동일하게 정의될 수 있다. 또한, 상기 의약외품 조성물에서의 반하사심탕의 중량비 또는 농도는 상기 약학적 조성물에서 정의된 바와 동일하게 이해될 수 있다.
본 발명에서의 용어 "의약외품"은 사람이나 동물의 질병을 진단, 치료, 개선, 경감, 처치, 또는 예방할 목적으로 사용되는 물품들 중 의약품보다 작용이 경미한 물품들을 의미한다. 예를 들어, 약사법에 따른 의약외품은 의약품의 용도로 사용되는 물품을 제외한 것으로, 사람/동물의 질병 치료나 예방에 쓰이는 제품, 인체에 대한 작용이 경미하거나 직접 작용하지 않는 제품 등이 포함된다.
상기 의약외품 조성물은 본 발명에 따른 반하사심탕을 유효성분으로 포함하는 조성물을 그대로 첨가하거나 다른 의약외품 또는 의약외품 성분과 함께 사용할 수 있고, 통상적인 방법에 따라 적절하게 사용할 수 있다. 유효성분의 혼합량은 사용 목적(예방, 건강 또는 치료적 처치)에 따라 적합하게 결정될 수 있다.
상기 의약외품 조성물은 특별히 이에 제한되지 않으나, 개인위생용품, 소독 청결제 또는 연고제를 포함한다. 상기 개인위생용품에는 특별히 이에 제한되지 않으나, 구체적으로 치약, 가글, 세정 겔 또는 틀니 등의 보철제에 대한 보관제가 포함될 수 있다.
또한, 상기 의약외품 조성물은 특별히 이에 제한되지 않으나, 구체적으로 연고제, 로션제, 스프레이제, 패취제, 크림제, 산제, 현탁제, 겔제 또는 젤의 형태로 제조되어 사용될 수 있다.
본 발명의 다른 양태로, 알츠하이머 예방 또는 치료를 위한 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 조성물의 용도를 제공한다. 상기 알츠하이머는 ApoE4 유전자변이를 원인으로 한 알츠하이머일 수 있다. 또한, 상기 알츠하이머는 만발성 알츠하이머병(Late onset Alzheimer's disease) 일 수 있다. 이와 관련하여, 상기 용어 "반하사심탕", "알츠하이머", "ApoE4 유전자 변이를 원인으로 한", "예방" 및 "치료"은 전술한 바와 동일하게 정의될 수 있다.
본 발명의 다른 양태로, 알츠하이머 예방 또는 치료를 위한 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 건강기능 식품 조성물의 용도를 제공한다. 상기 알츠하이머는 ApoE4 유전자변이를 원인으로 한 알츠하이머일 수 있다. 또한, 상기 알츠하이머는 만발성 알츠하이머병(Late onset Alzheimer's disease) 일 수 있다.
본 발명의 다른 양태로, 알츠하이머 예방 또는 치료를 위한 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 의약외품 조성물의 용도를 제공한다. 상기 알츠하이머는 ApoE4 유전자변이를 원인으로 한 알츠하이머일 수 있다. 또한, 상기 알츠하이머는 만발성 알츠하이머병(Late onset Alzheimer's disease) 일 수 있다.
본 발명의 반하사심탕을 유효성분으로 포함하는 조성물 및 치료방법은 ApoE4의 유전자 변이를 원인으로 한 알츠하이머에 특이적으로 아밀로이드 베타 단백질의 우수한 감소 효과 및 침전 저해 효과를 나타내어, ApoE4 유전자 변이를 원인으로 한 알츠하이머에 특이적인 치료용 조성물로서의 활용도가 높다. 본 명세서에서는 이하의 실시예에서 ApoE4 인간 뇌 성상교세포 및 뇌오가노이드를 이용하여 본 발명의 조성물의 ApoE4 특이적 아밀로이드 베타 감소 효과를 확인하여 위와 같은 효과를 명확히 규명하고 있다.
이러한 점에 있어서, 본 발명의 조성물 및 치료방법은 ApoE4 유전자형에 의한 알츠하이머 환자에 대한 보다 효과적인 맞춤형 치료를 제공할 것이다.
도 1은 CRISPR/Cas9 유전체 편집을 통하여 제작된 ApoE4 알츠하이머성 치매 인간유도만능줄기세포 모델을 나타내는 도이다.
도 2a는 성상교세포 분화과정을 나타내며, 도 2b는 인간유도만능줄기세포에서 신경전구세포를 거쳐 성상교세포로 분화하고 성공적 성상교세포의 분화를 형광염색법으로 검증한 결과를 나타낸다.
도 3은 알츠하이머성 치매 성상교세포에서 한의기반 치료 소재에 의한 아밀로이드 베타 식균작용 회복 탐색 프로토콜을 나타낸다.
도 4는 ApoE3, ApoE4 성상교세포 Aβ42 식균작용 측정 결과(도 4a), 분해 기능이 저하된 ApoE4 성상교세포에서 반하사심탕 처리에 의한 회복 효과(도 4c) 및 ApoE3 대조군에서의 결과(도 4b)를 나타낸다.
도 5는 CRISPR/Cas9 유전자 가위 기법을 통한 치매 인간유도만능줄기 세포 (APPswe) 모델 제작과정을 나타낸 도이다.
도 6은 APPswe 성상교세포에서의 반하사심탕에 의한 아밀로이드 베타 식균작용 효과 측정 실험의 타임라인(도 6a) 및 APPswe 성상교세포에서의 반하사심탕에 의한 아밀로이드 베타 식균작용 효과 측정 결과를 나타낸 도이다(도 6b).
도 7는 ApoE4 뇌오가노이드에서의 반하사심탕 효과 탐색 실험 진행 과정을 나타낸다.
도 8은 ApoE4 뇌오가노이드에서의 아밀로이드베타 침전 증가와 반하사심탕에 의한 감소 효과를 나타낸다. 구체적으로, 아밀로이드 베타 확인을 위한 웨스턴 블랏(western blot)수행 결과를 도 8a에, 상기 수행 결과를 그래프로 수치화하여 도 8b에 나타내었다.
이하, 실시예 및 실험예를 통하여 본 발명의 구성 및 효과를 더욱 상세히 설명하고자 한다. 이들 실시예 및 실험예는 오로지 본 발명을 예시하기 위한 것일 뿐 본 발명의 범위가 이들에 의해 제한되는 것은 아니다.
제조예 1: 반하사심탕을 유효성분으로 포함하는 조성물의 제조
감초(Glycyrrhiza uralensis Fischer, 광과감초 (Glycyrrhiza glabra Linne) 또는 창과감초 (Glycyrrhiza inflata Batal. (콩과 Leguminosae)) 의 뿌리 및 뿌리줄기로서 그대로 또는 주피를 제거한 것) 1. 00 g, 건강(생강 (Zingiber officinale Roscoe)(생강과 Zingiberaceae)의 뿌리줄기를 말린 것) 0. 83 g, 대추(대추나무 (Zizyphus jujuba Miller var. inermis Rehder) 또는 보은대추나무 (Zizyphus jujuba Miller var. hoonensis T. B. Lee )(갈매나무과 Rhamnaceae)의 잘익은열매)1.00 g, 반하(Pine/lia ternata Breitenbach (천남성과 Araceae) 의 덩이줄기로서 주피를 완전히 제거 한 것)1.67 g, 인삼 (Panax ginseng C. A.Meyer (두릅나무과 Araliaceae) 의 뿌리로서 그대로 또는 가는 뿌리와 코르크층을 제거한것)1 .00 g. 황금(속썩은풀 (Scutellaria baica/ensis Georgi)(꿀풀과 Labiatae) 의 뿌리로서 그대로 또는 주피를 제거 한 것)(1.00 g), 황련(Coptis japonica Makino), 중국황련 (Coptis chinensis Franchet), 삼각엽황련 (Coptis deltoidea C. Y. Cheng et Hsiao) 또는 운련 (雲連)(Coptis teeta Wallich)(미나리아재비과 Ranunculaceae)의 뿌리줄기로서 뿌리를 제거한 것)0.33 g 씩을 준비하였다. 상기 생약을 정선하여 원료약풍의 분랑대로 각 생약율 달아 추출기에 넣고 8-10배랑의 상수(KP) 또는 정제수 (KP) 를 넣어 80-100 ℃에서 2-3시간 추출하여, 반하사심탕을 제조하였다.
실시예 1: 인간유도만능줄기세포의 배양
알츠하이머성 치매의 대표 유전적 요인인 ApoE4 변이를 갖고 있는 알츠하이머성 치매 인간유도만능줄기세포 모델을 CRISPR/Cas9 유전체 편집 기법을 사용하여 제작(도 1) 및 제작된 알츠하이머성 치매 인간유도만능줄기세포 모델을 본 연구에 사용하기 위하여, ApoE3 / ApoE4 동질염색체 유도만능줄기세포를 matrigel-coated 6 well plate에서 TeSR1 media을 통해 배양하였다.
그 결과로, CRISPR/Cas9 유전체 편집을 통한 ApoE4 알츠하이머성 치매 인간유도만능줄기세포 모델을 제작하였다.
실시예 2: 성상교세포의 분화
성상교세포의 전구체인 신경전구세포를 인간유도만능줄기세포로부터 분화하기 위하여 인간유도만능줄기세포가 100% confluent 할 때, neuronal induction media [DMEM/F-12 GlutaMAX (Gibco), Neurobasal (Gibco), 0.5x N-2 (Gibco), 0.5x B27 (Gibco), 0.5x GlutaMAX (ThermoFisher Scientific), 5 μg/ml insulin (Sigma-Aldrich), 0.5x NEAA (Thermo Fisher Scientific), 100μM 2-mercaptoethanol (Sigma-Aldrich), 1xPenicillin/Streptomycin (Gibco)] 와 함께 SMAD 신호 억제제인 1 μM Dorsomorphin (Tocris) 와 10 μM SB431542 (Tocris) 를 11일 동안 처리하였다. 또한, 세포를 matrigel-coaated plate 로 옮긴 후 rosette 구조가 나올 때까지 20 ng/ml FGF2 (Peprotech) 를 배양액에 처리하였다.
제작된 신경전구세포는 1.5 x 105 개의 density 로 plating 된 후 Astrocyte Media (Sciencell)에서 배양 및 배양액은 이틀에 한 번씩 교체하여 한 달의 배양 후에는 세포를 TrypLE (Gibco) 로 떼어낸 후 성상교세포 마커인 GLAST-PE antibody (MiltenylBiotec) 로 염색한 후 flow cytometer (Sony SH800)를 통해 GLAST-positive 세포만 따로 모아 배양하였다(도 2a). 성상교세포의 분화를 검증하기 위하여 성상교세포의 또 다른 마커인 GFAP 과 AQP4을 염색하는 antibodies를 통해 형광염색을 수행하였다(도 2b).
인간유도만능줄기세포에서 신경전구세포를 거쳐 성상교세포로 분화 및 성상교세포의 분화를 형광염색법으로 검증하였다.
실시예 3: 반하사심탕에 의한 ApoE4 성상교세포에서의 아밀로이드 베타 식균작용 확인
합성된 아밀로이드 베타 (Aβ42)를 반하사심탕과 함께 ApoE4 성상교세포와 대조군 ApoE3 성상교세포에 처리한 후 이틀을 배양 후, 배양액에 남아 있는 아밀로이드 베타의 양을 ELISA 기법을 통해 측정하였다(도 3).
ApoE4 성상교세포의 경우 ApoE3 와 비교하여 배양액에 Aβ42를 처리하였을 때 이를 제거하는 능력이 현저하게 감소하였다(도 4a). 이 때, 반하사심탕의 투여 시 농도의존적으로 Aβ42 식균능력이 증가하여 정상군인 ApoE3에서의 값과 유사하거나 그 이상으로 증가함을 확인하였다. 특히 300 ug/ml 처리 조건에서의 제거능은 정상군 이상의 값으로 현저하게 증가하였다(도 4c). 반면, ApoE3 성상교세포에서는 반하사심탕 처리에 따른 통계적으로 유의미한 차이가 나타나지 않았다(도 4b).
실시예 4: 반하사심탕에 의한 APPswe (APP swedish) 성상교세포에서의 아밀로이드 베타 식균 작용 확인
다음으로, APPswe 유전자 변이를 원인으로 한 알츠하이머에 대해서도 반하사심탕의 치료 활성이 존재하는지 확인하고자 APPswe 성상교세포 모델을 제작하였다. APP는 아밀로이드전구체단백질 유전자(amyloid precursor protein gene)로, 가족성 알츠하이머병의 대표적인 원인유전자로 알려져 있다.
구체적으로, 본 출원인들은 정상인의 인간유도만능줄기세포에 알츠하이머성 치매 유발 변이인 APPswe (APP 유전자의 KM670/671NL double mutation)를 CRISPR/Cas9 유전자 가위 기법으로 삽입하여 '알츠하이머성 치매 인간유도만능줄기세포 모델 (APPswe)'을 제작하였다(도 5). 이 때, 본 실험에 이용한 서열은 하기와 같다.
WT sequence GAGATCTCTGAAGTGAAGATGGA
Repair ssODN GAGATCTCTGAAGTGAATCTCGA
한편, 성상교세포세포의 분화과정은 상기 실시예 2와 동일하게 수행하였다. 합성된 아밀로이드 베타 (Aβ42)를 반하사심탕과 함께 APPswe 성상교세포에 처리 한 후 이틀을 배양 후, 배양액에 남아 있는 아밀로이드 베타의 양을 ELISA 기법을 통해 측정하였다. 본 실험의 대략적인 타임라인을 도 6a에, 결과를 도 6b에 나타내었다.
도 6b의 결과에서 확인할 수 있듯, Familial alzhheimer's disease line인 APPswe 성상교세포에서는 반하사심탕 처리에 의한 아밀로이드 베타 (Aβ42) 제거능의 변화가 나타나지 않았다.
이러한 상기 실시예 3 및 4의 결과로부터, 반하사심탕의 ApoE4 보유 세포에 대한 특이적인 아밀로이드 베타 감소 효과를 확인할 수 있다.
실시예 5: 뇌오가노이드에서 반하사심탕 처리에 의한 알츠하이머 연관 병리현상 완화 확인
반하사심탕을 4개월 동안 배양된 ApoE4 뇌오가노이드에 7일동안 300 ug/ml 농도로 처리한 후 아밀로이드베타 축적 변화 양상을 확인하였다(도 7).
배양된 ApoE4 뇌오가노이드에서 ApoE3 뇌오가노이드에 비하여 아밀로이드베타 4량체(tetramer) 이하 및 이상의 중합체 모두에서 유의미한 증가가 관찰되었다. 아밀로이드 베타의 경우 4량체(tetramer) 올리고머(oligomer)를 형성할 때부터 Aβ40 과 구조가 상이해져 빠르게 독성을 가지는 핵을 형성할 수 있는 것으로 알려져 있는 바, 4량체 이상의 올리고머 형성이 신경독성에 더 주요한 영향인자이다. 도 8b에서 볼 수 있듯, ApoE4 뇌오가노이드에 반하사심탕을 처리한 그룹의 경우 4량체 이하 및 이상 중합체량의 감소가 모두 관찰되었다(도 8b).
이러한 결과는 본 발명이 ApoE4에 의해 유발된 알츠하이머에 있어서의 아밀로이드 베타 억제 및 식균작용에 우수한 효과가 있음을 나타내며, 본 발명이 ApoE4에 의해 유발된 알츠하이머에 대한 특이적 치료제 또는 만발성 알츠하이머병(Late onset Alzheimer's disease)에 대한 특이적 치료제로서 유용하게 활용될 수 있음을 시사한다.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.

Claims (9)

  1. 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서, 상기 알츠하이머는 ApoE4 유전자변이를 원인으로 한 것인, 알츠하이머 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서, 상기 알츠하이머는 만발성 알츠하이머병(Late onset Alzheimer's disease)인, 알츠하이머 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서, 상기 추출물은 물 또는 탄소수 1 내지 4의 저급알코올 추출물인 것인, 알츠하이머 예방 또는 치료용 약학적 조성물.
  5. 제1항에 있어서, 상기 조성물은 아밀로이드 베타 감소 효과를 나타내는 것을 특징으로 하는, 알츠하이머 예방 또는 치료용 약학적 조성물.
  6. 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 ApoE4 유전자변이를 원인으로 한 알츠하이머 예방 또는 개선용 건강기능식품 조성물.
  7. 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 ApoE4 유전자변이를 원인으로 한 알츠하이머 예방 또는 개선용 의약외품 조성물.
  8. 제1항의 약학적 조성물을 인간을 제외한 개체에 투여하는 단계를 포함하는, ApoE4 유전자변이를 원인으로 한 알츠하이머의 치료 방법.
  9. 알츠하이머 예방 또는 치료를 위한 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는 조성물의 용도.
PCT/KR2022/014816 2021-09-30 2022-09-30 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 치료용 조성물 WO2023055198A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202280066673.XA CN118103053A (zh) 2021-09-30 2022-09-30 包含半夏、大枣、甘草、人参、干姜、黄芩和黄连的混合提取物作为活性成分的用于治疗阿尔茨海默病的组合物

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0130429 2021-09-30
KR20210130429 2021-09-30

Publications (1)

Publication Number Publication Date
WO2023055198A1 true WO2023055198A1 (ko) 2023-04-06

Family

ID=85783285

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/014816 WO2023055198A1 (ko) 2021-09-30 2022-09-30 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 치료용 조성물

Country Status (3)

Country Link
KR (1) KR20230047320A (ko)
CN (1) CN118103053A (ko)
WO (1) WO2023055198A1 (ko)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020096925A (ko) * 2001-06-15 2002-12-31 주식회사 장생도라지 도라지 추출물을 포함하는 퇴행성 뇌질환의 예방 및치료용 또는 기억력 증진용 조성물
KR20070099144A (ko) * 2006-04-03 2007-10-09 황귀서 인삼, 백복신, 원지, 석창포, 천마 및 사향 또는 소합향추출물을 함유하는 뇌기능 및 인지기능 개선을 위한 조성물
KR20100126326A (ko) 2008-02-29 2010-12-01 그노시스 에스.피.에이. 알츠하이머 병 치료용 의약의 제조를 위한 ｓ-아데노실메티오닌(ｓａｍ) 및 슈퍼옥시드 디스뮤타아제(ｓｏｄ)의 용도
JP6704050B2 (ja) * 2016-07-13 2020-06-03 株式会社マイトス 水素を有効成分として含む軽度認知障害又は認知症の予防又は治療用組成物
KR20210010354A (ko) * 2019-07-18 2021-01-27 동국대학교 경주캠퍼스 산학협력단 우황청심환 및 도네페질을 포함하는 치매 예방 또는 치료용 약학 조성물
KR102209028B1 (ko) * 2020-02-14 2021-01-28 주성수 증포 인삼열매 발효물을 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020096925A (ko) * 2001-06-15 2002-12-31 주식회사 장생도라지 도라지 추출물을 포함하는 퇴행성 뇌질환의 예방 및치료용 또는 기억력 증진용 조성물
KR20070099144A (ko) * 2006-04-03 2007-10-09 황귀서 인삼, 백복신, 원지, 석창포, 천마 및 사향 또는 소합향추출물을 함유하는 뇌기능 및 인지기능 개선을 위한 조성물
KR20100126326A (ko) 2008-02-29 2010-12-01 그노시스 에스.피.에이. 알츠하이머 병 치료용 의약의 제조를 위한 ｓ-아데노실메티오닌(ｓａｍ) 및 슈퍼옥시드 디스뮤타아제(ｓｏｄ)의 용도
JP6704050B2 (ja) * 2016-07-13 2020-06-03 株式会社マイトス 水素を有効成分として含む軽度認知障害又は認知症の予防又は治療用組成物
KR20210010354A (ko) * 2019-07-18 2021-01-27 동국대학교 경주캠퍼스 산학협력단 우황청심환 및 도네페질을 포함하는 치매 예방 또는 치료용 약학 조성물
KR102209028B1 (ko) * 2020-02-14 2021-01-28 주성수 증포 인삼열매 발효물을 유효성분으로 포함하는 퇴행성 뇌질환 예방 또는 치료용 약학적 조성물

Also Published As

Publication number Publication date
CN118103053A (zh) 2024-05-28
KR20230047320A (ko) 2023-04-07

Similar Documents

Publication Publication Date Title
WO2010058926A2 (ko) 생강 추출물 또는 쇼가올을 포함하는 약학 조성물
WO2012050396A2 (ko) 생약 추출물을 포함하는 간암 예방 또는 치료용 약학적 조성물
WO2012094832A1 (zh) 一种防治动脉硬化的复方中药提取物及其制备方法
WO2016032249A1 (ko) 모새나무 추출물 또는 이의 분획물을 유효성분으로 포함하는 신경염증 또는 퇴행성 뇌신경 질환의 예방 또는 치료용 약학적 조성물
JP6773821B2 (ja) 桑椹子およびブクリョウ皮の混合抽出物を含有する退行性神経疾患の予防、改善または治療用組成物
WO2012108635A2 (ko) 천궁 및 종대황의 혼합 생약 추출물을 함유하는 호흡기 질환의 예방 또는 치료용 조성물
WO2012050398A2 (ko) 생약 추출물을 포함하는 폐암 예방 또는 치료용 약학적 조성물
WO2018208128A1 (ko) 틸리아닌을 유효성분으로 포함하는 파킨슨 질환의 예방 또는 치료용 약학적 조성물
WO2014025202A1 (ko) 작약, 건강 혼합추출물을 포함하는 치매 및 인지기능장애 예방 또는 치료용 약제학적 조성물
EP1843774B1 (en) Pulsatilla spp. extracts effective in brain function
KR101793503B1 (ko) 퇴행성 뇌질환 예방, 개선 또는 치료용 조성물
WO2012050397A2 (ko) 생약 추출물을 포함하는 신장암 예방 또는 치료용 약학적 조성물
WO2024005561A1 (ko) 노각나무 추출물을 유효성분으로 포함하는 치매의 예방 또는 치료용 조성물
WO2023055198A1 (ko) 반하, 대추, 감초, 인삼, 건강, 황금 및 황련 혼합 추출물을 유효성분으로 포함하는, 알츠하이머 치료용 조성물
WO2019050123A1 (ko) 가자나무열매추출물 및 암라추출물을 포함하는 비만 또는 고지혈증 개선용 식품 조성물
WO2011139118A2 (en) A pharmaceutical composition and a health functional food composition for preventing, treating or improving a gastrointestinal dyskinetic disease
WO2019177428A1 (ko) 호흡기 질환의 예방 또는 치료용 생약 조성물
WO2022065970A2 (ko) 천연물 혼합 추출물을 포함하는 코로나바이러스 감염 예방 또는 치료용 조성물
WO2021086120A1 (ko) 단삼(Salvia miltiorrhiza Bunge) 추출물을 유효성분으로 포함하는 전립선비대증 또는 탈모증의 치료 또는 예방용 조성물
WO2020071620A1 (ko) 참당귀 추출물 또는 참당귀 및 브로콜리의 혼합 추출물을 포함하는 퇴행성 신경질환의 예방 또는 치료용 약학 조성물
WO2017069506A1 (ko) 울금 및 감초 추출물의 혼합물을 유효성분으로 함유하는 갱년기 증상 예방 및 치료용 약학적 조성물
WO2019151547A1 (ko) 침향 추출물의 분획물을 유효성분으로 포함하는 퇴행성 신경질환의 예방, 개선 또는 치료용 조성물
WO2021071321A1 (ko) 원화, 위령선, 및 천마의 복합 생약 추출물을 포함하는 신경퇴행성 질환의 예방 또는 치료용 조성물
WO2012108746A2 (ko) 천초근 추출물을 포함하는 뇌암 치료용 조성물 및 화장료 조성물
WO2024117801A1 (ko) 염증성 질환의 예방, 치료 또는 개선용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22876969

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022876969

Country of ref document: EP

Effective date: 20240430