WO2023055055A1 - 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도 - Google Patents

탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도 Download PDF

Info

Publication number
WO2023055055A1
WO2023055055A1 PCT/KR2022/014522 KR2022014522W WO2023055055A1 WO 2023055055 A1 WO2023055055 A1 WO 2023055055A1 KR 2022014522 W KR2022014522 W KR 2022014522W WO 2023055055 A1 WO2023055055 A1 WO 2023055055A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
peptide
hair
hair loss
cells
Prior art date
Application number
PCT/KR2022/014522
Other languages
English (en)
French (fr)
Inventor
정용지
김은미
이응지
김민웅
길하나
Original Assignee
(주)케어젠
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by (주)케어젠 filed Critical (주)케어젠
Priority to CN202280065980.6A priority Critical patent/CN118043336A/zh
Publication of WO2023055055A1 publication Critical patent/WO2023055055A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04—Linear peptides containing only normal peptide links
    • C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00—Cosmetics or similar toiletry preparations
    • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/14—Drugs for dermatological disorders for baldness or alopecia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00—Preparations for care of the skin

Definitions

  • the present invention relates to a novel peptide having an activity capable of improving hair loss or promoting hair growth, and uses thereof.
  • Human hair is about 100,000 to 150,000 on average, and as cell division and activity of hair follicles are stopped in the process of repeating growth, regression, and rest, existing hairs are pushed out by newly growing hairs and fall out naturally.
  • This natural hair loss phenomenon occurs when an average of about 100 hairs fall out per day, and a larger amount of hair is lost than the above natural hair loss, or hair does not exist in areas where hair should normally exist. If it does not grow, hair loss appears as a kind of disease. Hair loss may appear in the natural aging process, but may also be caused by external environmental factors such as hormonal changes, stress, air pollution, and processed foods.
  • the dermal papilla present in the hair root becomes smaller, and accordingly, the thickness of the hair growing from the dermal papilla becomes thinner, and the growth, regression, and resting hair cycles are also shortened, so that newly growing hair becomes thinner. As this phenomenon is repeated, the hair that becomes thinner and thinner becomes fluffy, and the hair cycle is gradually shortened, so that the hair falls out after not growing for a while, and the overall number of hairs decreases.
  • Korean Patent Publication No. 2020-0058932 discloses a composition for preventing hair loss and improving hair loss containing bellflower extract, etc.
  • Korean Patent Publication No. 2017-0046528 discloses a composite composition for improving hair loss and preventing hair loss containing various herbal extracts.
  • unexpected side effects may occur due to the use of various types of natural products that may contain various components, especially in the case of hormone-regulating treatments, causing side effects related to sexual function.
  • a peptide having a hair loss treatment effect is developed among peptides formed by connecting amino acids and used as a hair loss treatment, it has high biocompatibility and is likely to show similar activity by mimicking the active site of other proteins in the human body.
  • the mechanism of action is clear compared to extracts containing various ingredients, and it can be easily degraded and removed by decomposed proteins in the body after suppressing hair loss locally, so unlike conventional treatments, there are no side effects. there is little concern about Therefore, there is an urgent need to develop a peptide preparation capable of effectively preventing hair loss and promoting hair growth while having few side effects.
  • Patent Document 1 Korean Patent Publication No. 2020-0058932
  • Patent Document 2 Korean Patent Publication No. 2017-0046528
  • An object of the present invention is to provide a peptide that can promote hair growth because it has an activity that induces to increase the proliferation or activity of cells related to hair formation.
  • an object of the present invention is to provide a composition for effectively preventing, treating, improving hair loss or promoting hair growth using the above peptide.
  • one aspect of the present invention provides a peptide containing the amino acid sequence of SEQ ID NO: 1, having an activity to prevent hair loss or promote hair growth.
  • Another aspect of the present invention provides a composition for preventing hair loss or promoting hair growth, including the peptide.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating hair loss, comprising the peptide.
  • Another aspect of the present invention provides a cosmetic composition for preventing or improving hair loss comprising the peptide.
  • One aspect of the present invention provides a novel peptide having an activity of preventing hair loss or promoting hair growth.
  • peptide refers to a polymer composed of two or more amino acids linked by peptide bonds.
  • the term "hair loss” means that hair does not exist in an area where hair should normally exist, and includes a phenomenon in which the number of hairs is reduced compared to the normal state.
  • the hair loss is a concept that includes both non-scarring hair loss and scarring hair loss depending on whether hair follicles are destroyed, for example, hereditary androgenetic alopecia, alopecia areata, tinea capitis due to fungal infection, telogen hair loss, hair growth, and hair loss. It includes all disorders of production, alopecia caused by lupus, folliculitis, lichen planus pilaris, hair loss caused by burns and/or trauma, and the like.
  • the peptide includes the amino acid sequence of SEQ ID NO: 1.
  • the peptide may include a mutant peptide having a different sequence by deletion, insertion, substitution, or a combination of amino acid residues within a range that does not affect the activity of the peptide, or a protein fragment having the same function.
  • can be in the form Amino acid modifications at the protein and peptide level that do not entirely change the activity by including the amino acid sequence of SEQ ID NO: 1 are known in the art, and in some cases phosphorylation, sulfation , acrylation, glycosylation, methylation, and farnesylation.
  • the peptide includes not only the amino acid sequence of SEQ ID NO: 1, but also a peptide having an amino acid sequence substantially identical thereto or a variant thereof.
  • the peptide having the substantially identical amino acid sequence is 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more of the amino acid sequence of SEQ ID NO: 1 , It may be a peptide comprising an amino acid sequence having 98% or more, 99% or more, or 99.5% or more homology, but is not limited thereto, and a sequence having 90% or more amino acid sequence homology with the amino acid sequence of SEQ ID NO: 1 Any peptide having the same activity while including a is included in the scope of the present invention.
  • the peptide of the present invention may be composed of 20 or less amino acids that exhibit hair loss prevention or hair growth promoting activity while including the amino acid sequence of SEQ ID NO: 1. Specifically, the peptide may be composed of 20 or less, 18 or less, 15 or less, or 12 amino acids.
  • the peptides of the present invention can be obtained by various methods well known in the art. As an example, it can be produced using a polynucleotide recombination and protein expression system, or synthesized in vitro through chemical synthesis such as peptide synthesis, and cell-free protein synthesis, but is not limited by its production method no.
  • the N-terminus or A protecting group may be bound to the C-terminus.
  • the protecting group may be an acetyl group, a fluorenyl methoxycarbonyl group, a formyl group, a palmitoyl group, a myristyl group, a stearyl group, or polyethylene glycol (PEG), but modification of the peptide, in particular, stability of the peptide may be improved. If there is a component, it can be included without limitation.
  • the 'stability' refers to storage stability (eg, storage stability at room temperature) as well as in vivo stability that protects the peptide of the present invention from attack by proteolytic enzymes in vivo.
  • the peptide of the present invention may promote proliferation or activity of cells related to hair formation. Specifically, the peptide promotes the proliferation of hair formation-related cells such as dermal papilla cells, outer root sheath cells, and germinal matrix cells to increase their number. It may have activity, or may have activity to induce hair formation by promoting the activity of the cells.
  • hair formation-related cells such as dermal papilla cells, outer root sheath cells, and germinal matrix cells to increase their number. It may have activity, or may have activity to induce hair formation by promoting the activity of the cells.
  • the peptide of the present invention may inhibit the expression of proteins related to the occurrence of hair loss in cells related to hair formation, and specifically, suppress the expression of DKK-1 protein (dickkopf-related protein 1) in dermal papilla cells It may be to do, and more specifically, it may be to inhibit the expression of DKK-1 protein in dermal papilla cells in which the expression of DKK-1 protein is induced by a hormone such as DHT (dihydrotestosterone).
  • DKK-1 protein dickkopf-related protein 1
  • DHT dihydrotestosterone
  • the peptides of the present invention have the above activities, they can be usefully used for preventing hair loss or promoting hair growth.
  • another aspect of the present invention provides a composition for preventing hair loss or promoting hair growth, including the peptide.
  • the peptide may be included in the composition at a concentration of 0.01 ⁇ M to 100 ⁇ M. Specifically, the peptide may be included in a concentration of 0.01 ⁇ M to 100 ⁇ M, 0.05 ⁇ M to 80 ⁇ M, 0.1 ⁇ M to 60 ⁇ M, or 0.5 ⁇ M to 50 ⁇ M, but is not limited thereto.
  • concentration of the peptide included in the composition of the present invention is within the above range, the effect of preventing hair loss and/or promoting hair growth is sufficiently exhibited by the activity of the peptide, but has the advantage of not exhibiting toxicity to organisms or their cells.
  • the composition may induce the formation of hair by promoting the activity of one or more cells selected from the group consisting of dermal papilla cells, outer root sheath cells, and hair cells.
  • the composition may induce at least one phosphorylation selected from the group consisting of AKT and ERK in dermal papilla cells.
  • the composition can increase the amount of p-AKT and/or p-ERK in dermal papilla cells, thereby activating signaling pathways related to the proliferation of dermal papilla cells.
  • the composition may induce activation of ⁇ -catenin in dermal papilla cells. Specifically, the composition may activate ⁇ -catenin in dermal papilla cells to induce migration to the nucleus, and thus promote or induce cell proliferation and/or differentiation of dermal papilla cells.
  • the composition may promote expression of at least one selected from the group consisting of LEF-1, c-Myc, and cyclin D1 in dermal papilla cells. Specifically, as the composition promotes or induces cell proliferation and/or differentiation in dermal papilla cells, it can promote the expression of LEF-1, c-Myc and/or cyclin D1.
  • the absorbance was measured by treating human hair follicle dermal papilla cells (HHFDPC) with the composition containing the peptide of the present invention at each concentration, and the absorbance was greater than that of the control group. , it was confirmed that there is an effect of promoting and inducing the proliferation of HHFDPC.
  • HHFDPC human hair follicle dermal papilla cells
  • p-AKT and p-ERK which are factors related to their proliferation or activation, are increased, and ⁇ -catenin is activated to increase migration to the nucleus, resulting in LEF-1, c-Myc, and cyclin D1 expression increased.
  • the peptide of the present invention and the composition containing the same have an excellent effect of promoting or inducing the proliferation and activity of dermal papilla cells, which are cells constituting hair follicles, to promote hair growth or prevent hair loss.
  • the composition may inhibit the expression of DKK-1 protein in dermal papilla cells. Specifically, it may be to inhibit the expression of DKK-1 protein in dermal papilla cells in which the expression of DKK-1 protein is induced by a hormone such as DHT (dihydrotestosterone).
  • DHT dihydrotestosterone
  • the composition containing the peptide of the present invention was treated with DHT to induce the expression of DKK-1 protein, and dermal papilla cells HHFDPC were treated at different concentrations to confirm DKK-1 protein through Western blotting. As a result, it was confirmed that the amount of DKK-1 protein was reduced compared to the negative control group.
  • the peptide of the present invention and the composition containing the same have the effect of suppressing the expression of hair loss-related proteins in dermal papilla cells and are useful for preventing hair loss I was able to confirm that it could be used.
  • the composition may promote the expression of one or more selected from the group consisting of Ha3-II, Keratin 5, Keratin 14 and Keratin 19 in outer root sheath cells. Specifically, the composition may promote the expression of Ha3-II, Keratin 5, Keratin 14 and/or Keratin 19 by increasing the cellular activity of outer root sheath cells.
  • the expression of Ha3-II, Keratin 5, Keratin 14 and Keratin 19 was confirmed by RT-PCR by treating the outer root sheath cell HHORSC with the composition containing the peptide of the present invention at each concentration, As it was confirmed that the expression level was increased compared to the control group, the peptide of the present invention and the composition containing the same have the effect of increasing the activity of outer root sheath cells, a type of cells constituting hair follicles, thereby preventing hair loss or promoting hair growth. I was able to confirm that it worked.
  • the composition may promote expression of at least one selected from the group consisting of MSX2 and FOXN1 in parental cells. Specifically, the composition may promote the expression of MSX2 and/or FOXN1, which are transcription factors related to cellular activity of hair cells, to induce the expression of genes related to the activity of hair cells.
  • the composition containing the peptide of the present invention was treated with the parental cell HHGMC for each concentration, and the expression of MSX2 and FOXN1 was confirmed through RT-PCR. As a result, it was confirmed that the expression level increased compared to the control group. Bar, it was confirmed that the peptide of the present invention and the composition containing the same have the effect of increasing the activity of hair cells, which are a type of hair-forming cells, and thus have the effect of preventing hair loss or promoting hair growth.
  • Another aspect of the present invention provides a pharmaceutical composition for preventing or treating hair loss comprising the peptide.
  • the peptide includes the amino acid sequence of SEQ ID NO: 1, and the description thereof is the same as that of the peptide described in the section 'Peptides having hair loss prevention or hair growth promoting activity and uses thereof', and specific descriptions are incorporated therein. Hereinafter, only the configuration specific to the pharmaceutical composition will be described.
  • prevention means reducing the risk of suffering from a disease or disorder, and is susceptible to one or more clinical symptoms of a disease in a subject who is susceptible to or susceptible to a disease but does not yet suffer from the disease or does not show symptoms of the disease. It means any action that suppresses or delays the onset of a disease by preventing symptoms from progressing.
  • treatment means alleviating a disease or disorder, and includes all actions that improve or beneficially change the symptoms of a disease by preventing or reducing the progression of the disease or one or more clinical symptoms thereof.
  • the peptide may be included in a therapeutically effective amount, and may further include a pharmaceutically acceptable carrier.
  • therapeutically effective amount means an amount sufficient to achieve the purpose of the present composition for preventing or treating hair loss.
  • hair loss means that hair does not exist in an area where hair should normally exist, and includes a phenomenon in which the number of hairs is reduced compared to the normal state.
  • the hair loss is a concept that includes both non-scarring hair loss and scarring hair loss depending on whether hair follicles are destroyed, for example, hereditary androgenetic alopecia, alopecia areata, tinea capitis due to fungal infection, telogen hair loss, hair growth, and hair loss. It includes all disorders of production, alopecia caused by lupus, folliculitis, lichen planus pilaris, hair loss caused by burns and/or trauma, and the like.
  • the prevention or treatment of hair loss may be to remove the cause of hair loss or to suppress the progression of hair loss, or to promote hair growth by suppressing hair loss or promoting hair formation.
  • the pharmaceutical composition of the present invention is formulated according to a method that can be easily performed by those skilled in the art, using pharmaceutically acceptable carriers and / or excipients, thereby unit dose It can be prepared in a form or put into a multi-dose container.
  • the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, capsule, or gel (eg, hydrogel), and may additionally contain a dispersing agent or a stabilizer. there is.
  • the peptide included in the pharmaceutical composition may be transported in a pharmaceutically acceptable carrier such as colloidal suspension, powder, saline solution, lipid, liposome, microspheres, or nano-spherical particles. They may be complexed with or associated with the delivery vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be delivered in vivo using known delivery systems.
  • a pharmaceutically acceptable carrier such as colloidal suspension, powder, saline solution, lipid, liposome, microspheres, or nano-spherical particles. They may be complexed with or associated with the delivery vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino
  • pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinyl pyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, and the like, but are not limited thereto.
  • lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like may be further included.
  • the pharmaceutical composition according to the present invention can be administered orally or parenterally during clinical administration and can be used in the form of a general pharmaceutical preparation. That is, the pharmaceutical composition of the present invention can be administered in various oral and parenteral formulations at the time of actual clinical administration, and when formulated, commonly used fillers, extenders, binders, wetting agents, disintegrants, Or prepared using an excipient.
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, for example, starch, calcium carbonate, sucrose or It is prepared by mixing lactose and gelatin. In addition to simple excipients, lubricants such as magnesium styrate and talc are also used.
  • Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • Witepsol Macrogol, Tween 61, cacao butter, laurin paper, glycerol, gelatin, and the like may be used.
  • the dosage of the peptide may vary depending on factors such as formulation method, administration method, patient's age, weight, sex, morbid condition, food, administration time, administration route, excretion rate and reaction sensitivity, but generally 1 to 20 mg/day, preferably 5 to 10 mg/day per 1 kg body weight of an adult patient, divided several times a day at regular time intervals, preferably 2 to 3 times a day according to the judgment of a doctor or pharmacist can be administered.
  • the pharmaceutical composition of the present invention may be an external preparation for skin.
  • the external skin preparation is a preparation that can be applied and used on the outside of the skin.
  • the pharmaceutical composition of the present invention is used as an external skin preparation, it is the scalp, specifically the scalp of the area where hair loss occurs or the area where hair growth is to be promoted. It may be applied to the scalp of.
  • the external skin preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof.
  • the external skin preparation is a component usually used in external skin preparations such as cosmetics or pharmaceuticals, for example, water-based components, oil-based components, powder components, alcohols, moisturizers, midpoint agents, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, It can be appropriately blended with fragrances, colorants, various skin nutrients, or combinations thereof as needed.
  • the external skin preparations include metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, bellapamil, licorice extract, glabridin, and calin.
  • Hot water extract of fruit, various herbal medicines, drugs such as tocopherol acetate, glycylitnic acid, tranexamic acid and its derivatives or salts, vitamin C, magnesium ascorbic acid phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can also be mix
  • Another aspect of the present invention provides a cosmetic composition for preventing or improving hair loss comprising the peptide.
  • the peptide includes the amino acid sequence of SEQ ID NO: 1, and the description thereof is the same as that of the peptide described in the section 'Peptides having hair loss prevention or hair growth promoting activity and uses thereof', and specific descriptions are incorporated therein. Hereinafter, only the configuration specific to the cosmetic composition will be described.
  • the term "improvement” refers to any action that improves or benefits the symptoms of a disease or disorder.
  • the prevention or improvement of hair loss may be to remove the cause of hair loss or to suppress the progression of hair loss, or to promote hair growth by suppressing hair loss or promoting hair formation.
  • the cosmetic composition may include a cosmetically effective amount of the peptide and a cosmetically acceptable carrier, and the cosmetically effective amount means an amount sufficient to achieve the aforementioned effect of preventing hair loss or promoting hair growth. .
  • the cosmetic composition of the present invention may further contain other components characterized by being able to give a synergistic effect to the activity of the peptide, for example, within a range that does not affect the hair loss prevention or hair growth promoting activity of the peptide.
  • fatty substances organic solvents, solubilizers, thickeners and gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers
  • Cosmetics such as fillers, sequestering and chelating agents, preservatives, vitamins, blocking agents, humectants, essential oils, dyes, pigments, fragrances, hydrophilic or lipophilic actives, lipid vesicles or any other ingredient commonly used in cosmetics. or supplements commonly used in the field of skin science, and the components may be contained in amounts commonly used in the field of cosmetics or skin science.
  • the cosmetic composition of the present invention may be prepared in any formulation conventionally prepared in the art, for example, a solution, suspension, emulsion, gel, lotion, essence, cream, powder, soap, shampoo, rinse, It can be formulated into cosmetics such as a pack mask, surfactant-containing cleansing, cleansing foam, cleansing water, oil, liquid foundation, cream foundation or spray.
  • a solvent, solubilizing agent or emulsifying agent may be used as a carrier component, such as water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1 ,3-butyl glycol oil, glycerol fatty esters, polyethylene glycol or fatty acid esters of sorbitan may be used.
  • a liquid diluent such as water, ethanol or propylene glycol, an ethoxylated isostearyl alcohol, a suspension agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, aluminum metahydroxy Seeds, microcrystalline cellulose, bentonite, agar or tracanth and the like may be used.
  • a suspension agent such as polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, aluminum metahydroxy Seeds, microcrystalline cellulose, bentonite, agar or tracanth and the like may be used.
  • the formulation is a cream or gel, wax, paraffin, tracanth, animal oil, starch, cellulose derivative, silicone, bentonite, polyethylene glycol, silica, zinc oxide, or talc may be used as a carrier component.
  • a propellant such as silica, talc, aluminum hydroxy group, lactose, calcium silicate, chlorofluorohydrocarbon, propane/butane or dimethyl ether may be included as a carrier component.
  • fatty alcohol sulfate aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, imidazolinium derivative, isethionate, methyl taurate, sarcosinate, fatty acid amide ether sulfate as a carrier component
  • Fatty alcohols, alkylamidobetaines, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, or ethoxylated glycerol fatty acid esters may be used.
  • the cosmetic composition of the present invention may be an external preparation for skin.
  • the external skin preparation is a preparation that can be applied and used on the outside of the skin.
  • the cosmetic composition of the present invention is used as an external skin preparation, it is applied to the scalp, specifically, the scalp of the area where hair loss occurs or the area where hair growth is to be promoted. It can be applied to the scalp.
  • the external skin preparation may be a cream, gel, ointment, skin emulsifier, skin suspension, transdermal delivery patch, drug-containing bandage, lotion, or a combination thereof.
  • the external skin preparation is a component usually used in external skin preparations such as cosmetics or pharmaceuticals, for example, water-based components, oil-based components, powder components, alcohols, moisturizers, midpoint agents, ultraviolet absorbers, whitening agents, preservatives, antioxidants, surfactants, It can be appropriately blended with fragrances, colorants, various skin nutrients, or combinations thereof as needed.
  • the external skin preparations include metal sequestering agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid, caffeine, tannin, bellapamil, licorice extract, glabridin, and calin.
  • Hot water extract of fruit, various herbal medicines, drugs such as tocopherol acetate, glycylitnic acid, tranexamic acid and its derivatives or salts, vitamin C, magnesium ascorbic acid phosphate, ascorbic acid glucoside, arbutin, kojic acid, glucose, fructose, Sugars, such as trehalose, etc. can also be mix
  • a method for treating hair loss comprising administering a therapeutically effective amount of the peptide to a subject in need of treatment for hair loss.
  • a method for improving hair loss comprising the step of administering a cosmetically effective amount of the peptide to a subject in need of improvement of hair loss.
  • the use of the peptide for the treatment of alopecia is provided.
  • the use of the peptide in the manufacture of a medicament for treating or preventing alopecia is provided.
  • the peptides provided in the present invention have an activity of promoting the proliferation of or promoting the activity of cells that form hair follicles or are involved in hair formation, such as dermal papilla cells, outer root sheath cells, and hair cells.
  • the peptides of the present invention can increase the expression level of genes or proteins related to the proliferation, differentiation, and activation of the cells, and have an activity to suppress the expression of hair loss-related proteins induced by hormones such as DHT.
  • the peptide and the composition containing the same may be usefully used for preventing, treating or improving hair loss or promoting hair growth.
  • the peptide of the present invention and the composition containing it use a single peptide as an active ingredient, various ingredients can be included, compared to hair loss improving agents using natural products that can exhibit unexpected effects, topical After showing the effect of suppressing hair loss, it can be easily decomposed and removed by proteolytic enzymes in the body, and since the mechanism of action is clearer, there is an advantage that there is little or no possibility of side effects.
  • composition of the present invention which uses a peptide as an active ingredient, has higher biocompatibility than conventional therapeutic agents in that it uses a substance composed of amino acid bonds as an active ingredient, and the peptide mimics the active site of a protein in the human body, thereby There is an advantage of having a possibility of exhibiting similar activity, and there is an effect that there are fewer problems such as deterioration of sexual function due to hormone regulation.
  • Figure 1 is a control group (Con) without any treatment and a positive control group (MNX) treated with minoxidil by checking the proliferation of cells after treating HHFDPC with a peptide containing the amino acid sequence of SEQ ID NO: 1 of the present invention by concentration. ) It is a graph shown by comparing the numerical value of
  • Figure 2 shows that the peptide containing the amino acid sequence of SEQ ID NO: 1 of the present invention was treated by concentration in HHFDPC, or in a control group (Con) without any treatment and a positive control group (MNX) treated with minoxidil, phosphorylated AKT and ERK (respectively, p-AKT and p-ERK) were confirmed through Western blotting.
  • 3 is a result of confirming ⁇ -catenin transferred to the nucleus through Western blotting in a control group (Con) treated with a peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention by concentration in HHFDPC or without any treatment am.
  • Figure 4 shows the expression of LEF-1, c-Myc and cyclin D1 in a control group (Con) treated with a peptide comprising the amino acid sequence of SEQ ID NO: 1 of the present invention by concentration in HHFDPC or not treated at all by RT- This is the result confirmed by PCR.
  • Figure 5 is a control (Con) treated with a peptide containing the amino acid sequence of SEQ ID NO: 1 of the present invention to DHT-treated HHFDPC by concentration, or no treatment (Con), finasteride-treated positive control (Finasteride), DKK- 1 This is the result of confirming the protein through Western blotting.
  • Figure 6 is a control (Con) treated with a peptide containing the amino acid sequence of SEQ ID NO: 1 of the present invention by concentration in HHORSC, or no treatment (Con), in a positive control group treated with EGF, Ha3-II, Keratin 5, Keratin 14 and Keratin 19 expression were confirmed through RT-PCR.
  • Figure 7 shows the expression of MSX2 and FOXN1 in a control group (Con) treated with a peptide containing the amino acid sequence of SEQ ID NO: 1 of the present invention by concentration in HHGMC, or no treatment (Con), and a positive control group treated with EGF, by RT- This is the result confirmed by PCR.
  • a peptide having the amino acid sequence of SEQ ID NO: 1 shown in Table 1 below was synthesized using an automatic peptide synthesizer (Milligen 9050, Millipore, USA), and using C18 reverse phase high performance liquid chromatography (HPLC) (Waters Associates, USA) Thus, these synthesized peptides were purified.
  • ACQUITY UPLC BEH300 C18 (2.1 mm ⁇ 100 mm, 1.7 ⁇ m, Waters Co, USA) was used as the column.
  • HHFDPC human hair follicle dermal papilla cells
  • HHFDPC Mesenchymal stem cell complete media, Sciencell, USA
  • MSC complete medium meenchymal stem cell complete media, Sciencell, USA
  • serum-free It was replaced with MSC complete medium and cultured again for 24 hours.
  • the HHFDPC was treated with the peptide of SEQ ID NO: 1 prepared in Preparation Example at concentrations of 500 nM, 5 ⁇ M and 50 ⁇ M, respectively, and incubated at 37° C. for 72 hours.
  • minoxidil was treated at a concentration of 1 ⁇ M and used, and as a negative control, HHFDPC without any treatment was used.
  • the absorbance was measured higher than that of the control group without any treatment, and it was confirmed that the proliferation of HHDFC was promoted and the number of cells further increased. It was confirmed that in all concentration treatment groups of 500 nM, 5 ⁇ M and 50 ⁇ M, a better proliferation promoting effect than that of the positive control group appeared.
  • the peptides of the present invention have the effect of increasing the number of dermal papilla cells, and dermal papilla cells correspond to cells forming hair follicles that promote hair growth and prevent hair loss. It was confirmed that there was an improvement effect.
  • HHFDPC treated with the peptide of the present invention changes in related factors affecting cell proliferation or differentiation were confirmed, and it was confirmed whether the peptide of the present invention could promote proliferation and differentiation of HHFDPC by increasing them.
  • HHFDPC as in [Experimental Example 1-1] was seeded in a 6-well culture plate by 4 ⁇ 10 5 cells/well, cultured in MSC complete medium (mesenchymal stem cell complete media) for 24 hours, and then serum It was replaced with free MSC complete medium and cultured for another 24 hours.
  • MSC complete medium mesenchymal stem cell complete media
  • serum It was replaced with free MSC complete medium and cultured for another 24 hours.
  • the HHFDPC was treated with the peptide of SEQ ID NO: 1 prepared in Preparation Example at concentrations of 500 nM, 5 ⁇ M, and 50 ⁇ M, respectively, and incubated at 37° C. for 24 hours.
  • minoxidil was treated at a concentration of 1 ⁇ M and used, and as a negative control, HHFDPC without any treatment was used. Then, Western blotting was performed to detect phosphorylated AKT and phosphorylated ERK. After washing with PBS, 100 ⁇ l of lysis buffer was used to obtain a cell lysate, which was then electrophoresed using a 10% SDS-PAGE gel and transferred to a PVDF membrane to obtain a lysate of 5%. Blocking was performed at room temperature for 30 minutes using skim milk.
  • ERK antibody cell signaling, USA
  • ERK antibody cell signaling, USA
  • 0.1% PBS-T 0.1% Tween-20 in PBS
  • the secondary antibodies to the above antibodies were diluted 1:2000 in 5% skim milk and reacted at room temperature for 1 hour.
  • ECL solution GE Healthcare, USA
  • peptide of the present invention has an effect of promoting proliferation of dermal papilla cells and promoting hair growth by activating proliferation-related signals of dermal papilla cells constituting hair follicles.
  • the HHFDPC was treated with the peptide of SEQ ID NO: 1 prepared in Preparation Example at concentrations of 500 nM, 5 ⁇ M, and 50 ⁇ M, respectively, and incubated at 37° C. for 24 hours.
  • minoxidil was treated at a concentration of 1 ⁇ M and used, and as a negative control, HHFDPC without any treatment was used.
  • proteins in the nucleus were separated using a nuclear protein extraction kit (Thermo scientific, USA), electrophoresed using a 10% SDS-PAGE gel, and transferred to a PVDF membrane with a 5% skim. Blocking was performed at room temperature for 30 minutes using milk.
  • anti- ⁇ -catenin (cell signaling, USA) that can specifically bind to ⁇ -catenin was diluted 1:1000 in 3% BSA and left at 4° C. for 16 hours with the PVDF membrane. reacted Then, after washing with 0.1% PBS-T (0.1% Tween-20 in PBS) three times for 15 minutes, the secondary antibodies to the above antibodies were diluted 1:2000 in 5% skim milk and reacted at room temperature for 1 hour. made it After washing with 0.1% PBS-T (0.1% Tween-20 in PBS) three times for 15 minutes each, ⁇ -catenin was detected by treating with ECL solution (GE Healthcare, USA).
  • cDNA was synthesized using a cDNA synthesis kit (cDNA synthesis kit, enzynomics, Korea) by quantification by nano drop, and primers for LEF-1, c-Myc, and cyclin D1 (base sequences of the primers are shown in Table 2 below).
  • cDNA synthesis kit enzynomics, Korea
  • primers for LEF-1, c-Myc, and cyclin D1 base sequences of the primers are shown in Table 2 below.
  • PCR premix enzynomics, Korea
  • DKK-1 protein (dickkopf-related protein 1) is a hair loss-related protein known to be highly expressed in individuals with hair loss, especially male pattern baldness, and its expression is known to be promoted by hormones such as DHT (Dihydrotestosterone). . Therefore, after inducing the expression of DKK-1 protein by treating HHFDPC cells with DHT together with the peptide according to the preparation example of the present invention, the expression level of DKK-1 was measured through Western blotting to determine the expression of DKK-1 protein It was confirmed whether there was an inhibitory effect.
  • HHFDPC as in [Experimental Example 1-1] was seeded in a 6-well culture plate by 4 ⁇ 10 5 cells/well, cultured in MSC complete medium (mesenchymal stem cell complete media) for 24 hours, and then serum It was replaced with free MSC complete medium and cultured for another 24 hours.
  • MSC complete medium meenchymal stem cell complete media
  • serum It was replaced with free MSC complete medium and cultured for another 24 hours.
  • the HHFDPC was treated with the peptide of SEQ ID NO: 1 prepared in Preparation Example at concentrations of 500 nM, 5 ⁇ M and 50 ⁇ M, respectively, and at this time, DHT, an expression inducer of DKK-1 protein, was simultaneously treated at a concentration of 100 nM After treatment, it was incubated at 37° C. for 24 hours.
  • finasteride was treated at a concentration of 5 ⁇ M and used, and as a negative control, HHFDPC, which was treated with only DHT to induce expression of DKK-1 and not treated with the peptide, was used. Then, Western blotting was performed to detect DKK-1 protein, a protein related to hair loss. After washing with PBS, a cell lysate was obtained by treating the cell lysate with a lysis buffer, and then electrophoresed using a 10% SDS-PAGE gel and transferred to a PVDF membrane to obtain 5% skim milk. Blocking was performed at room temperature for 30 minutes.
  • an anti-DKK-1 antibody (cell signaling, USA) that can specifically bind thereto was diluted 1:1000 in 3% BSA and reacted with the PVDF membrane at 4° C. for 16 hours. made it Then, after washing with 0.1% PBS-T (0.1% Tween-20 in PBS) three times for 15 minutes, the secondary antibody to the anti-DKK-1 antibody was diluted 1:2000 in 5% skim milk at room temperature. It was reacted for 1 hour. After washing with 0.1% PBS-T (0.1% Tween-20 in PBS) three times for 15 minutes each, ECL solution (GE Healthcare, USA) was treated to detect DKK-1 protein.
  • ECL solution GE Healthcare, USA
  • the amount of DKK-1 protein was decreased in HHFDPC treated with the peptide of the present invention compared to the negative control group. That is, DHT treatment of dermal papilla cells increased the expression of hair loss-related proteins (negative control group), but when the peptide of the present invention was treated, the amount of DKK-1 protein increased by DHT treatment in HHFDPC decreased again, The increased expression of DKK-1 was again decreased depending on the concentration of the peptide of the present invention, confirming that the peptide of the present invention has an effect of suppressing hair loss.
  • peptide of the present invention consisting of the amino acid sequence of SEQ ID NO: 1 prepared according to the above Preparation Example, it was confirmed whether or not it promotes the activity of outer root sheath cells, a type of cells constituting hair follicles.
  • HHORSC human hair outer root sheath cell, Sciencell, USA
  • MSC complete medium meenchymal stem cell complete media
  • serum free MSC complete medium serum free MSC complete medium and cultured for another 24 hours.
  • the HHORSC was treated with the peptide of SEQ ID NO: 1 prepared in Preparation Example at concentrations of 500 nM, 5 ⁇ M, and 50 ⁇ M, respectively, and cultured at 37° C. for 72 hours.
  • EGF was treated at a concentration of 50 nM and used, and as a negative control, HHORSCs without any treatment were used.
  • Ha3-II Forward primer (5') GATCATCGAGCTGAGACGCA (3') 11 Ha3-II reverse primer (5') CTGGCCCCAGGGTATCTAGT (3') 12 Keratin 5 Forward primer (5') CCCTCAAGGATGCCAGGAAC (3') 13 Keratin 5 Reverse primer (5') CACTGCTACCTCCGGCAAG (3') 14 Keratin 14 Forward primer (5') CCAAATCCGCACCAAGGTCA (3') 15 Keratin 14 Reverse primer (5') GTATTGATTGCCAGGAGGG (3') 16 Keratin 19 Forward primer (5') CGCGGCGTATCCGTGTCCTC (3') 17 Keratin 19 Reverse primer (5') AGCCTGTTCCGTCTCAAACTTGGT (3')
  • mRNAs of Ha3-II, Keratin 5, Keratin 14, and Keratin 19 were detected in HHORSC treated with the peptide of the present invention, and the amount of mRNA was higher compared to the control group without any treatment. increased. Therefore, it was confirmed that the expression of the cytokines increased in the outer root sheath cells treated with the peptide of the present invention as their cellular activity increased, and the peptide of the present invention formed the hair follicle and helped the formation of hair. It was confirmed that there was an effect of increasing the activity.
  • peptide of the present invention consisting of the amino acid sequence of SEQ ID NO: 1 prepared according to the Preparation Example, it was confirmed whether the expression of transcription factors related to the activity of hair cells, a type of hair forming cells, was stimulated.
  • HHGMC human hair germinal matrix cell, Sciencell, USA
  • MSC complete medium meenchymal stem cell complete media
  • serum free MSC complete medium was replaced with serum free MSC complete medium and cultured for another 24 hours.
  • HHGMC was treated with the peptide of SEQ ID NO: 1 prepared in Preparation Example at concentrations of 500 nM, 5 ⁇ M, and 50 ⁇ M, respectively, and incubated at 37° C. for 72 hours.
  • EGF was treated at a concentration of 50 nM and used, and as a negative control, HHGMC without any treatment was used.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Dermatology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Birds (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Immunology (AREA)
  • Cosmetics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 발모를 촉진하고 탈모를 방지하는 활성이 있는 신규한 서열의 펩타이드에 관한 것으로, 상기 펩타이드는 모발의 형성과 관련된 세포의 증식 또는 활성을 촉진하거나 유도할 수 있는 활성이 있는바 상기 펩타이드를 포함하는 조성물은 탈모의 방지 또는 발모의 촉진 용도로 유용하게 이용될 수 있다.

Description

탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
본 발명은 탈모를 개선하거나 발모를 촉진할 수 있는 활성을 가지는 신규 펩타이드 및 이의 용도에 관한 것이다.
인체의 모발은 평균적으로 약 10만개 내지 15만개 정도이며 성장, 퇴행, 휴지를 반복하는 과정에서 모낭의 세포 분열 및 활동이 중단됨에 따라, 새롭게 자라나는 모발에 의해 기존의 모발은 밀려나 자연적으로 탈락된다. 이러한 자연적인 모발의 빠짐 현상은 하루 평균 약 100개 정도의 모발이 빠지며 나타나는데, 상기와 같은 자연적인 모발의 탈락보다 더 많은 양의 모발이 탈락되거나 정상적으로 모발이 존재해야 할 부위에 모발이 존재하지 않거나 자라지 않게 되는 경우 질환의 일종으로서 탈모가 나타나게 된다. 탈모는 자연적인 노화 과정에서 나타나기도 하지만, 호르몬의 변화, 스트레스, 대기오염, 가공 식품 등의 외부적인 환경 요인에 의해 발생하기도 한다.
탈모가 진행됨에 따라 모근에 존재하는 모유두가 작아지게 되고, 이에 따라 상기 모유두로부터 자라나는 모발의 굵기도 가늘어지며 성장, 퇴행, 휴지의 모주기 역시 짧아져 새롭게 자라나는 모발은 더욱 가늘어지게 된다. 이러한 현상이 반복됨에 따라 점점 더 가늘어진 모발은 솜털로 변하게 되고, 모주기는 점차 짧아져 모발이 얼마 자라지 못해 빠지게 되면서 전체적인 모발의 수가 감소하게 된다. 과거에는 나이 든 남성들에게서 주로 나타나는 현상이나 질환으로만 여겨졌으나, 탈모 환자의 절반 정도에 가까운 비율로 20대, 30대의 젊은 환자가 나타난다는 통계가 있으며 여성 환자의 수도 점차 증가하고 있다. 탈모는 외적인 측면에서의 큰 변화를 유발하므로 미용과 외모에 관심이 많은 젊은 층에서는 탈모를 치료하기 위해 이식 수술을 받거나 치료제를 복용하는 등 탈모 치료를 위한 비용이 점차 증가하고 있다.
그럼에도 여전히 탈모를 치료하기 위한 효과적인 치료제의 연구와 개발은 미흡한 실정이다. 대한민국 공개특허공보 제2020-0058932호에서는 도라지 추출물 등을 함유하는 탈모예방 및 탈모개선 조성물에 대해 개시하고, 대한민국 공개특허공보 제2017-0046528호에서는 각종 한약 추출물이 함유된 탈모개선 및 탈모방지용 복합조성물에 대해 개시하고 있으나, 다양한 성분이 함유되어 있을 수 있는 여러 종류의 천연물을 이용함에 따라 예상할 수 없는 부작용이 발생할 가능성이 있다는 문제점이 있으며, 특히 호르몬을 조절하는 치료제의 경우 성기능과 관련된 부작용을 초래하거나 여성에게는 적용이 불가능한 단점이 있다. 한편, 아미노산들이 연결되어 이루어지는 펩타이드 중에서 탈모 치료 효과가 있는 펩타이드를 개발하여 탈모 치료제로 이용하게 될 경우, 이는 생체친화성이 높으며 인체 내 다른 단백질의 활성부위를 모사하여 유사한 활성을 나타낼 가능성이 존재한다는 장점이 있다. 또한, 단일 펩타이드를 사용함에 따라, 다양한 성분이 함유된 추출물 등에 비해 작용 기전이 명확하고, 국소적으로 탈모 억제 작용을 한 이후 체내 분해 단백질에 의해 쉽게 분해되어 제거될 수 있으므로 기존 치료제와는 달리 부작용에 대한 우려가 적다. 따라서, 부작용은 적으면서 효과적으로 탈모를 방지하고 모발의 성장을 촉진할 수 있는 펩타이드 제제의 개발이 시급하다.
[선행기술문헌]
[특허문헌]
(특허문헌 1) 대한민국 공개특허공보 제2020-0058932호
(특허문헌 2) 대한민국 공개특허공보 제2017-0046528호
본 발명은 모발의 형성과 관련된 세포의 증식 또는 활성을 증가시키도록 유도하는 활성이 있어 발모를 촉진할 수 있는 펩타이드를 제공하는 것을 목적으로 한다.
또한, 본 발명은 상기와 같은 펩타이드를 이용하여 효과적으로 탈모를 예방, 치료, 개선하거나 발모를 촉진하기 위한 조성물을 제공하는 것을 목적으로 한다.
상기의 목적을 달성하기 위하여, 본 발명의 일 측면은 서열번호 1의 아미노산 서열을 포함하는, 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드를 제공한다.
본 발명의 다른 측면은 상기 펩타이드를 포함하는, 탈모 방지 또는 발모 촉진용 조성물을 제공한다.
본 발명의 다른 측면은 상기 펩타이드를 포함하는, 탈모의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명의 다른 측면은 상기 펩타이드를 포함하는, 탈모의 예방 또는 개선용 화장료 조성물을 제공한다.
이하, 본 발명을 상세히 설명한다.
1. 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드 및 이의 용도
본 발명의 일 측면은 탈모를 방지하거나 발모를 촉진하는 활성을 갖는 신규한 펩타이드를 제공한다.
본 발명에서 용어 "펩타이드"는 펩타이드 결합으로 연결된 2개 이상의 아미노산으로 이루어진 폴리머를 의미한다.
본 발명에서 용어 "탈모"는 정상적으로 모발이 존재해야 할 부위에 모발이 존재하지 않는 것을 의미하며, 정상적인 상태보다 모발의 수가 감소하는 현상을 포함한다. 상기 탈모는 모낭의 파괴 여부에 따라 비반흔성 탈모 또는 반흔성 탈모를 모두 포함하는 개념으로, 예를 들어, 유전성 안드로겐성 탈모, 원형 탈모, 곰팡이 감염에 의한 두부 백선, 휴지기 탈모, 발모벽, 모발생성 장애 질환이나, 루푸스에 의한 탈모, 독발성 모낭염, 모공성 편평 태선, 화상 및/또는 외상에 의한 탈모 등을 모두 포함한다.
상기 펩타이드는 서열번호 1의 아미노산 서열을 포함한다. 상기 펩타이드는 상기 펩타이드의 활성에 영향을 미치지 않는 범위 내에서, 아미노산 잔기의 결실, 삽입, 치환 또는 이들의 조합에 의해 상이한 서열을 가지는 변이체 펩타이드를 포함할 수 있으며, 또는 동일한 기능을 가지는 단백질 단편의 형태일 수 있다. 상기 서열번호 1의 아미노산 서열을 포함함에 따른 활성을 전체적으로 변경시키지 않는, 단백질 및 펩타이드 수준에서의 아미노산 변형은 본 발명의 기술분야에 공지되어 있으며, 경우에 따라서는 인산화 (phosphorylation), 황화(sulfation), 아크릴화(acrylation), 당화(glycosylation), 메틸화(methylation), 파네실화(farnesylation) 등으로 변형될 수 있다. 따라서, 상기 펩타이드는 서열번호 1의 아미노산 서열뿐만 아니라 이와 실질적으로 동일한 아미노산 서열을 갖는 펩타이드 또는 이의 변이체를 포함한다. 상기 실질적으로 동일한 아미노산 서열을 갖는 펩타이드는, 상기 서열번호 1의 아미노산 서열과 90% 이상, 91% 이상, 92% 이상, 93% 이상, 94% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 99% 이상, 또는 99.5% 이상의 상동성을 가지는 아미노산 서열을 포함하는 펩타이드일 수 있으나 이에 한정되지 않으며, 상기 서열번호 1의 아미노산 서열과 90% 이상의 아미노산 서열의 상동성을 가지는 서열을 포함하면서 동일한 활성을 가지는 펩타이드라면 본 발명의 범위에 포함된다.
본 발명의 펩타이드는 서열번호 1의 아미노산 서열을 포함하면서, 탈모 방지 또는 발모 촉진 활성을 나타내는 20개 이하의 아미노산으로 이루어지는 것일 수 있다. 구체적으로, 상기 펩타이드는 20개 이하, 18개 이하, 15개 이하 또는 12개의 아미노산으로 이루어지는 것일 수 있다.
또한, 본 발명의 상기 펩타이드는 당해 분야에서 널리 공지된 다양한 방법으로 획득할 수 있다. 일례로서, 폴리뉴클레오타이드 재조합과 단백질 발현 시스템을 이용하여 제조하거나 펩타이드 합성과 같은 화학적 합성을 통하여 시험관 내에서 합성하는 방법, 및 무세포 단백질 합성법 등으로 제조될 수 있으나, 이의 제조방법에 의해 한정되는 것은 아니다.
또한, 보다 나은 화학적 안정성, 강화된 약리 특성(반감기, 흡수성, 역가, 효능 등), 변경된 특이성(예를 들어, 광범위한 생물학적 활성 스펙트럼), 감소된 항원성을 획득하기 위하여, 펩타이드의 N-말단 또는 C-말단에 보호기가 결합되어 있을 수 있다. 예컨대, 상기 보호기는 아세틸기, 플루오레닐 메톡시 카르보닐기, 포르밀기, 팔미토일기, 미리스틸기, 스테아릴기 또는 폴리에틸렌글리콜(PEG)일 수 있으나, 펩타이드의 개질, 특히 펩타이드의 안정성 증진시킬 수 있는 성분이라면, 제한없이 포함할 수 있다. 상기 '안정성'은 생체 내 단백질 절단 효소의 공격으로부터 본 발명의 펩타이드를 보호하는 인 비보에서의 안정성뿐만 아니라, 저장안정성(예컨대, 상온 저장 안정성)도 의미한다.
본 발명의 펩타이드는 모발의 형성과 관련된 세포의 증식 또는 활성을 촉진시키는 것일 수 있다. 구체적으로, 상기 펩타이드는 모유두세포(dermal papilla cell), 외모근초세포(outer root sheath cell), 모모세포(germinal matrix cell) 등의 모발 형성 관련 세포의 증식을 촉진하여 이의 수를 증가시키도록 촉진하는 활성을 가지거나, 또는 상기 세포의 활성을 촉진함으로써 모발 형성을 유도하도록 하는 활성을 가질 수 있다.
또한, 본 발명의 펩타이드는 모발의 형성과 관련된 세포에서 탈모의 발생과 관련된 단백질의 발현을 억제하는 것일 수 있으며, 구체적으로, 모유두세포에서 DKK-1 단백질(dickkopf-related protein 1)의 발현을 억제하는 것일 수 있으며, 보다 구체적으로, DHT(dihydrotestosterone)과 같은 호르몬에 의해 DKK-1 단백질의 발현이 유도된 모유두세포에서 DKK-1 단백질의 발현을 억제하는 것일 수 있다.
본 발명의 펩타이드는 상기와 같은 활성을 가짐에 따라, 탈모를 방지하거나 발모를 촉진하기 위한 용도로 유용하게 이용될 수 있다.
이에 따라, 본 발명의 다른 일 측면은, 상기 펩타이드를 포함하는, 탈모 방지 또는 발모 촉진용 조성물을 제공한다.
상기 펩타이드는 상기 조성물 내에 0.01 μM 내지 100 μM의 농도로 포함될 수 있다. 구체적으로, 상기 펩타이드는 0.01 μM 내지 100 μM, 0.05 μM 내지 80 μM, 0.1 μM 내지 60 μM 또는 0.5 μM 내지 50 μM의 농도로 포함되는 것일 수 있으나, 이에 제한되는 것은 아니다. 본 발명의 조성물에 포함되는 펩타이드의 농도가 상기 범위일 경우, 펩타이드가 나타내는 활성에 의해 탈모 방지 및/또는 발모 촉진 효과가 충분히 나타나면서도, 생명체 또는 이의 세포에 독성을 나타내지 않는다는 장점이 있다.
상기 조성물은 모유두세포, 외모근초세포 및 모모세포로 이루어진 군으로부터 선택되는 하나 이상의 세포의 활성을 촉진시켜 모발의 형성을 유도하는 것일 수 있다.
상기 조성물은 모유두세포에서 AKT 및 ERK로 이루어진 군으로부터 선택되는 하나 이상의 인산화를 유도하는 것일 수 있다. 구체적으로, 상기 조성물은 모유두세포에서 p-AKT 및/또는 p-ERK의 양을 증가시킬 수 있으며 이에 따라 모유두세포의 증식과 관련된 신호전달 경로를 활성화 시킬 수 있다.
상기 조성물은 모유두세포에서 β-카테닌의 활성화를 유도하는 것일 수 있다. 구체적으로, 상기 조성물은 모유두세포에서 β-카테닌을 활성화시켜 핵으로의 이동을 유도할 수 있으며, 이에 따라 모유두세포의 세포 증식 및/또는 분화를 촉진하거나 유도할 수 있다.
상기 조성물은 모유두세포에서 LEF-1, c-Myc 및 사이클린 D1으로 이루어진 군으로부터 선택되는 하나 이상의 발현을 촉진하는 것일 수 있다. 구체적으로, 상기 조성물은 모유두세포에서 이의 세포 증식 및/또는 분화를 촉진하거나 유도함에 따라, 상기 LEF-1, c-Myc 및/또는 사이클린 D1의 발현을 촉진할 수 있다.
본 발명의 구체적인 실시예에서는, 본 발명의 상기 펩타이드가 포함된 조성물을 모유두세포 HHFDPC(human hair follicle dermal papilla cell)에 농도 별로 처리하여 흡광도를 측정한 결과, 대조군에 비해 흡광도가 더 크게 측정되었는바, HHFDPC의 증식을 촉진, 유도하는 효과가 있음을 확인하였다. 또한, 상기 HHFDPC에서는 이의 증식이나 활성화와 관련된 인자인, p-AKT 및 p-ERK가 증가되고 β-카테닌이 활성화되어 핵으로의 이동이 증가되며 이에 따른 LEF-1, c-Myc 및 사이클린 D1의 발현이 증가되었다. 따라서, 본 발명의 펩타이드 및 이를 포함하는 조성물은 모낭을 이루는 세포인 모유두세포의 증식과 활성을 촉진, 유도함에 따라 발모를 촉진하거나 탈모를 방지할 수 있는 효과가 우수함을 확인할 수 있었다.
상기 조성물은 모유두세포에서 DKK-1 단백질의 발현을 억제하는 것일 수 있다. 구체적으로, DHT(dihydrotestosterone)과 같은 호르몬에 의해 DKK-1 단백질의 발현이 유도된 모유두세포에서 DKK-1 단백질의 발현을 억제하는 것일 수 있다.
본 발명의 구체적인 실시예에서는, 본 발명의 상기 펩타이드가 포함된 조성물을 DHT를 처리하여 DKK-1 단백질의 발현을 유도시킨 모유두세포 HHFDPC에 농도 별로 처리하여 DKK-1 단백질을 웨스턴 블랏팅을 통해 확인한 결과, 음성대조군에 비해 DKK-1 단백질의 양이 감소되는 것을 확인하였는바, 본 발명의 펩타이드 및 이를 포함하는 조성물은 모유두세포에서 탈모 관련 단백질의 발현을 억제하는 효과가 있으며 탈모를 방지하기 위해 유용하게 이용될 수 있음을 확인할 수 있었다.
상기 조성물은 외모근초세포에서 Ha3-II, Keratin 5, Keratin 14 및 Keratin 19로 이루어진 군으로부터 선택되는 하나 이상의 발현을 촉진하는 것일 수 있다. 구체적으로, 상기 조성물은 외모근초세포의 세포 활성을 증가시켜 상기 Ha3-II, Keratin 5, Keratin 14 및/또는 Keratin 19의 발현을 촉진하는 것일 수 있다.
본 발명의 구체적인 실시예에서는, 본 발명의 상기 펩타이드가 포함된 조성물을 외모근초세포 HHORSC에 농도 별로 처리하여 Ha3-II, Keratin 5, Keratin 14 및 Keratin 19의 발현을 RT-PCR을 통해 확인한 결과, 대조군에 비해 발현량이 증가되는 것을 확인하였는바, 본 발명의 펩타이드 및 이를 포함하는 조성물은 모낭을 이루는 세포의 일종인 외모근초세포의 활성을 증가시키는 효과가 있으며 이에 따라 탈모를 방지하거나 발모를 촉진하는 효과가 있음을 확인할 수 있었다.
상기 조성물은 모모세포에서 MSX2 및 FOXN1로 이루어진 군으로부터 선택되는 적어도 하나의 발현을 촉진하는 것일 수 있다. 구체적으로, 상기 조성물은 모모세포의 세포 활성에 관련된 전사 인자인 MSX2 및/또는 FOXN1의 발현을 촉진하여 모모세포의 활성 관련 유전자들의 발현을 유도하는 것일 수 있다.
본 발명의 구체적인 실시예에서는, 본 발명의 상기 펩타이드가 포함된 조성물을 모모세포 HHGMC에 농도 별로 처리하여 MSX2 및 FOXN1의 발현을 RT-PCR을 통해 확인한 결과, 대조군에 비해 발현량이 증가되는 것을 확인하였는바, 본 발명의 펩타이드 및 이를 포함하는 조성물은 모발을 형성하는 세포의 일종인 모모세포의 활성을 증가시키는 효과가 있으며 이에 따라 탈모를 방지하거나 발모를 촉진하는 효과가 있음을 확인할 수 있었다.
2. 탈모의 예방 또는 치료용 약학적 조성물
본 발명의 또 다른 측면은 상기 펩타이드를 포함하는 탈모의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 펩타이드는 서열번호 1의 아미노산 서열을 포함하는 것이며, 이에 관한 설명은 '탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드 및 이의 용도' 항목에서 설명한 펩타이드와 동일한바, 구체적인 설명은 이를 원용한다. 이하에서는 약학적 조성물에 특유한 구성에 대해서만 설명하도록 한다.
본 발명에서 용어 "예방"은 질환 또는 장애에 걸릴 위험을 감소시키는 것을 의미하며, 질환에 노출되거나 질환에 걸리기는 쉽지만 아직 질환에 걸리거나 질환의 증후를 나타내지 않는 대상에서 질병의 1종 이상의 임상적 증후가 진행되지 않도록 하여 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미한다.
본 발명에서 용어 "치료"는 질환 또는 장애를 경감시키는 것을 의미하며, 질환 또는 이의 1종 이상의 임상적 증후의 진행을 저지 또는 감소시켜 질환의 증세를 호전시키거나 이롭게 변경하는 모든 행위를 포함한다.
본 발명의 약학적 조성물에서 상기 펩타이드는 치료학적 유효량(therapeutically effective amount)으로 포함될 수 있으며, 약학적으로 허용되는 담체를 더 포함할 수 있다. 상기 용어 "치료학적 유효량"은 본 조성물의 목적인 탈모의 예방 또는 치료를 달성하기에 충분한 양을 의미한다.
본 발명에서 탈모는 정상적으로 모발이 존재해야 할 부위에 모발이 존재하지 않는 것을 의미하며, 정상적인 상태보다 모발의 수가 감소하는 현상을 포함한다. 상기 탈모는 모낭의 파괴 여부에 따라 비반흔성 탈모 또는 반흔성 탈모를 모두 포함하는 개념으로, 예를 들어, 유전성 안드로겐성 탈모, 원형 탈모, 곰팡이 감염에 의한 두부 백선, 휴지기 탈모, 발모벽, 모발생성 장애 질환이나, 루푸스에 의한 탈모, 독발성 모낭염, 모공성 편평 태선, 화상 및/또는 외상에 의한 탈모 등을 모두 포함한다.
상기 탈모의 예방 또는 치료는 상기와 같은 탈모의 원인을 제거하거나 탈모의 진행을 억제하는 것일 수 있고, 모발의 탈락을 억제하거나 모발의 형성을 촉진하여 발모를 촉진하는 것일 수 있다.
한편, 본 발명의 상기 약학적 조성물은 본 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라, 약학적으로 허용되는 담체 및/또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기내에 내입시켜 제조될 수 있다. 이때, 제형은 오일 또는 수성 매질중의 용액, 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제, 캅셀제 또는 젤(예컨대, 하이드로젤) 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다.
또한, 상기 약학적 조성물이 포함하는 상기 펩타이드는 콜로이드 현탁액, 분말, 식염수, 지질, 리포좀, 미소구체(microspheres), 또는 나노 구형입자와 같은 약학적으로 허용될 수 있는 담체에 운반될 수 있다. 이들은 운반 수단과 복합체를 형성하거나 관련될 수 있고, 지질, 리포좀, 미세입자, 금, 나노입자, 폴리머, 축합 반응제, 다당류, 폴리아미노산, 덴드리머, 사포닌, 흡착 증진 물질 또는 지방산과 같은 당업계에 공지된 운반 시스템을 사용하여 생체 내 운반될 수 있다.
이 외에도, 약학적으로 허용되는 담체는 제제시 통상적으로 이용되는 락토스, 덱스트로스, 수크로스, 솔비톨, 만니톨, 전분, 아카시아, 고무, 인산칼슘, 알기네이트, 젤라틴, 규산 칼슘, 미세 결정성 셀룰로스, 폴리비닐 피로리돈, 셀룰로스, 물, 시럽, 메틸 셀룰로스, 메틸히드록시벤조에이트, 프로필 히드록시벤조에이트, 활석, 스테아르산 마그네슘 및 미네랄 오일 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 또한, 상기 성분들 이외에 윤활제, 습윤제, 감미제, 향미제, 유화제, 현탁제, 보존제 등을 추가로 포함할 수 있다.
본 발명에 따른 약학적 조성물은 임상 투여시에 경구 또는 비경구로 투여가 가능하며 일반적인 의약품 제제의 형태로 사용될 수 있다. 즉, 본 발명의 약학적 조성물은 실제 임상 투여시에 경구 및 비경구의 여러 가지 제형으로 투여될 수 있는데, 제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다. 경구 투여를 위한 고형 제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형 제제는 생약 추출물 또는 생약 발효물에 적어도 하나 이상의 부형제, 예를 들면, 전분, 탄산칼슘, 수크로스 또는 락토오스, 젤라틴 등을 섞어 조제된다. 또한, 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다. 경구 투여를 위한 액상 제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순 희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁용제로는 프로필렌글리콜, 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔, 마크로골, 트윈 61, 카카오지, 라우린지, 글리세롤, 젤라틴 등이 사용될 수 있다.
상기 펩타이드의 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중, 성, 병적 상태, 음식, 투여 시간, 투여 경로, 배설 속도 및 반응 감응성과 같은 요인들에 의해 다양화될 수 있지만, 일반적으로 성인 환자 체중 1 kg 당 1 내지 20 ㎎/일이고, 바람직하게는 5 내지 10 ㎎/일이며, 의사 또는 약사의 판단에 따라 일정 시간 간격으로 1 일 수회, 바람직하게는 하루 2 회 내지 3 회 분할 투여될 수 있다.
본 발명의 상기 약학적 조성물은 피부외용제일 수 있다. 상기 피부외용제는 피부의 외부에 도포되어 이용될 수 있는 형태의 제제로, 본 발명의 약학적 조성물이 피부외용제로 이용될 경우 이는 두피, 구체적으로 탈모가 발생한 부위의 두피나 발모를 촉진하고자 하는 부위의 두피에 적용되는 것일 수 있다. 상기 피부외용제는 크림, 겔, 연고, 피부 유화제, 피부 현탁액, 경피전달성 패치, 약물 함유 붕대, 로션, 또는 그 조합일 수 있고. 상기 피부외용제는 통상 화장품이나 의약품 등의 피부외용제에 사용되는 성분, 예를 들어 수성성분, 유성성분, 분말성분, 알코올류, 보습제, 중점제, 자외선흡수제, 미백제, 방부제, 산화방지제, 계면활성제, 향료, 색제, 각종 피부 영양제, 또는 이들의 조합과 필요에 따라서 적절하게 배합될 수 있다. 상기 피부외용제는, 에데트산이나트륨, 에데트산삼나트륨, 시트르산나트륨, 폴리인산나트륨, 메타인산나트륨, 글루콘산 등의 금속봉쇄제, 카페인, 탄닌, 벨라파밀, 감초추출물, 글라블리딘, 칼린의 과실의 열수추출물, 각종 생약, 아세트산토코페롤, 글리틸리틴산, 트라넥삼산 및 그 유도체 또는 그 염등의 약제, 비타민 C, 아스코르브산 인산 마그네슘, 아스코르브산글루코시드, 알부틴, 코지산, 글루코스, 프룩토스, 트레할로스 등의 당류 등도 적절하게 배합할 수 있다.
3. 탈모의 예방 또는 개선용 화장료 조성물
본 발명의 또 다른 측면은 상기 펩타이드를 포함하는 탈모의 예방 또는 개선용 화장료 조성물을 제공한다.
상기 펩타이드는 서열번호 1의 아미노산 서열을 포함하는 것이며, 이에 관한 설명은 '탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드 및 이의 용도' 항목에서 설명한 펩타이드와 동일한 바, 구체적인 설명은 이를 원용한다. 이하에서는 화장료 조성물에 특유한 구성에 대해서만 설명하도록 한다.
본 발명에서 용어 "개선"은 질환 또는 장애의 증세가 호전되도록 하거나 이롭게 되도록 하는 모든 행위를 의미한다.
상기 탈모의 예방 또는 개선은 탈모의 원인을 제거하거나 탈모의 진행을 억제하는 것일 수 있고, 모발의 탈락을 억제하거나 모발의 형성을 촉진하여 발모를 촉진하는 것일 수 있다.
상기 화장료 조성물은 상기 펩타이드의 화장품학적 유효량(cosmetically effective amount) 및 화장품학적으로 허용되는 담체를 포함할 수 있으며, 상기 화장품학적 유효량이란 전술한 탈모 방지 또는 발모 촉진 효능을 달성하는 데 충분한 양을 의미한다.
본 발명의 상기 화장료 조성물은 상기 펩타이드의 탈모 방지 또는 발모 촉진 활성에 영향을 미치지 않는 범위 내에서, 예컨대 상기 펩타이드의 활성에 상승 효과를 줄 수 있는 특징이 있는 다른 성분을 추가로 함유할 수 있다. 예를 들어, 지방 물질, 유기 용매, 용해제, 농축제 및 겔화제, 연화제, 항산화제, 현탁화제, 안정화제, 발포제(foaming agent), 방향제, 계면활성제, 물, 이온형 또는 비이온형 유화제, 충전제, 금속이온 봉쇄제 및 킬레이트화제, 보존제, 비타민, 차단제, 습윤화제, 필수 오일, 염료, 안료, 향료, 친수성 또는 친유성 활성제, 지질 소낭 또는 화장품에 통상적으로 사용되는 임의의 다른 성분 등과 같이 화장품이나 피부 과학 분야에서 통상적으로 사용되는 보조제를 함유할 수 있으며, 상기 성분들은 화장품이나 피부 과학 분야에서 일반적으로 사용되는 양으로 함유될 수 있다.
본 발명의 상기 화장료 조성물은 당업계에서 통상적으로 제조되는 어떠한 제형으로도 제조될 수 있으며, 예를 들어, 용액, 현탁액, 유탁액, 겔, 로션, 에센스, 크림, 파우더, 비누, 샴푸, 린스, 팩마스크, 계면활성제-함유 클렌징, 클렌징 폼, 클렌징 워터, 오일, 리퀴드 파운데이션, 크림 파운데이션 또는 스프레이 등의 화장료로 제형화 될 수 있다.
상기 제형이 용액 또는 유탁액인 경우에는 담체 성분으로 용매, 용해화제 또는 유탁화제가 이용될 수 있고, 예컨대 물, 에탄올, 이소프로판올, 에틸카보네이트, 에틸 아세테이트, 벤질 알코올, 벤질 벤조에이트, 프로필렌 글리콜, 1,3-부틸글리콜 오일, 글리세롤 지방족 에스테르, 폴리에틸렌 글리콜 또는 소르비탄의 지방산 에스테르가 이용될 수 있다. 상기 제형이 현탁액인 경우에는 담체 성분으로 물, 에탄올 또는 프로필렌 글리콜과 같은 액상의 희석제, 에톡실화이소스테아릴 알코올, 폴리옥시에틸렌 소르비톨 에스테르 및 폴리옥시에틸렌 소르비탄 에스테르와 같은 현탁제, 알루미늄 메타히드록시드, 미소결정성 셀룰로오스, 벤토나이트, 아가 또는 트라칸트 등이 이용될 수 있다. 상기 제형이 크림 또는 겔인 경우에는 담체 성분으로서 왁스, 파라핀, 트라칸트, 동물성유, 전분, 셀룰로오스 유도체, 실리콘, 벤토나이트, 폴리에틸렌 글리콜, 실리카, 산화아연 또는 탈크 등이 이용될 수 있다. 상기 제형이 파우더 또는 스프레이인 경우에는 담체 성분으로서 실리카, 탈크, 알루미늄 히드록시기, 락토스, 칼슘 실리케이트, 클로로플루오로히드로카본, 프로판/부탄 또는 디메틸 에테르와 같은 추진체를 포함할 수 있다. 상기 제형이 계면활성제-함유 클렌징인 경우에는 담체 성분으로서 지방족 알코올 설페이트, 지방족 알코올 에테르설페이트, 설포숙신산 모노에스테르, 이미다졸리늄 유도체, 이세티오네이트, 메틸타우레이트, 사르코시네이트, 지방산 아미드 에테르 설페이트, 지방족 알코올, 알킬아미도베타인, 지방산 글리세리드, 지방산 디에탄올아미드, 식물성 유, 라놀린유도체 또는 에톡실화 글리세롤 지방산 에스테르 등이 이용될 수 있다.
구체적으로, 본 발명의 상기 화장료 조성물은 피부외용제일 수 있다. 상기 피부외용제는 피부의 외부에 도포되어 이용될 수 있는 형태의 제제로, 본 발명의 화장료 조성물이 피부외용제로 이용될 경우 이는 두피, 구체적으로 탈모가 발생한 부위의 두피나 발모를 촉진하고자 하는 부위의 두피에 적용되는 것일 수 있다. 상기 피부외용제는 크림, 겔, 연고, 피부 유화제, 피부 현탁액, 경피전달성 패치, 약물 함유 붕대, 로션, 또는 그 조합일 수 있고. 상기 피부외용제는 통상 화장품이나 의약품 등의 피부외용제에 사용되는 성분, 예를 들어 수성성분, 유성성분, 분말성분, 알코올류, 보습제, 중점제, 자외선흡수제, 미백제, 방부제, 산화방지제, 계면활성제, 향료, 색제, 각종 피부 영양제, 또는 이들의 조합과 필요에 따라서 적절하게 배합될 수 있다. 상기 피부외용제는, 에데트산이나트륨, 에데트산삼나트륨, 시트르산나트륨, 폴리인산나트륨, 메타인산나트륨, 글루콘산 등의 금속봉쇄제, 카페인, 탄닌, 벨라파밀, 감초추출물, 글라블리딘, 칼린의 과실의 열수추출물, 각종 생약, 아세트산토코페롤, 글리틸리틴산, 트라넥삼산 및 그 유도체 또는 그 염등의 약제, 비타민 C, 아스코르브산 인산 마그네슘, 아스코르브산글루코시드, 알부틴, 코지산, 글루코스, 프룩토스, 트레할로스 등의 당류 등도 적절하게 배합할 수 있다.
본 발명의 다른 측면에서 상기 펩타이드의 치료학적 유효량을 탈모증의 치료가 필요한 대상체(subject)에 투여하는 단계를 포함하는 탈모의 치료 방법을 제공한다.
본 발명의 다른 측면에서 상기 펩타이드의 화장품학적 유효량을 탈모증의 개선이 필요한 대상체(subject)에게 투여하는 단계를 포함하는 탈모의 개선 방법을 제공한다.
본 발명의 다른 측면에서, 상기 펩타이드의 탈모증의 치료를 위한 용도를 제공한다.
본 발명의 다른 측면에서, 상기 펩타이드의 탈모증 치료 또는 예방용 의약의 제조에서의 용도를 제공한다.
본 발명에서 제공하는 펩타이드는 모유두세포, 외모근초세포, 모모세포와 같이 모낭을 이루거나 모발의 형성에 관련된 세포의 증식을 촉진하거나 이들 세포의 활성을 촉진하는 활성이 있다.
구체적으로, 본 발명의 펩타이드는 상기 세포들의 증식, 분화, 활성화에 관련된 유전자 또는 단백질의 발현량을 증가시킬 수 있으며, DHT와 같은 호르몬에 의해 유도되는 탈모 관련 단백질의 발현을 억제시키는 활성이 있는바, 상기 펩타이드 및 이를 포함하는 조성물은 탈모를 예방, 치료 또는 개선하거나 발모를 촉진하기 위한 용도로 유용하게 이용될 수 있다.
또한, 본 발명의 펩타이드 및 이를 포함하는 조성물은, 단일의 펩타이드를 유효성분으로 사용하고 있으므로, 다양한 성분이 포함될 수 있어 예상할 수 없는 효과를 나타낼 수 있는 천연물을 이용한 탈모 개선제와 비교할 때, 국소적으로 탈모 억제 효과를 나타낸 다음 체내 단백질 분해 효소에 의해 어렵지 않게 분해되어 제거될 수 있으며 작용 기전이 보다 명확하기 때문에 부작용의 발생 가능성이 적거나 없다는 장점이 있다. 또한, 펩타이드를 유효성분으로 하는 본 발명의 조성물은, 아미노산의 결합으로 이루어진 물질을 유효성분으로 한다는 점에서 기존의 치료제에 비해 생체친화성이 높고, 상기 펩타이드가 인체 내 단백질의 활성부위를 모사함으로써 유사한 활성을 나타낼 가능성이 있는 장점이 존재하며, 호르몬의 조절에 따른 성기능의 저하 등의 문제점도 적다는 효과가 있다.
다만, 본 발명의 효과는 상기에서 언급한 효과로 제한되지 아니하며, 언급되지 않은 또 다른 효과들은 하기의 기재로부터 당업자에게 명확히 이해될 수 있을 것이다.
도 1은 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 HHFDPC에 농도 별로 처리한 후 세포의 증식 여부를 확인하여, 아무런 처리를 하지 않은 대조군(Con)과 미녹시딜을 처리한 양성대조군(MNX)의 수치와 비교하여 나타낸 그래프이다.
도 2는 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 HHFDPC에 농도 별로 처리하거나, 아무런 처리를 하지 않은 대조군(Con), 미녹시딜을 처리한 양성대조군(MNX)에서, 인산화된 AKT 및 ERK(각각 p-AKT, p-ERK)를 웨스턴 블랏팅을 통해 확인한 결과이다.
도 3은 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 HHFDPC에 농도 별로 처리하거나, 아무런 처리를 하지 않은 대조군(Con)에서, 핵으로 이동한 β-카테닌을 웨스턴 블랏팅을 통해 확인한 결과이다.
도 4는 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 HHFDPC에 농도 별로 처리하거나, 아무런 처리를 하지 않은 대조군(Con)에서, LEF-1, c-Myc 및 사이클린 D1의 발현을 RT-PCR을 통해 확인한 결과이다.
도 5는 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 DHT 처리된 HHFDPC에 농도 별로 처리하거나, 아무런 처리를 하지 않은 대조군(Con), 피나스테리드를 처리한 양성대조군(Finasteride)에서, DKK-1 단백질을 웨스턴 블랏팅을 통해 확인한 결과이다.
도 6은 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 HHORSC에 농도 별로 처리하거나, 아무런 처리를 하지 않은 대조군(Con), EGF를 처리한 양성대조군에서, Ha3-II, Keratin 5, Keratin 14 및 Keratin 19의 발현을 RT-PCR을 통해 확인한 결과이다.
도 7은 본 발명의 서열번호 1의 아미노산 서열을 포함하는 펩타이드를 HHGMC에 농도 별로 처리하거나, 아무런 처리를 하지 않은 대조군(Con), EGF를 처리한 양성대조군에서, MSX2 및 FOXN1의 발현을 RT-PCR을 통해 확인한 결과이다.
이하, 본 발명을 실시예에 의하여 상세히 설명한다.
단, 하기 실시예는 본 발명을 구체적으로 예시하는 것이며, 본 발명의 내용이 하기 실시예에 의해 한정되지 아니한다.
실시예
[제조예] 펩타이드의 제작
자동 펩타이드 합성기(Milligen 9050, Millipore, 미국)를 이용하여 하기의 표 1에 기재된 서열번호 1의 아미노산 서열을 갖는 펩타이드를 합성하고, C18 역상 고성능액체크로마토그래피(HPLC)(Waters Associates, 미국)를 이용하여 이들 합성된 펩타이드를 순수 분리하였다. 컬럼은 ACQUITY UPLC BEH300 C18 (2.1 ㎜ Х 100 ㎜, 1.7㎛, Waters Co, 미국)을 이용하였다.
서열번호 펩타이드 서열
1 HLPKPI
[실험예 1] 본 발명 펩타이드의 모유두세포 증식 및 활성 촉진 효과 확인
상기 제조예에 따라 제조된 서열번호 1의 아미노산 서열로 이루어진 본 발명의 펩타이드를 이용하여, 모낭을 이루는 세포 중 하나인 모유두세포에 대한 증식 촉진 효과와 활성 촉진 효과를 확인하였으며, 탈모 관련 단백질의 억제 효과를 확인하였다.
[1-1] 모유두세포의 증식 촉진 효과 확인
HHFDPC(human hair follicle dermal papilla cell)를 배양하면서, 본 발명의 펩타이드를 처리한 후 흡광도를 측정함으로써 상기 HHFDPC 모유두세포의 증식을 촉진하는 효과가 있는지 여부를 확인하였다.
구체적으로, HHFDPC(Sciencell, USA)를 4Х103 cells/well만큼 96-웰 배양 플레이트에 시딩한 후 MSC 완전배지(mesenchymal stem cell complete media, Sciencell, USA)에서 24시간 동안 배양한 다음, 이를 serum free MSC 완전배지로 교환하여 다시 24시간 배양하였다. 그리고, 상기 HHFDPC에 상기 제조예에서 제조한 서열번호 1의 펩타이드를 각각 500 nM, 5 μM 및 50 μM의 농도로 처리하여 37℃ 에서 72시간 동안 배양하였다. 양성 대조군으로는 미녹시딜(minoxidil)을 1 μM의 농도로 처리하여 사용하였고 음성 대조군으로는 아무런 처리를 하지 않은 HHFDPC를 사용하였다. 그런 다음 5 ㎎/㎖의 MTT 용액을 10 ㎕만큼 넣고 37℃ CO2 인큐베이터에서 4시간 동안 배양하여 세포를 염색하였다. 배지를 제거한 다음 DMSO를 100 ㎕ 처리하여 10분 동안 흔들어 준 후 분광광도계(spectrophotometer)를 이용해 540 ㎚의 파장에서 흡광도를 측정함으로써 HHFDPC 세포의 수를 확인하였다.
그 결과, 도 1에서 확인할 수 있듯이 본 발명의 펩타이드를 처리한 군에서는 아무런 처리를 하지 않은 대조군과 비교할 때 흡광도가 더 높게 측정되어 HHDFC의 증식이 촉진되어 세포 수가 더 증가한 것을 확인할 수 있었으며, 상기 펩타이드는 500 nM, 5 μM 및 50 μM의 모든 농도 처리군에서 양성 대조군에서보다 더 우수한 증식 촉진 효과가 나타남을 확인할 수 있었다. 상기와 같은 결과를 통해, 본 발명의 펩타이드는 모유두세포의 수를 증가시키도록 하는 효과가 있음을 확인할 수 있었으며, 모유두세포는 털을 만드는 모낭을 이루는 세포에 해당하는바, 발모를 촉진하고 탈모를 개선하는 효과가 있음을 확인할 수 있었다.
[1-2] 모유두세포의 증식 관련 인자의 증가 효과 확인
본 발명의 펩타이드가 처리된 HHFDPC에서, 세포의 증식 또는 분화에 영향을 주는 관련 인자들의 변화를 확인하여, 본 발명 펩타이드가 이들을 증가시켜 HHFDPC의 증식과 분화를 촉진할 수 있는지 여부를 확인하였다.
먼저, HHFDPC의 증식과 관련된 신호 분자로 작용하는 인산화된 형태의 AKT 및 ERK를 웨스턴 블랏팅을 통해 확인하였다. 구체적으로, 상기 [실험예 1-1]과 같은 HHFDPC를 4Х105 cells/well만큼 6-웰 배양 플레이트에 시딩한 후 MSC 완전배지(mesenchymal stem cell complete media)에서 24시간 동안 배양한 다음, 이를 serum free MSC 완전배지로 교환하여 다시 24시간 배양하였다. 그리고, 상기 HHFDPC에 상기 제조예에서 제조한 서열번호 1의 펩타이드를 각각 500 nM, 5 μM 및 50 μM의 농도로 처리하여 37℃ 에서 24시간 동안 배양하였다. 양성 대조군으로는 미녹시딜(minoxidil)을 1μM의 농도로 처리하여 사용하였고 음성 대조군으로는 아무런 처리를 하지 않은 HHFDPC를 사용하였다. 그런 다음 인산화된 AKT 및 인산화된 ERK를 검출하기 위하여 웨스턴 블랏팅을 수행하였다. PBS로 씻어낸 후 세포를 파괴하기 위한 완충용액(lysis buffer)를 100 ㎕를 처리하여 세포 파쇄물(cell lysate)를 얻은 다음, 10% SDS-PAGE 겔을 이용해 전기영동 후 PVDF 막으로 옮겨 5%의 skim milk를 이용해 30분 동안 실온에서 blocking 시켰다. 그리고, 인산화된 AKT(p-AKT) 및 인산화된 ERK(p-ERK)를 검출하기 위하여 상기 p-AKT 및 p-ERK에 대해 각각 특이적으로 결합가능한 항-p-AKT 항체 및 항-p-ERK 항체(cell signaling, USA)를 1:1000으로 3% BSA에 희석하여 4℃에서 상기 PVDF 막과 16시간 동안 반응시켰다. 그 후, 0.1% PBS-T(0.1% Tween-20 in PBS)로 15분씩 3회 워시 후 상기 항체들에 대한 2차 항체를 1:2000으로 5% skim milk에 희석하여 상온에서 1시간 반응시켰다. 다시 0.1% PBS-T(0.1% Tween-20 in PBS)로 15분씩 3회 워시 후 ECL 용액(GE Healthcare, USA)을 처리해 p-AKT 및 p-ERK를 검출하였다.
그 결과, 도 2에서 확인할 수 있듯이, 본 발명의 펩타이드를 처리한 HHFDPC에서는 이의 증식과 관련된 신호 분자인 p-AKT와 p-ERK가 검출되었고 펩타이드를 처리하지 않은 대조군과 비교할 때 상기와 같은 인산화가 증가한 것으로 나타났다. 상기와 같은 결과로 볼 때, 본 발명의 펩타이드는 모낭을 이루는 모유두세포의 증식 관련 신호를 활성화시켜 모유두세포의 증식을 촉진하고, 발모를 촉진하는 효과가 있음을 확인할 수 있었다.
또한, 상기 p-AKT 및 p-ERK 이외에, 세포 증식과 분화에 영향을 주는 것으로 알려진 β-카테닌(β-catenin)의 활성화 여부를 확인하기 위하여, β-카테닌이 핵 내로 이동하였는지 여부를 웨스턴 블랏팅을 통해 확인하였다. 구체적으로, 상기 [실험예 1-1]과 같은 HHFDPC를 4Х105 cells/well만큼 6-웰 배양 플레이트에 시딩한 후 MSC 완전배지(mesenchymal stem cell complete media)에서 24시간 동안 배양한 다음, 이를 serum free MSC 완전배지로 교환하여 다시 24시간 배양하였다. 그리고, 상기 HHFDPC에 상기 제조예에서 제조한 서열번호 1의 펩타이드를 각각 500 nM, 5 μM 및 50 μM의 농도로 처리하여 37℃ 에서 24시간 동안 배양하였다. 양성 대조군으로는 미녹시딜(minoxidil)을 1 μM의 농도로 처리하여 사용하였고 음성 대조군으로는 아무런 처리를 하지 않은 HHFDPC를 사용하였다. 그리고 PBS로 세척한 후 핵 단백질 추출 키트(nuclear protein extraction kit, Thermo scientific, USA)를 이용해 핵 내 단백질을 분리한 다음, 10% SDS-PAGE 겔을 이용해 전기영동 후 PVDF 막으로 옮겨 5%의 skim milk를 이용해 30분 동안 실온에서 blocking 시켰다. β-카테닌을 검출하기 위하여 상기 β-카테닌에 대해 특이적으로 결합가능한 항-β-카테닌(cell signaling, USA)를 1:1000으로 3% BSA에 희석하여 4℃에서 상기 PVDF 막과 16시간 동안 반응시켰다. 그 후, 0.1% PBS-T(0.1% Tween-20 in PBS)로 15분씩 3회 세척한 후 상기 항체들에 대한 2차 항체를 1:2000으로 5% skim milk에 희석하여 상온에서 1시간 반응시켰다. 다시 0.1% PBS-T(0.1% Tween-20 in PBS)로 15분씩 3회 세척한 후 ECL 용액(GE Healthcare, USA)을 처리해 β-카테닌을 검출하였다.
그 결과, 도 3에서 확인할 수 있듯이, 본 발명의 펩타이드를 처리한 HHFDPC의 핵 내에는 β-카테닌이 이동되어 존재하는 것으로 나타났고, 펩타이드를 처리하지 않은 대조군과 비교할 때 β-카테닌의 활성화에 따른 이동이 증가하였고 본 발명 펩타이드의 농도에 따라 β-카테닌의 활성화가 더욱 촉진되었음을 확인할 수 있었다.
나아가, 상기 β-카테닌이 핵으로 이동하여 활성화되어 증식 미치 분화에 영향을 주는지 여부를 확인하기 위하여, β-카테닌 활성화에 따른 하위 인자로 작용하는 LEF-1, c-Myc 및 사이클린 D1(cyclin D1)의 발현이 증가하는지 여부를 RT-PCR을 통해 확인하였다. 구체적으로, 앞선 웨스턴 블랏팅 실험과 동일한 방법으로 HHFDPC 세포를 배양하여 본 발명 제조예의 펩타이드를 각각 500 nM, 5 μM 및 50 μM의 농도로 처리하여 37℃에서 24시간 동안 배양한 다음, PBS 워시 후 easy blue(intron, 한국)를 300 ㎕ 처리하여 RNA를 분리하였다. 그런 다음, nano drop으로 정량하여 cDNA 합성 키트(cDNA synthesis kit, enzynomics, 한국)을 이용하여 cDNA를 합성하였으며, LEF-1, c-Myc 및 사이클린 D1에 대한 프라이머(프라이머의 염기서열은 하기 표 2에 나타내었다) 와 PCR premix(enzynomics, 한국)을 이용해 PCR을 수행하였다. 1.5%의 아가로즈 겔에서 전기영동을 수행한 다음, 밴드 분석 시스템(Bio-Rad gel image system)을 통해 LEF-1, c-Myc 및 사이클린 D1의 mRNA를 검출하였다.
서열번호 서열이름 염기서열
2 LEF-1 Forward primer (5') CCAGCTATTGTAACACCTCA (3')
3 LEF-1 Reverse primer (5') TTCAGATGTAGGCAGCTGTC (3')
4 c-Myc Forward primer (5') ACCAGCAGCGACTCTGAGGAGGAAC (3')
5 c-Myc Reverse primer (5') TGACCCTCTTGGCAGCAGGATAGTCC (3')
6 cyclin-D1 Forward primer (5') ACCTTCGTTGCCCTCTGTGCCACAGATG (3')
7 cyclin-D1 Reverse primer (5') AGGCCCGGAGGCAGTCCGGGT (3')
8 GAPDH Forward primer (5') GGAGCCAAAAGGGTCATCAT (3')
9 GAPDH Reverse primer (5') GTGATGGCATGGACTGTGGT (3')
그 결과, 도 4에서 볼 수 있듯이, 본 발명의 펩타이드를 처리한 HHFDPC에서는 LEF-1, c-Myc 및 사이클린 D1의 mRNA가 검출되었으며 아무런 처리를 하지 않은 대조군과 비교할 때 mRNA의 양이 더 증가하였다. 따라서, 본 발명의 펩타이드가 처리된 모유두세포에서는 β-카테닌이 활성화됨에 따라 발현되는 LEF-1, c-Myc 및 사이클린 D1의 발현이 촉진되며, 모유두세포의 증식과 분화를 촉진하여 모발의 형성을 촉진하는 효과가 있음을 확인할 수 있었다.
[실험예 2] 본 발명 펩타이드의 모유두세포에서의 탈모 관련 단백질 발현 억제 효과 확인
DKK-1 단백질(dickkopf-related protein 1)은 탈모, 특히 남성형 탈모가 발생한 개체에서 높게 발현되는 것으로 알려진 탈모 관련 단백질로, DHT(Dihydrotestosterone)와 같은 호르몬에 의해 그 발현이 촉진될 수 있는 것으로 알려져 있다. 이에, 본 발명의 제조예에 따른 펩타이드와 함께 DHT를 HHFDPC 세포에 처리함으로써 DKK-1 단백질의 발현을 유도한 후, DKK-1의 발현 정도를 웨스턴 블랏팅을 통해 측정하여 DKK-1 단백질의 발현 억제 효과가 있는지 여부를 확인하였다.
구체적으로, 상기 [실험예 1-1]과 같은 HHFDPC를 4Х105 cells/well만큼 6-웰 배양 플레이트에 시딩한 후 MSC 완전배지(mesenchymal stem cell complete media)에서 24시간 동안 배양한 다음, 이를 serum free MSC 완전배지로 교환하여 다시 24시간 배양하였다. 그리고, 상기 HHFDPC에 상기 제조예에서 제조한 서열번호 1의 펩타이드를 각각 500 nM, 5 μM 및 50 μM의 농도로 처리하였고 이 때 DKK-1 단백질의 발현 유도 물질인 DHT를 100 nM의 농도로 동시 처리한 후 37℃에서 24시간 동안 배양하였다. 양성 대조군으로는 피나스테리드(finasteride)를 5 μM의 농도로 처리하여 사용하였고 음성 대조군으로는 DHT만 처리하여 DKK-1의 발현을 유도시키고 펩타이드를 처리하지 않은 HHFDPC를 사용하였다. 그런 다음 탈모 관련 단백질인 DKK-1 단백질을 검출하기 위하여 웨스턴 블랏팅을 수행하였다. PBS로 씻어낸 후 세포를 파괴하기 위한 완충용액(lysis buffer)를 처리하여 세포 파쇄물(cell lysate)를 얻은 다음, 10% SDS-PAGE 겔을 이용해 전기영동 후 PVDF 막으로 옮겨 5%의 skim milk를 이용해 30분 동안 실온에서 blocking 시켰다. 그리고, DDK-1 단백질을 검출하기 위하여 이에 특이적으로 결합가능한 항-DKK-1 항체(cell signaling, USA)를 1:1000으로 3% BSA에 희석하여 4℃에서 상기 PVDF 막과 16시간 동안 반응시켰다. 그 후, 0.1% PBS-T(0.1% Tween-20 in PBS)로 15분씩 3회 워시 후 상기 항-DKK-1 항체에 대한 2차 항체를 1:2000으로 5% skim milk에 희석하여 상온에서 1시간 반응시켰다. 다시 0.1% PBS-T(0.1% Tween-20 in PBS)로 15분씩 3회 워시 후 ECL 용액(GE Healthcare, USA)을 처리해 DKK-1 단백질을 검출하였다.
그 결과, 도 5에서 확인할 수 있듯이, 본 발명의 펩타이드를 처리한 HHFDPC에서는 음성 대조군과 비교할 때 DKK-1 단백질의 양이 감소한 것으로 나타났다. 즉, 모유두세포에 DHT를 처리하여 탈모 관련 단백질의 발현이 증가하였으나(음성대조군), 본 발명 펩타이드를 처리한 경우, HHFDPC에서는 DHT의 처리에 의해 증가된 DKK-1 단백질의 양이 다시 감소하였으며, 증가된 DKK-1의 발현은 본 발명 펩타이드 농도에 의존적으로 다시 감소되었는바, 본 발명의 펩타이드는 탈모를 억제할 수 있는 효과가 있음을 확인할 수 있었다.
[실험예 3] 본 발명 펩타이드의 외모근초세포 활성 촉진 효과 확인
상기 제조예에 따라 제조된 서열번호 1의 아미노산 서열로 이루어진 본 발명의 펩타이드를 이용하여, 모낭을 이루는 세포의 일종인 외모근초세포의 활성을 촉진하는지 여부를 확인하였다.
구체적으로, HHORSC(human hair outer root sheath cell, Sciencell, USA)를 4Х105 cells/well만큼 6-웰 배양 플레이트에 시딩한 후 MSC 완전배지(mesenchymal stem cell complete media)에서 24시간 동안 배양한 다음, 이를 serum free MSC 완전배지로 교환하여 다시 24시간 배양하였다. 그리고, 상기 HHORSC에 상기 제조예에서 제조한 서열번호 1의 펩타이드를 각각 500 nM, 5 μM 및 50 μM의 농도로 처리하여 37℃ 에서 72시간 동안 배양하였다. 양성 대조군으로는 EGF를 50 nM의 농도로 처리하여 사용하였고 음성 대조군으로는 아무런 처리를 하지 않은 HHORSC를 사용하였다. 그리고 PBS 워시 후 easy blue(intron, 한국)를 300 ㎕ 처리하여 RNA를 분리하였다. 그런 다음, nano drop으로 정량하여 cDNA 합성 키트(cDNA synthesis kit, enzynomics, 한국)을 이용하여 cDNA를 합성하였으며, Ha3-II, Keratin 5, Keratin 14 및 Keratin 19에 대한 프라이머(프라이머의 염기서열은 하기 표 3에 나타내었다) 와 PCR premix(enzynomics, 한국)을 이용해 PCR을 수행하였다. 1.5%의 아가로즈 겔에서 전기영동을 수행한 다음, 밴드 분석 시스템(Bio-Rad gel image system)을 통해 Ha3-II, Keratin 5, Keratin 14 및 Keratin 19의 mRNA를 검출하였다.
서열번호 서열이름 염기서열
10 Ha3-II Forward primer (5') GATCATCGAGCTGAGACGCA (3')
11 Ha3-II Reverse primer (5') CTGGCCCCAGGGTATCTAGT (3')
12 Keratin 5 Forward primer (5') CCCTCAAGGATGCCAGGAAC (3')
13 Keratin 5 Reverse primer (5') CACTGCTACCTCCGGCAAG (3')
14 Keratin 14 Forward primer (5') CCAAATCCGCACCAAGGTCA (3')
15 Keratin 14 Reverse primer (5') GTATTGATTGCCAGGAGGGGG (3')
16 Keratin 19 Forward primer (5') CGCGGCGTATCCGTGTCCTC (3')
17 Keratin 19 Reverse primer (5') AGCCTGTTCCGTCTCAAACTTGGT (3')
그 결과, 도 6에서 볼 수 있듯이, 본 발명의 펩타이드를 처리한 HHORSC에서는 Ha3-II, Keratin 5, Keratin 14 및 Keratin 19의 mRNA가 검출되었으며 아무런 처리를 하지 않은 대조군과 비교할 때 mRNA의 양이 더 증가하였다. 따라서, 본 발명의 펩타이드가 처리된 외모근초세포에서는 이의 세포 활성이 증가됨에 따라 상기 사이토카인들의 발현이 증가되는 것을 확인할 수 있었고, 본 발명의 펩타이드는 모낭을 이루어 모발의 형성을 돕는 외모근초세포의 활성을 증가시키는 효과가 있음을 확인할 수 있었다.
[실험예 4] 본 발명 펩타이드의 모모세포 활성 촉진 효과 확인
상기 제조예에 따라 제조된 서열번호 1의 아미노산 서열로 이루어진 본 발명의 펩타이드를 이용하여, 모발을 형성하는 세포의 일종인 모모세포의 활성 관련 전사인자의 발현 촉진 여부를 확인하였다.
구체적으로, HHGMC(human hair germinal matrix cell, Sciencell, USA)를 4Х105 cells/well만큼 6-웰 배양 플레이트에 시딩한 후 MSC 완전배지(mesenchymal stem cell complete media)에서 24시간 동안 배양한 다음, 이를 serum free MSC 완전배지로 교환하여 다시 24시간 배양하였다. 그리고, 상기 HHGMC에 상기 제조예에서 제조된 서열번호 1의 펩타이드를 각각 500 nM, 5 μM 및 50 μM의 농도로 처리하여 37℃에서 72시간 동안 배양하였다. 양성 대조군으로는 EGF를 50 nM의 농도로 처리하여 사용하였고 음성 대조군으로는 아무런 처리를 하지 않은 HHGMC를 사용하였다. 그리고 PBS 워시 후 easy blue(intron, 한국)를 300 ㎕ 처리하여 RNA를 분리하였다. 그런 다음, nano drop으로 정량하여 cDNA 합성 키트(cDNA synthesis kit, enzynomics, 한국)을 이용하여 cDNA를 합성하였으며, MSX2 및 FOXN1에 대한 프라이머(프라이머의 염기서열은 하기 표 4에 나타내었따) 와 PCR premix(enzynomics, 한국)을 이용해 PCR을 수행하였다. 1.5%의 아가로즈 겔에서 전기영동을 수행한 다음, 밴드 분석 시스템(Bio-Rad gel image system)을 통해 MSX2 및 FOXN1의 mRNA를 검출하였다.
서열번호 서열이름 염기서열
18 MSX2 Forward primer (5') CGGTCAAGTCGGAAAATTCA (3')
19 MSX2 Reverse primer (5') GAGGAGCTGGGATGTGGTAA (3')
20 FOXN1 Forward primer (5') CAGGACTGGGTGATGGTGTC (3')
21 FOXN1 Reverse primer (5') TCTGAGGGTGAGAGCCTGAA (3')
그 결과, 도 7에서 볼 수 있듯이, 본 발명의 펩타이드를 처리한 HHGMC에서는 MSX2 및 FOXN1의 mRNA가 검출되었으며 아무런 처리를 하지 않은 대조군과 비교할 때 mRNA의 양이 더 증가하였다. 따라서, 본 발명의 펩타이드가 처리된 모모세포에서는 전사인자 MSX2 및 FOXN1의 발현이 증가됨에 따라 세포 활성과 관련된 유전자의 전사와 이에 따른 활성이 증가되며, 본 발명의 펩타이드는 모모세포의 활성을 증가시켜 모발의 형성을 촉진하고 탈모를 예방, 개선할 수 있는 효과가 있음을 확인할 수 있었다.
이상에서 본 발명은 기재된 실시예에 대해서만 상세히 설명되었지만 본 발명의 기술사상 범위 내에서 다양한 변형 및 수정이 가능함은 당업자에게 있어서 명백한 것이며, 이러한 변형 및 수정이 첨부된 청구범위에 속함은 당연한 것이다.

Claims (16)

  1. 서열번호 1의 아미노산 서열을 포함하는, 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드.
  2. 청구항 1에 있어서,
    상기 펩타이드는 모발의 형성과 관련된 세포의 증식 또는 활성을 촉진시키는 것인, 펩타이드.
  3. 청구항 1의 펩타이드를 포함하는, 탈모 방지 또는 발모 촉진용 조성물.
  4. 청구항 3에 있어서,
    상기 펩타이드는 상기 조성물 내에 0.01 μM 내지 100 μM의 농도로 포함되는 것인, 탈모 방지 또는 발모 촉진용 조성물.
  5. 청구항 3에 있어서,
    상기 조성물은 모유두세포, 외모근초세포 및 모모세포로 이루어진 군으로부터 선택되는 하나 이상의 세포의 활성을 촉진시켜 모발의 형성을 유도하는 것인, 탈모 방지 또는 발모 촉진용 조성물.
  6. 청구항 3에 있어서,
    상기 조성물은 모유두세포에서 AKT 및 ERK로 이루어진 군으로부터 선택되는 하나 이상의 인산화를 유도하는 것인, 탈모 방지 또는 발모 촉진용 조성물.
  7. 청구항 3에 있어서,
    상기 조성물은 모유두세포에서 β-카테닌의 활성화를 유도하는 것인, 탈모 방지 또는 발모 촉진용 조성물.
  8. 청구항 3에 있어서,
    상기 조성물은 모유두세포에서 LEF-1, c-Myc 및 사이클린 D1으로 이루어진 군으로부터 선택되는 하나 이상의 발현을 촉진하는 것인, 탈모 방지 또는 발모 촉진용 조성물.
  9. 청구항 3에 있어서,
    상기 조성물은 모유두세포에서 DKK-1 단백질의 발현을 억제하는 것인, 탈모 방지 또는 발모 촉진용 조성물.
  10. 청구항 3에 있어서,
    상기 조성물은 외모근초세포에서 Ha3-II, Keratin 5, Keratin 14 및 Keratin 19로 이루어진 군으로부터 선택되는 하나 이상의 발현을 촉진하는 것인, 탈모 방지 또는 발모 촉진용 조성물.
  11. 청구항 3에 있어서,
    상기 조성물은 모모세포에서 MSX2 및 FOXN1로 이루어진 군으로부터 선택되는 적어도 하나의 발현을 촉진하는 것인, 탈모 방지 또는 발모 촉진용 조성물.
  12. 청구항 1의 펩타이드를 포함하는, 탈모의 예방 또는 치료용 약학적 조성물.
  13. 청구항 12에 있어서, 상기 약학적 조성물은 피부외용제인 것을 특징으로 하는, 탈모의 예방 또는 치료용 약학적 조성물.
  14. 청구항 1의 펩타이드를 포함하는, 탈모의 예방 또는 개선용 화장료 조성물.
  15. 청구항 14에 있어서, 상기 화장료 조성물은 피부외용제인 것을 특징으로 하는, 탈모의 예방 또는 개선용 화장료 조성물.
  16. 청구항 14에 있어서,
    상기 화장료 조성물은 용액, 현탁액, 유탁액, 겔, 로션, 에센스, 크림, 파우더, 비누, 샴푸, 린스, 팩마스크, 계면활성제-함유 클렌징, 클렌징 폼, 클렌징 워터, 오일, 리퀴드 파운데이션, 크림 파운데이션, 스프레이로 이루어진 군으로부터 선택되는 어느 하나의 제형을 갖는 것인, 탈모의 예방 또는 개선용 화장료 조성물.
PCT/KR2022/014522 2021-10-01 2022-09-28 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도 WO2023055055A1 (ko)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202280065980.6A CN118043336A (zh) 2021-10-01 2022-09-28 具有脱发预防或毛发生长促进活性的肽及其用途

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0130819 2021-10-01
KR1020210130819A KR20230047693A (ko) 2021-10-01 2021-10-01 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도

Publications (1)

Publication Number Publication Date
WO2023055055A1 true WO2023055055A1 (ko) 2023-04-06

Family

ID=85783185

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/014522 WO2023055055A1 (ko) 2021-10-01 2022-09-28 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도

Country Status (3)

Country Link
KR (1) KR20230047693A (ko)
CN (1) CN118043336A (ko)
WO (1) WO2023055055A1 (ko)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7115398B2 (en) * 1998-05-15 2006-10-03 Genentch, Inc. IL-17 homologous polypeptides and therapeutic uses thereof
US8460647B2 (en) * 2007-04-20 2013-06-11 Amgen Inc. Pre-ligand assembly domain of the IL-17 receptor
US9416168B2 (en) * 2011-07-19 2016-08-16 The National Institute for Biotechnology in the Negev, Ltd IL-17R-ECD mutants and methods of using same
KR20170046528A (ko) 2015-10-21 2017-05-02 주식회사 제이아이바이오신약 청호, 구절초, 애엽, 인진호, 괴각, 대계, 및 목향을 포함하는 한약 추출물이 함유된 탈모개선 및 탈모방지용 복합조성물 및 그 제조방법
KR20170097830A (ko) * 2016-02-18 2017-08-29 (주)케어젠 발모 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR20200058932A (ko) 2018-11-20 2020-05-28 대동대학교 산학협력단 도라지 추출물 또는 도라지 분획물을 함유하는 탈모예방 및 탈모개선 조성물

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7115398B2 (en) * 1998-05-15 2006-10-03 Genentch, Inc. IL-17 homologous polypeptides and therapeutic uses thereof
US8460647B2 (en) * 2007-04-20 2013-06-11 Amgen Inc. Pre-ligand assembly domain of the IL-17 receptor
US9416168B2 (en) * 2011-07-19 2016-08-16 The National Institute for Biotechnology in the Negev, Ltd IL-17R-ECD mutants and methods of using same
KR20170046528A (ko) 2015-10-21 2017-05-02 주식회사 제이아이바이오신약 청호, 구절초, 애엽, 인진호, 괴각, 대계, 및 목향을 포함하는 한약 추출물이 함유된 탈모개선 및 탈모방지용 복합조성물 및 그 제조방법
KR20170097830A (ko) * 2016-02-18 2017-08-29 (주)케어젠 발모 촉진 활성을 나타내는 펩타이드 및 이의 용도
KR20200058932A (ko) 2018-11-20 2020-05-28 대동대학교 산학협력단 도라지 추출물 또는 도라지 분획물을 함유하는 탈모예방 및 탈모개선 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
TOBIAS FERNANDO, HUMMON AMANDA B.: "Considerations for MALDI-Based Quantitative Mass Spectrometry Imaging Studies", JOURNAL OF PROTEOME RESEARCH, vol. 19, no. 9, 4 September 2020 (2020-09-04), pages 3620 - 3630, XP093053703, ISSN: 1535-3893, DOI: 10.1021/acs.jproteome.0c00443 *

Also Published As

Publication number Publication date
KR20230047693A (ko) 2023-04-10
CN118043336A (zh) 2024-05-14

Similar Documents

Publication Publication Date Title
ES2329568T3 (es) Uso de un extracto de centella asiatica en madecasosido y en terminolosido.
KR102257524B1 (ko) 피부 진정 및 재생효과를 지니는 병풀 유래 엑소좀 함유 피부 개선용 화장료 조성물
WO2020171285A1 (ko) 대기오염물질에 의한 피부 손상 방지 및 항노화용 펩타이드와 이의 용도
WO2020218846A1 (ko) 우유 엑소좀을 포함하는 피부 미백용 조성물
WO2014058142A1 (ko) 섬쑥부쟁이 추출물을 유효성분으로 함유하는 비만 또는 대사성질환의 예방 또는 치료용 약학적 조성물
WO2017014502A1 (ko) 해당화 꽃 추출물을 유효성분으로 포함하는 il-6 매개성 질환의 예방 또는 치료용 약학적 조성물
WO2021080129A1 (ko) 하이드란제놀 또는 필로둘신을 유효성분으로 하는 피부장벽 강화 및 아토피 피부염 개선용 조성물
WO2023055055A1 (ko) 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
WO2023055053A1 (ko) 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
WO2023055060A1 (ko) 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
WO2023055054A1 (ko) 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
WO2023055056A1 (ko) 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
WO2023055051A1 (ko) 탈모 방지 또는 발모 촉진 활성을 갖는 펩타이드와 이의 용도
WO2017057910A1 (ko) 소야사포닌을 함유하는 발모 및/또는 육모 촉진용 조성물
WO2013115456A1 (ko) 생강 초임계 추출물 및 발효 미나리 박 추출물을 함유하는 식품, 화장료 또는 약학 조성물
WO2019139403A1 (ko) 세리신, 사상자 추출물 및 겨우살이 추출물을 포함하는, 피부 재생, 진정 또는 상처 치유용 조성물
WO2015034247A1 (ko) 모노아세틸디아실글리세롤 화합물을 유효성분으로 함유하는 아토피 피부염의 예방 또는 치료용 조성물
WO2019066590A1 (ko) Zag 유래 펩타이드 및 그의 용도
WO2021162463A1 (ko) 플라본-레스베라트롤 접합체 화합물을 포함하는 아토피 피부염 예방, 치료 및 개선용 조성물
WO2019031655A1 (ko) 티몰을 유효성분으로 함유하는 피부 주름 또는 아토피성 피부염의 예방 또는 치료용 조성물
WO2018056676A1 (ko) 퍼플콘 추출물을 함유하는 피부 질환의 예방 또는 치료용 약제학적 조성물
WO2019225891A1 (ko) 아이리린 b를 포함하는 피부 항노화 조성물
WO2018194261A1 (ko) 4'-o-메틸알피눔 이소플라본의 치료적 용도
WO2023085887A1 (ko) 신규한 압타머 및 그 압타머를 유효성분으로 포함하는 인지 기능 개선 및 항노화용 조성물
WO2021187679A1 (ko) 해삼 유래 사포닌 화합물을 포함하는 신경병증의 예방, 완화 또는 치료용 조성물

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22876827

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2022876827

Country of ref document: EP

Effective date: 20240502