WO2023043152A1 - 간세포 표적화 엑소좀 및 이의 간질환의 예방 또는 치료를 위한 용도 - Google Patents

간세포 표적화 엑소좀 및 이의 간질환의 예방 또는 치료를 위한 용도 Download PDF

Info

Publication number
WO2023043152A1
WO2023043152A1 PCT/KR2022/013640 KR2022013640W WO2023043152A1 WO 2023043152 A1 WO2023043152 A1 WO 2023043152A1 KR 2022013640 W KR2022013640 W KR 2022013640W WO 2023043152 A1 WO2023043152 A1 WO 2023043152A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
pharmaceutical composition
liver disease
preventing
extracellular vesicles
Prior art date
Application number
PCT/KR2022/013640
Other languages
English (en)
French (fr)
Inventor
김세준
홍태호
김옥희
Original Assignee
가톨릭대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 가톨릭대학교 산학협력단 filed Critical 가톨릭대학교 산학협력단
Publication of WO2023043152A1 publication Critical patent/WO2023043152A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/28—Bone marrow; Haematopoietic stem cells; Mesenchymal stem cells of any origin, e.g. adipose-derived stem cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
    • A61K38/08—Peptides having 5 to 11 amino acids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/71—Receptors; Cell surface antigens; Cell surface determinants for growth factors; for growth regulators
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/88—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation using microencapsulation, e.g. using amphiphile liposome vesicle
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to a pharmaceutical composition for preventing or treating liver disease, including hepatocyte-specific exosomes as an active ingredient.
  • Liver fibrosis can be defined as excessive deposition of extracellular matrix due to chronic intrahepatic inflammation. A decrease in the number progresses to cirrhosis.
  • Liver fibrosis occurs as a result of repeated inflammation and healing as chronic hepatitis persists and is repaired. When fibrosis progresses further, it progresses to cirrhosis. Liver tissue biopsy is known to be the optimal method for diagnosing liver fibrosis and cirrhosis, but it is invasive and is accompanied by pain and bleeding, which limits blood coagulation disorders.
  • Exosomes are only 30-100 nm in size, but contain various substances such as proteins, nucleic acids, and lipids contained in original cells. They are nanoparticles secreted by our adipose-derived stem cells, such as immune cells and stem cells. . As the function of exosomes as intercellular information carriers is known, they are attracting attention as next-generation anticancer substances.
  • the present inventors have developed a novel method that efficiently inhibits liver fibrosis by inhibiting activated hepatic fibrosis cells by delivering miRNA to activated hepatic fibrosis cells (HSCs) using extracellular vesicles (EVs).
  • HSCs activated hepatic fibrosis cells
  • EVs extracellular vesicles
  • An object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of liver disease, comprising, as an active ingredient, extracellular vesicles on the surface of which hepatic stellate cell receptor-specific peptides are expressed.
  • Another object of the present invention is to provide a method for preparing the extracellular vesicles or the pharmaceutical composition.
  • the present invention is for the prevention or treatment of liver disease, which contains, as an active ingredient, extracellular vesicles on the surface of which peptides specific to hepatic stellate cell receptors (i.e., peptides that specifically bind to hepatic stellate cell receptors) are expressed.
  • a pharmaceutical composition is provided.
  • the present invention provides a preventive or therapeutic use of the extracellular vesicles or a composition containing them for liver disease.
  • the present invention provides a method for preventing or treating liver disease, comprising the step of administering the extracellular vesicles or a composition containing them to a subject in need thereof.
  • the present invention provides the use of the extracellular vesicles or a composition containing them for preparing a therapeutic agent for liver disease.
  • the receptor of the hepatic stellate cell may be PDGFR (Platelet Derived Growth Factor Receptor), but is not limited thereto.
  • the peptide may be expressed from a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1, but is not limited thereto.
  • the extracellular vesicles may be obtained from cells transformed with a recombinant vector into which a gene encoding a peptide specific for the hepatic stellate cell receptor is inserted, but is not limited thereto .
  • the cells may be at least one selected from the group consisting of stem cells, bone marrow-derived stem cells, umbilical cord blood-derived stem cells, and adipose-derived stem cells, but is not limited thereto.
  • the cells may be human or animal-derived cells, but are not limited thereto.
  • the extracellular vesicles may be exosomes, but are not limited thereto.
  • the extracellular vesicles may further contain a nucleic acid that inhibits the expression of a liver fibrosis-promoting gene, but is not limited thereto.
  • the nucleic acid is an antisense nucleotide, an antisense oligonucleotide, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), a microRNA ( miRNA), RNA interference (RNAi), and at least one selected from the group consisting of ribozyme molecules, but is not limited thereto.
  • siRNA small interfering RNA
  • shRNA short hairpin RNA
  • miRNA microRNA
  • RNAi RNA interference
  • the hepatic fibrosis-promoting gene may be at least one selected from the group consisting of collagen I, collagen II, ⁇ -SMA, and MMP coding genes, but is not limited thereto.
  • the liver disease may be at least one selected from the group consisting of liver fibrosis, liver cirrhosis, acute hepatitis, chronic hepatitis, and liver cancer, but is not limited thereto.
  • the present invention comprises the steps of (S1) transforming cells with a recombinant vector into which a gene encoding a peptide specific for a receptor of hepatic stellate cells is inserted;
  • (S3) a method for producing hepatic stellate cell-specific extracellular vesicles, comprising the step of introducing a nucleic acid that inhibits the expression of a hepatic fibrosis-promoting gene into the extracellular vesicles,
  • the extracellular endoplasmic reticulum is characterized in that a peptide specific to the receptor of the hepatic stellate cells is expressed, provides a manufacturing method.
  • the extracellular vesicles may be exosomes, but are not limited thereto.
  • the extracellular vesicles may be used for preventing or treating liver disease, but is not limited thereto.
  • the pharmaceutical composition comprising extracellular vesicles transformed with a recombinant expression vector into which a gene expressing a peptide that binds to a receptor of hepatic stellate cells is inserted into a gene expressed in extracellular vesicles of stem cells of the present invention prevents liver disease Or it may be useful as a pharmaceutical composition for treatment. Therefore, the pharmaceutical composition can be applied to the field of liver fibrosis treatment, particularly clinical application technology.
  • FIG. 1 is a diagram showing the process of inducing hepatic fibrosis by activated hepatic stellate cells (HSC) and the mechanism of improving hepatic fibrosis of extracellular vesicles (exosomes) according to the present invention.
  • HSC hepatic stellate cells
  • exosomes extracellular vesicles
  • the extracellular vesicles of the present invention are obtained from cells transformed with a recombinant vector expressing an HSC surface receptor-specific peptide, the peptide is expressed on the surface, and antifibrogenic miRNA can be loaded inside, It can specifically act on hepatic stellate cells to suppress the expression of genes promoting fibrosis.
  • FIG. 2 shows the results of transmission electron microscopy (TEM) for structural analysis of the exosome of the present invention.
  • Figure 3 shows the results of analyzing the exosomes of the present invention using flow cytometry (FACS).
  • Figure 6 shows changes in gene expression related to liver fibrosis after treatment with exosomes of the present invention in a liver lesion model constructed by intraperitoneal injection of TAA into BALB/C Nude mice.
  • liver lesion model 7 is a result of observing the appearance of the liver after treating the exosome of the present invention in a liver lesion model constructed by intraperitoneal injection of TAA into a BALB/C Nude mouse.
  • FIG. 9 is a result of confirming the COL1A1 gene expression pattern after treating the exosome of the present invention in a liver lesion model constructed by intraperitoneal injection of TAA into a BALB/C Nude mouse.
  • 11 is a result of confirming the expression pattern of TIMP1 gene after treatment with exosomes of the present invention in a liver lesion model constructed by intraperitoneal injection of TAA into BALB/C Nude mice.
  • One aspect of the present invention provides a pharmaceutical composition for preventing or treating liver disease, comprising, as an active ingredient, extracellular vesicles on the surface of which hepatic stellate cell receptor-specific peptides are expressed.
  • the extracellular vesicles may be obtained from cells transformed with a recombinant vector into which a gene encoding a peptide specific for the hepatic stellate cell receptor is inserted.
  • the extracellular vesicles are transfected with a recombinant expression vector in which a gene expressing a peptide that binds to a receptor of hepatic stellate cells is inserted into a gene expressed in extracellular vesicles of cells (particularly, stem cells) It may be obtained from transformed cells.
  • the "expression vector" in the present invention may be selected from the group consisting of a linear DNA vector, a plasmid DNA vector, and a recombinant viral vector, but is not limited thereto, and conventional vectors used for transformation in the art are all of the present invention. can be used in the method of In one embodiment of the present invention, the expression vector may be a pDisplay vector.
  • extracellular vesicle refers to a small sphere surrounded by a membrane derived from a cell, and the extracellular vesicle is an extracellular vesicle derived from nature, such as plants, animals, and microorganisms, or artificially prepared extracellular It may be an endoplasmic reticulum.
  • the cells may be cells isolated from natural organisms.
  • the "extracellular vesicles” may be exosomes, ectosomes or microvesicles.
  • the "extracellular vesicle” may be an exosome.
  • exosome is a small membrane-structured vesicle secreted from various cells, and refers to a vesicle released into the extracellular environment after fusion of the polycystic body and the plasma membrane.
  • the exosomes may be derived from or isolated from one or more selected from the group consisting of immune cells, stem cells, bone marrow-derived stem cells, cord blood-derived stem cells, and adipose-derived stem cells.
  • the exosome may have a diameter of 50 to 300 nm, 50 to 200 nm, or 50 to 150 nm.
  • the extracellular vesicles in the composition may be included in a concentration of 1 to 50 ⁇ L / ml, 1 to 30 ⁇ L / ml, or 1 to 10 ⁇ L / ml.
  • “Stem cells” in the present invention refers to cells of various origins as pluripotent cells capable of differentiating into various tissue cells when appropriate conditions are met in an undifferentiated state.
  • the stem cells may be bone marrow-derived stem cells, cord blood-derived stem cells or adipose-derived stem cells.
  • the stem cells may be adipose-derived stem cells.
  • the bone marrow-derived stem cells, cord blood-derived stem cells, or adipose-derived stem cells may be human or animal-derived stem cells.
  • Adipose-derived stem cells in the present invention are stem cells derived from adipose tissue, and refer to cells having pluripotency and self-renewal ability, and the adipose-derived stem cells of the present invention are obtained through liposuction and various surgical operations. It can, but is not limited to this.
  • the exosome is transformed to express a peptide that binds to a receptor of hepatic stellate cell (HSC) within a gene expressed by exosomes of host cells such as stem cells. It means that it can act as a target on astrocytes.
  • HSC hepatic stellate cell
  • the extracellular vesicle according to the present invention may have a peptide specifically binding to a hepatic stellate cell receptor expressed on the surface, and hepatic stellate cells can be targeted through the peptide.
  • the hepatic stellate cell receptor may include without limitation any protein that is specifically expressed in hepatic stellate cells or expressed at a particularly high level in hepatic stellate cells compared to other cells, but is preferably PDGFR (Platelet Derived Growth Factor Receptor).
  • PDGFR Plated Growth Factor Receptor
  • the peptide may be expressed from a polynucleotide comprising the nucleic acid sequence of SEQ ID NO: 1.
  • a polynucleotide composed of a nucleic acid sequence represented by a specific sequence number is not limited to the nucleic acid sequence, and variants of the nucleic acid sequence are included within the scope of the present invention.
  • the polynucleotide molecule of the nucleic acid sequence of the present invention is a functional equivalent of the polynucleotide molecule constituting it, for example, although some base sequences of the polypeptide molecule have been modified by deletion, substitution or insertion , It is a concept including variants capable of functionally the same action as the corresponding polynucleotide.
  • the polynucleotide disclosed in the present invention is 70% or more, more preferably 80% or more, still more preferably 90% or more, and most preferably 95% or more of the nucleic acid sequence represented by a specific sequence number. It may contain homologous amino acid sequences (nucleic acid sequences). For example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85 %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence homology It includes a polynucleotide having.
  • the "percentage of sequence homology" for polynucleotides is determined by comparing two optimally aligned sequences with a comparison region, wherein a portion of the polynucleotide sequence in the comparison region is a reference sequence (addition or deletion) for the optimal alignment of the two sequences. may include additions or deletions (i.e., gaps) compared to (not including).
  • the exosome may be transfected with a nucleic acid capable of suppressing the expression of a liver fibrosis-inducing gene (ie, anti-fibrotic nucleic acid). That is, the extracellular vesicles may further contain nucleic acids that suppress the expression of hepatic fibrosis-promoting genes.
  • the nucleic acid is a nucleic acid capable of suppressing the expression of a liver fibrosis-inducing gene, and can suppress the expression of a liver fibrosis-inducing gene by combining with a nucleic acid expressing a liver fibrosis gene or by directly combining with a liver fibrosis gene to inhibit expression.
  • the extracellular vesicles of the present invention can inhibit the production of factors promoting fibrosis by hepatocytes through the nucleic acid and reduce fibrosis in liver tissue.
  • calcium phosphate transfection (calcium phosphate transfection) Phosphate transfection) Phosphate transfection), lipofection, electroporation, microinjection, and microprojectile may be used, but are not limited thereto.
  • a method of treating cells by mixing DNA with commercially available reagents such as DNA calcium phosphate precipitation, lipofection, or PEI may be used.
  • the anti-fibrotic nucleic acid according to the present invention can be introduced into the extracellular vesicle through the known method to exhibit anti-fibrotic activity.
  • the nucleic acid is an antisense nucleotide, antisense oligonucleotide, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), RNA interference (RNAi), And it may be one or more selected from the group consisting of ribozyme molecules, but is not limited thereto.
  • the nucleic acid comprises one or more nucleic acids selected from the group consisting of miRNA and siRNA.
  • the nucleic acid is included without limitation as long as it can suppress the activity or expression of a gene promoting hepatic fibrosis, but may preferably be miR-150.
  • the present invention includes (a) introducing a gene that expresses a peptide that binds to a receptor of hepatic stellate cells into a gene expressed in the extracellular vesicles of adipose-derived stem cells; (b) culturing the cells into which the gene has been introduced in a medium to obtain extracellular vesicles; and (c) transfecting the obtained extracellular endoplasmic reticulum with a nucleic acid capable of suppressing the expression of a gene that induces hepatic fibrosis.
  • the present invention includes (S1) transforming cells with a recombinant vector into which a gene encoding a peptide specific for hepatic stellate cell receptor is inserted;
  • (S3) a method for producing hepatic stellate cell-specific extracellular vesicles, comprising the step of introducing a nucleic acid that inhibits the expression of a hepatic fibrosis-promoting gene into the extracellular vesicles,
  • the extracellular endoplasmic reticulum is characterized in that a peptide specific to the hepatic stellate cell receptor is expressed, and provides a manufacturing method.
  • Extracellular vesicles in the present invention may be exosomes, ectosomes or microvesicles, but in one embodiment of the present invention, the "extracellular vesicles” may be exosomes there is.
  • the "medium” in the present invention may be an adipose-derived stem cell culture medium.
  • the adipose-derived stem cell culture medium is DMEM high-low glucose medium or FBS-Free to which FBS (inactivated fetal bovine serum) and P/S (penicillin-streptomycin) are added.
  • the medium can be DMEM low glucose.
  • liver disease that can be treated, prevented or improved by the pharmaceutical composition of the present invention may be, but is not limited to, liver fibrosis, liver cirrhosis, acute hepatitis, chronic hepatitis or liver cancer, preferably liver fibrosis or liver cirrhosis. there is.
  • the content of the extracellular vesicles in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the progress of the symptoms, the condition of the patient, etc., for example, 0.0001 to 99.9% by weight, or 0.001 to 50% by weight based on the total weight of the composition. %, but is not limited thereto.
  • the content ratio is a value based on the dry amount after removing the solvent.
  • the pharmaceutical composition according to the present invention may further include suitable carriers, excipients and diluents commonly used in the manufacture of pharmaceutical compositions.
  • the excipient may be, for example, one or more selected from the group consisting of a diluent, a binder, a disintegrant, a lubricant, an adsorbent, a moisturizer, a film-coating material, and a controlled release additive.
  • compositions according to the present invention are powders, granules, sustained-release granules, enteric granules, solutions, eye drops, elsilic agents, emulsions, suspensions, spirits, troches, perfumes, and limonadese, respectively, according to conventional methods.
  • tablets, sustained-release tablets, enteric tablets, sublingual tablets, hard capsules, soft capsules, sustained-release capsules, enteric capsules, pills, tinctures, soft extracts, dry extracts, fluid extracts, injections, capsules, perfusate It can be formulated and used in the form of external preparations such as warning agents, lotions, pasta agents, sprays, inhalants, patches, sterile injection solutions, or aerosols, and the external agents are creams, gels, patches, sprays, ointments, and warning agents.
  • lotion, liniment, pasta, or cataplasma may have formulations such as the like.
  • Carriers, excipients and diluents that may be included in the pharmaceutical composition according to the present invention include lactose, dextrose, sucrose, oligosaccharide, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.
  • diluents or excipients such as commonly used fillers, extenders, binders, wetting agents, disintegrants, and surfactants.
  • Additives for the liquid formulation according to the present invention include water, dilute hydrochloric acid, dilute sulfuric acid, sodium citrate, sucrose monostearate, polyoxyethylene sorbitol fatty acid esters (tween esters), polyoxyethylene monoalkyl ethers, lanolin ethers, Lanolin esters, acetic acid, hydrochloric acid, aqueous ammonia, ammonium carbonate, potassium hydroxide, sodium hydroxide, prolamine, polyvinylpyrrolidone, ethyl cellulose, sodium carboxymethyl cellulose, and the like may be used.
  • a solution of white sugar, other sugars, or a sweetener may be used, and aromatics, coloring agents, preservatives, stabilizers, suspending agents, emulsifiers, thickeners, etc. may be used as necessary.
  • Purified water may be used in the emulsion according to the present invention, and emulsifiers, preservatives, stabilizers, fragrances, etc. may be used as needed.
  • Suspension agents according to the present invention include acacia, tragacantha, methylcellulose, carboxymethylcellulose, sodium carboxymethylcellulose, microcrystalline cellulose, sodium alginate, hydroxypropylmethylcellulose (HPMC), HPMC 1828, HPMC 2906, HPMC 2910, etc. Agents may be used, and surfactants, preservatives, stabilizers, colorants, and fragrances may be used as needed.
  • Injections according to the present invention include distilled water for injection, 0.9% sodium chloride injection, IV injection, dextrose injection, dextrose + sodium chloride injection, PEG, lactated IV injection, ethanol, propylene glycol, non-volatile oil-sesame oil , solvents such as cottonseed oil, peanut oil, soybean oil, corn oil, ethyl oleate, isopropyl myristate, and benzene benzoate; solubilizing agents such as sodium benzoate, sodium salicylate, sodium acetate, urea, urethane, monoethylacetamide, butazolidine, propylene glycol, twins, nijuntinamide, hexamine, and dimethylacetamide; buffers such as weak acids and their salts (acetic acid and sodium acetate), weak bases and their salts (ammonia and ammonium acetate), organic compounds, proteins, albumins, peptones, and gums; tonicity agents such as
  • the suppository according to the present invention includes cacao butter, lanolin, witapsol, polyethylene glycol, glycerogelatin, methylcellulose, carboxymethylcellulose, a mixture of stearic acid and oleic acid, subanal, cottonseed oil, peanut oil, palm oil, cacao butter + Cholesterol, Lecithin, Lannet Wax, Glycerol Monostearate, Tween or Span, Imhausen, Monolen (Propylene Glycol Monostearate), Glycerin, Adeps Solidus, Buytyrum Tego-G -G), Cebes Pharma 16, Hexalide Base 95, Cotomar, Hydroxycote SP, S-70-XXA, S-70-XX75 (S-70-XX95), Hyde Hydrokote 25, Hydrokote 711, Idropostal, Massa estrarium (A, AS, B, C, D, E, I, T), Massa-MF, Masupol, Masupol-15, Neos
  • Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid preparations contain at least one excipient, for example, starch, calcium carbonate, sucrose, etc. ) or by mixing lactose and gelatin.
  • excipients for example, starch, calcium carbonate, sucrose, etc.
  • lubricants such as magnesium stearate and talc are also used.
  • Liquid preparations for oral administration include suspensions, solutions for oral administration, emulsions, syrups, etc.
  • various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included.
  • Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents.
  • composition according to the present invention is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, activity of the drug, It may be determined according to factors including sensitivity to the drug, administration time, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field.
  • the pharmaceutical composition according to the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents, may be administered sequentially or simultaneously with conventional therapeutic agents, and may be administered single or multiple times. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by a person skilled in the art to which the present invention belongs.
  • the pharmaceutical composition of the present invention can be administered to a subject by various routes. All modes of administration can be envisaged, eg oral administration, subcutaneous injection, intraperitoneal administration, intravenous injection, intramuscular injection, paraspinal space (intrathecal) injection, sublingual administration, buccal administration, intrarectal insertion, vaginal It can be administered by intraoral insertion, ocular administration, otic administration, nasal administration, inhalation, spraying through the mouth or nose, dermal administration, transdermal administration, and the like.
  • the pharmaceutical composition of the present invention is determined according to the type of drug as an active ingredient together with various related factors such as the disease to be treated, the route of administration, the age, sex, weight and severity of the disease of the patient.
  • the effective amount of the composition according to the present invention may vary depending on the patient's age, sex, and weight, and is generally 0.001 to 150 mg per 1 kg of body weight, preferably 0.01 to 100 mg per day or every other day, or 1 It can be administered in 1 to 3 divided doses per day.
  • the dosage is not limited to the scope of the present invention in any way.
  • “individual” means a subject in need of treatment of a disease, and more specifically, a human or non-human primate, mouse, rat, dog, cat, horse, cow, etc. of mammals.
  • administration means providing a given composition of the present invention to a subject by any suitable method.
  • prevention refers to any action that suppresses or delays the onset of a desired disease
  • treatment means that the desired disease and its resulting metabolic abnormality are improved or improved by administration of the pharmaceutical composition according to the present invention. All actions that are advantageously altered are meant, and “improvement” means any action that reduces a parameter related to a target disease, for example, the severity of a symptom, by administration of the composition according to the present invention.
  • Example 1 Preparation of adipose-derived stem cell-derived exosomes targeting hepatic stellate cells
  • Exosomes targeting hepatic stellate cells were prepared using adipose-derived stem cells.
  • adipose-derived stem cells are only used as donor cells for producing exosomes, and other than adipose-derived stem cells, immune cells such as NK cells can also be used as donor cells for producing exosomes. Therefore, the type of cells for producing exosomes is not limited to specific cell types such as adipose-derived stem cells.
  • adipose-derived stem cells were transformed with a recombinant vector expressing the peptide.
  • a recombinant vector was prepared by inserting a gene sequence (TGCTCCCGGAATCTCATAGACTGT; SEQ ID NO: 1) encoding a peptide targeting PDGFR (Platelet Derived Growth Factor Receptor) of hepatic stellate cells (HSC) into pDisplay vector (invitrogen), and transfection reagent (lipofectamine, invitrogen) was used according to the manufacturer's instructions to transform adipose-derived stem cells with the recombinant vector.
  • the adipose-derived stem cells transformed as described above express the PDGFR target peptide and generate exosomes in which the recombinant protein is expressed on the surface.
  • the exosome can target hepatic stellate cells through the PDGFR targeting peptide. Therefore, the exosomes were extracted from the transformed adipose-derived stem cells.
  • the transformed adipose-derived stem cells were cultured in DMEM low glucose medium supplemented with 10% inactivated fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S) at 37°C and 5% CO 2 conditions. .
  • the medium was exchanged with FBS-Free DMEM low glucose, and after 24 hours of medium exchange, the culture medium was kicked off and centrifuged at 1000 rpm in a differential centrifugation method to remove cells. Subsequently, exosomes targeting hepatic stellate cells were extracted from the culture medium from which the cells were removed using an exosome extraction kit (Thermo Fisher scientific).
  • miR150 was loaded as a representative example of anti-fibrotic miRNA to the target exosomes obtained through the above process.
  • the miRNA was transfected into hepatic stellate cell-specific exosomes using Exo-Fect kit (SBI System biosciences), an Exosome transfection reagent.
  • Example 1 The morphology and characteristics of the hepatic stellate cell-specific exosomes obtained in Example 1 were observed. Specifically, the structure of exosomes was analyzed using transmission electron microscopy (TEM) and flow cytometry (FACs), and gene expression patterns when hematopoietic stem cells were treated with the exosomes of the present invention were analyzed by flow cytometry (FACs). Expression patterns were observed.
  • TEM transmission electron microscopy
  • FACs flow cytometry
  • the hepatic stellate cell-specific exosome according to the present invention had a fine spherical structure in nanometers (FIG. 2).
  • c-Myc a factor that regulates apoptosis, proliferation, and differentiation in hematopoietic stem cells using flow cytometry
  • treatment with hepatic stellate cell-specific exosomes of the present invention compared to control exosome treatment
  • the increase in expression from FITC-/PE- to FITC+/PE+ was changed (FIG. 3).
  • TGF- ⁇ is secreted from hepatocytes or Kupffer cells to activate hepatic stellate cells (HSCs), and the activated hepatic stellate cells produce collagen and the like to induce mesofibrosis.
  • HSCs hepatic stellate cells
  • hepatic stellate cells were treated with 20ng/ml TGF- ⁇ 1 to induce activation of hepatic stellate cells to realize a cirrhosis-like state.
  • Stem cell-derived hepatic stellate cell-specific exosomes t-EV; exosomes with PDGFR-specific peptides expressed on the surface
  • t-EV+miRNA150 hepatic stellate cell-specific exosomes transfected with miR150
  • hepatic stellate cells were activated and the expression of fibrotic factors significantly increased when TGF- ⁇ 1 was treated. It was confirmed that the expression of representative fibrosis factors such as Collagen I and SMA decreased when the injected target exosome was treated (FIGS. 4 and 5).
  • Example 4 Hepatic stellate cell-specific exosomes inhibit liver fibrosis and improve liver cirrhosis in liver injury animal models
  • a liver lesion model was constructed by intraperitoneal injection of 200 mg/ml of thioacetamide (TAA) to BALB/C Nude mice ( in vivo ).
  • TAA thioacetamide
  • the liver injury animal model was treated with the exosome according to the present invention to confirm the expression pattern of genes related to liver fibrosis.
  • the groups were divided as follows: control group treated with normal exosomes (Normal); Adipose-derived stem cell-derived exosome administration group expressing PDGFR target peptide (t-EV); a miR150 transfected, adipose-derived stem cell-derived exosome-administered group expressing a PDGFR target peptide (t-EV+miR150); TAA treated group (TAA); TAA and t-EV administration group (TAA+t-EV); and TAA and t-EV+miR150 administration group (TAA+t-EV+miR150).
  • Each component was injected into the cirrhosis mouse for 2 weeks by tail vein injection method, and after the administration schedule was over, the mouse was sacrificed to confirm the results.
  • the group treated with miR150-introduced hepatic stellate cell-specific exosomes showed a decrease in the expression of MMP, a factor promoting hepatic fibrosis, compared to other groups. It was confirmed that the expression of TIMP, an inhibitory factor, was increased.
  • liver of the group treated with miR150-introduced hepatic stellate cell-specific exosomes showed significantly reduced liver cirrhosis compared to other groups. It was confirmed (Fig. 7).
  • Example 5 Inhibiting tissue fibrosis of hepatic stellate cell-specific exosomes in liver injury animal models
  • a liver lesion model was constructed by intraperitoneal injection of 200 mg/ml of thioacetamide (TAA) to BALB/C Nude mice ( in vivo ). After treating the liver injury animal model with the exosome according to the present invention, the degree of fibrosis of liver tissue was compared.
  • TAA thioacetamide
  • liver fibrosis was observed by Masson staining.
  • control exosomes Ct
  • TAAs TAAs
  • adipose-derived stem cell-derived exosomes expressing TAA and PDGFR target peptides TAA and PDGFR target peptides
  • TAA+Exo adipose-derived stem cell-derived exosomes expressing TAA and PDGFR target peptides
  • TAA+Exo+miR150 adipose-derived stem cell-derived exosomes expressing PDGFR target peptides
  • Masson staining was performed to determine the liver tissue.
  • the degree of fibrosis was compared. As a result, as shown in FIG. 8, it was confirmed that tissue fibrosis was significantly suppressed in the TAA+Exo+miR150 treated group compared to the other groups.
  • Example 6 Efficacy evaluation of adipose-derived stem cell-derived target exosomes in liver injury animal models
  • each of the control exosome (Ct), TAA, TAA+Exo, and TAA+Exo+miR150 was injected into cirrhosis mice by tail vein injection for 2 weeks, and the mice were sacrificed to confirm the results.
  • the group treated with miR150-introduced hepatic stellate cell-specific exosomes showed a decrease in the expression of liver fibrosis factors COL1A1 and ⁇ -SMA compared to the other groups, and decreased expression of MMPs that promote fibrosis. It was confirmed that the expression of TIMP1, an inhibitory factor, was increased (FIGS. 9 to 11).
  • the exosomes according to the present invention can target hepatic stellate cells through surface-expressed hepatic stellate cell-specific factors and reduce the expression of fibrotic factors in the liver through internally introduced anti-fibrotic miRNAs. and inhibit tissue fibrosis. Therefore, since the exosome according to the present invention can exhibit an anti-fibrotic function specifically for hepatic stellate cells, it is expected to be used as a therapeutic agent for various liver diseases related to liver fibrosis.
  • the extracellular vesicles of the present invention are obtained from cells transformed with a gene targeting hepatic stellate cells, and are characterized in that peptides specific to hepatic stellate cell receptors are expressed on the surface.
  • hepatic fibrosis-inhibiting nucleic acids can be introduced into the extracellular vesicles of the present invention, wherein the nucleic acid-introduced extracellular vesicles specifically act on hepatic stellate cells to suppress the expression of liver fibrosis-promoting factors, May reduce inflammation in tissues. Therefore, since the extracellular vesicles of the present invention can inhibit fibrosis by targeting the liver, it can be used for the treatment of various liver diseases such as liver fibrosis and liver cirrhosis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Cell Biology (AREA)
  • Veterinary Medicine (AREA)
  • Microbiology (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Developmental Biology & Embryology (AREA)
  • Hematology (AREA)
  • Virology (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Rheumatology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 발명의 세포외소포체는 간성상세포 표적화 유전자로 형질전환된 세포로부터 수득된 것으로서, 표면에 간성상세포의 수용체에 특이적인 펩타이드가 발현된 것을 특징으로 한다. 특히, 본 발명의 세포외소포체에는 간섬유화 억제성 핵산이 도입될 수 있는 바, 상기 핵산이 도입된 세포외소포체는 간성상세포에 특이적으로 작용하여 간섬유화 촉진 인자들의 발현을 억제하고, 간조직 내 염증을 감소시킬 수 있다. 따라서 본 발명의 세포외소포체는 간을 표적화하여 섬유화를 억제할 수 있으므로, 간섬유화 및 간경화 등 다양한 간질환의 치료에 활용될 수 있다.

Description

간세포 표적화 엑소좀 및 이의 간질환의 예방 또는 치료를 위한 용도
본 발명은 간세포 특이적 엑소좀을 유효성분으로 포함하는, 간질환의 예방 또는 치료용 약학적 조성물 등에 관한 것이다.
본 발명은 2021년 9월 14일에 출원된 한국특허출원 제10-2021-0122642호에 기초한 우선권을 주장하며, 상기 출원의 명세서 및 도면에 개시된 모든 내용은 본 출원에 원용된다.
간섬유화 (Liver fibrosis)는 만성 간내 염증으로 인한 세포외 기질 (extracellular matrix)의 과다한 침착으로 정의될 수 있으며 이러한 세포외 기질의 과다한 침착으로 만성간질환이 지속되는 경우 결국은 간내 구조의 변형과 간세포수의 감소로 간경변으로 진행된다.
간섬유화는 만성간염이 지속되면서 염증과 치유를 반복하고 그에 대한 수복현상(Reparation)으로 발생하는 것으로, 섬유화가 더욱 진행되면 간경변으로 진행된다. 간섬유화 및 간경변 진단에 최적의 방법은 간조직 생검으로 알려져 있으나, 침습적이고 통증과 출혈을 동반하여 혈액응고 장애의 한계가 존재한다.
엑소좀은 그 크기가 30-100nm에 불과하지만, 원세포에 들어있는 단백질, 핵산, 지질 등 여러 물질을 포함하고 있는 물질로서, 면역세포나 줄기세포 등 우리 지방유래줄기세포가 분비하는 나노입자이다. 엑소좀의 세포간 정보 전달체 역할을 하는 기능이 알려지면서 차세대 항암물질로 주목받고 있다.
이에, 본 발명자들은 세포외소포체 (EV: extracellular vesicle)를 이용하여 miRNA를 활성화된 간섬유화세포 (HSCs: hepatic stellate cells)에 전달함으로써 활성화된 간섬유화세포를 억제시켜 간섬유화를 효율적으로 저해하는 신규 표적요법을 구축함으로써, 본 발명을 완성하였다.
본 발명의 목적은 간성상세포의 수용체에 특이적인 펩타이드가 표면에 발현된 세포외소포체를 유효성분으로 포함하는, 간질환의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
본 발명의 다른 목적은 상기 세포외소포체 또는 상기 약학적 조성물의 제조방법을 제공하는 것이다.
그러나, 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 본 발명이 속하는 기술 분야의 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.
본 발명은 간성상세포의 수용체에 특이적인 펩타이드 (즉, 간성상세포의 수용체에 특이적으로 결합하는 펩타이드)가 표면에 발현된 세포외소포체를 유효성분으로 포함하는, 간질환의 예방 또는 치료용 약학적 조성물을 제공한다.
또한, 본 발명은 상기 세포외소포체 또는 이를 포함하는 조성물의 간질환의 예방 또는 치료 용도를 제공한다.
또한, 본 발명은 상기 세포외소포체 또는 이를 포함하는 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 간질환의 예방 또는 치료방법을 제공한다.
또한, 본 발명은 간질환의 치료제를 제조하기 위한 상기 세포외소포체 또는 이를 포함하는 조성물의 용도를 제공한다.
본 발명의 일 구현예에서, 상기 간성상세포의 수용체는 PDGFR (Platelet Derived Growth Factor Receptor)일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 다른 구현예에서, 상기 펩타이드는 서열번호 1의 핵산 서열을 포함하는 폴리뉴클레오티드로부터 발현되는 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 세포외소포체는 상기 간성상세포의 수용체에 특이적인 펩타이드를 코딩하는 유전자가 삽입된 재조합 벡터로 형질전환된 세포로부터 수득된 것일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 세포는 줄기세포, 골수유래줄기세포, 제대혈유래줄기세포, 및 지방유래줄기세포로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 세포는 인체 또는 동물 유래 세포일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 세포외소포체는 엑소좀일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 세포외소포체는 간 섬유화-촉진 유전자의 발현을 억제하는 핵산을 더 포함할 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 핵산은 상기 간섬유화-촉진 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 안티센스 올리고뉴클레오티드, 작은 간섭 RNA (siRNA), 짧은 헤어핀 RNA (shRNA), 마이크로RNA (miRNA), RNA 간섭 (RNAi), 및 리보자임 (ribozyme) 분자로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 간섬유화-촉진 유전자는 Collagen I, Collagen II, α-SMA, 및 MMP 코딩 유전자로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
본 발명의 또 다른 구현예에서, 상기 간질환은 간섬유증, 간경화, 급성간염, 만성간염, 및 간암으로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되는 것은 아니다.
또한, 본 발명은 (S1) 세포를 간성상세포의 수용체에 특이적인 펩타이드를 코딩하는 유전자가 삽입된 재조합 벡터로 형질전환 시키는 단계;
(S2) 상기 형질전환된 세포의 배양액으로부터 세포외소포체를 수득하는 단계; 및
(S3) 상기 세포외소포체에 간섬유화-촉진 유전자의 발현을 억제하는 핵산을 도입하는 단계를 포함하는, 간성상세포 특이적 세포외소포체의 제조방법으로서,
상기 세포외소포체는 상기 간성상세포의 수용체에 특이적인 펩타이드가 발현된 것을 특징으로 하는, 제조방법을 제공한다.
본 발명의 일 구현예에서, 상기 세포외소포체는 엑소좀일 수 있으나, 이에 한정되지 않는다.
본 발명의 다른 구현예에서, 상기 세포외소포체는 간질환의 예방 또는 치료에 사용되기 위한 것일 수 있으나, 이에 한정되지 않는다.
본 발명의 줄기세포의 세포외소포체로 발현되는 유전자 내에 간성상세포의 수용체와 결합하는 펩타이드를 발현시키는 유전자가 삽입된 재조합 발현벡터로 형질전환된 세포외소포체를 포함하는 약학적 조성물은 간질환 예방 또는 치료용 약학적 조성물로 유용할 수 있다. 따라서, 상기 약학적 조성물은 간섬유화 치료 분야, 특히 임상적 적용 기술로 응용될 수 있다.
도 1은 활성화된 간성상세포 (HSC)에 의해 간섬유화가 유도되는 과정 및 본 발명에 따른 세포외소포체 (엑소좀)의 간섬유화 개선 매커니즘을 나타낸 그림이다. 본 발명의 세포외소포체는 HSC 표면 수용체-특이적 펩타이드를 발현하는 재조합 벡터로 형질전환된 세포로부터 수득되므로 표면에 상기 펩타이드가 발현되며, 내부에는 항섬유화 miRNA (antifibrogenic miRNA)가 탑재될 수 있으므로, 간성상세포에 특이적으로 작용하여 섬유화 촉진 유전자들의 발현을 억제할 수 있다.
도 2는 본 발명의 엑소좀의 구조 분석을 위하여 투과전자현미경(TEM) 결과를 나타낸 것이다.
도 3은 본 발명의 엑소좀을 유세포분석기 (FACS)을 이용하여 분석한 결과를 나타낸 것이다.
도 4는 간성상세포에 본 발명에 따른 엑소좀을 처리한 후 간섬유화 유도 인자들의 발현 수준을 확인한 결과이다.
도 5는 간성상세포에 본 발명에 따른 엑소좀을 처리한 후 간섬유화 유도 인자들의 발현 수준을 정량적으로 확인한 결과이다.
도 6은 BALB/C Nude mouse에 TAA를 복강주사에 의하여 구축된 간병변 모델에 본 발명의 엑소좀을 처리한 후 간섬유화 관련 유전자 발현 변화를 나타낸 것이다.
도 7은 BALB/C Nude mouse에 TAA를 복강주사에 의하여 구축된 간병변 모델에 본 발명의 엑소좀을 처리한 후 간의 외형을 관찰한 결과이다.
도 8은 BALB/C Nude mouse에 TAA를 복강주사에 의하여 구축된 간병변 모델에 본 발명의 엑소좀을 처리한 후 간 조직을 Masson staining하여 섬유화 정도를 확인한 결과이다.
도 9은 BALB/C Nude mouse에 TAA를 복강주사에 의하여 구축된 간병변 모델에서 본 발명의 엑소좀을 처리한 후 COL1A1 유전자 발현 양상을 확인한 결과이다.
도 10은 BALB/C Nude mouse에 TAA를 복강주사에 의하여 구축된 간병변 모델에서 본 발명의 엑소좀을 처리한 후 α-SMA 유전자 발현 양상을 확인한 결과이다.
도 11은 BALB/C Nude mouse에 TAA를 복강주사에 의하여 구축된 간병변 모델에서 본 발명의 엑소좀을 처리한 후 TIMP1 유전자 발현 양상을 확인한 결과이다.
본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다.
본 발명의 일 측면은 간성상세포의 수용체에 특이적인 펩타이드가 표면에 발현된 세포외소포체를 유효성분으로 포함하는, 간질환의 예방 또는 치료용 약학적 조성물을 제공한다.
본 발명에 있어서, 상기 세포외소포체는 상기 간성상세포 수용체에 특이적인 펩타이드를 코딩하는 유전자가 삽입된 재조합 벡터로 형질전환된 세포로부터 수득된 것일 수 있다. 본 발명의 다른 구현예에서, 상기 세포외소포체는 세포 (특히, 줄기세포)의 세포외소포체로 발현되는 유전자 내에 간성상세포의 수용체와 결합하는 펩타이드를 발현시키는 유전자가 삽입된 재조합 발현벡터로 형질전환된 세포로부터 수득된 것일 수 있다.
본 발명에서의 "발현벡터"는 선형 DNA 벡터, 플라스미드 DNA 벡터 및 재조합 바이러스 벡터로 이루어진 군에서 선택될 수 있으나, 이에 제한되는 것은 아니며 당업계에서 형질전환을 위해 사용되는 통상적인 벡터들은 모두 본 발명의 방법에 사용될 수 있다. 본 발명의 일 구체예에 있어서, 상기　발현벡터는 pDisplay 벡터일 수 있다.
본 발명에서의 "세포외소포체"는 세포에서 유래되는 막으로 둘러싸인 작은 구체를 의미하는 것으로, 상기 세포외소포체는 자연계, 예컨대 식물, 동물, 미생물로부터 유래된 세포외 소포체 또는 인공적으로 제조된 세포외소포체일 수 있다. 또한, 상기 세포는 자연계 생물 개체로부터 분리된 세포인 것일 수 있다.
상기 "세포외소포체"는 엑소좀(exosome), 엑토솜(ectosome) 또는 미세소포(microvesicle)일 수 있다. 바람직하게는, 상기 "세포외소포체"는 엑소좀일 수 있다.
본 발명에서의 "엑소좀"은 다양한 세포들로부터 분비되는 막 구조의 작은 소낭으로서, 다낭체와 원형질막의 융합이 일어나 세포 밖 환경으로 방출되는 소낭을 의미한다. 본 발명의 일 구체예에 있어서, 상기　엑소좀은 면역세포, 줄기세포, 골수유래줄기세포, 제대혈유래줄기세포, 및 지방유래줄기세포로 이루어진 군에서 선택된 하나 이상으로부터 유래하거나 분리된 것일 수 있다.
본 발명의 일 구체예에 있어서, 상기　엑소좀은 50 내지 300 nm, 50 내지 200 nm, 또는 50 내지 150 nm 의 직경을 갖는 것일 수 있다. 또한, 상기 조성물 내에서 상기 세포외소포체는 1 내지 50 μL/ml, 1 내지 30 μL/ml, 또는 1 내지 10 μL/ml 의 농도로 포함될 수 있다.
본 발명에서의 "줄기세포(stem cells)"는 미분화 상태에서 적절한 조건을 맞춰주면 다양한 조직 세포로 분화될 수 있는 만능세포로서 다양한 유래의 세포를 의미한다.
상기 줄기세포는 골수유래줄기세포, 제대혈유래줄기세포 또는 지방유래줄기세포일 수 있다. 본 발명의 일 구체예에 있어서, 상기　줄기세포는 지방유래줄기세포일 수 있다. 또한, 상기 골수유래줄기세포, 제대혈유래줄기세포 또는 지방유래줄기세포는 인체 또는 동물유래 줄기세포인 것일 수 있다.
본 발명에서의 "지방유래줄기세포"는 지방 조직으로부터 유래한 줄기세포로서, 다분화능 및 자기증식능을 가진 세포를 의미하며, 본 발명의 지방유래줄기세포는 지방흡입술 및 다양한 외과적 수술을 통해 수득할 수 있으나, 이에 한정되지 않는다.
본 발명의 일 구체예에 있어서, 상기　엑소좀은 줄기세포 등 호스트세포의 엑소좀으로 발현하는 유전자 내에 간성상세포(HSC, hepatic stellate cell)의 수용체와 결합하는 펩타이드를 발현시키도록 형질전환되어 간성상세포에 표적으로 작용할 수 있는 것을 의미한다.
즉, 본 발명에 따른 세포외소포체는 간성상세포 수용체에 특이적으로 결합되는 펩타이드가 표면에 발현된 것일 수 있으며, 상기 펩타이드를 통해 간성상세포를 표적화 (targeting) 할 수 있다.
상기 간성상세포 수용체는 간성상세포에서 특이적으로 발현되거나, 기타 세포에 비해 간성상세포에서 특히 높은 수준으로 발현되는 단백질이라면 제한 없이 포함될 수 있으나, 바람직하게는 PDGFR (Platelet Derived Growth Factor Receptor)일 수 있다.
본 발명의 일 구현예에서, 상기 펩타이드는 서열번호 1의 핵산 서열을 포함하는 폴리뉴클레오티드로부터 발현되는 것일 수 있다.
본 발명에 있어서 특정 서열번호로 표시되는 핵산 서열로 이루어진 폴리뉴클레오티드는 해당 핵산 서열에만 제한되지 않으며, 상기 핵산 서열의 변이체가 본 발명의 범위 내에 포함된다. 본 발명의 핵산 서열의 폴리뉴클레오티드 분자는 이를 구성하는 폴리뉴클레오티드 분자의 작용성 등가물, 예를 들어, 폴리펩티드 분자의 일부 염기 서열이 결실(deletion), 치환(substitution) 또는 삽입(insertion)에 의해 변형되었지만, 해당 폴리뉴클레오티드와 기능적으로 동일한 작용을 할 수 있는 변이체 (variants)를 포함하는 개념이다. 구체적으로, 본 발명에 개시된 폴리뉴클레오티드는 특정 서열번호로 표시되는 핵산 서열과 각각 70% 이상, 더욱 바람직하게는 80% 이상, 더 더욱 바람직하게는 90% 이상, 가장 바람직하게는 95% 이상의 서열 상동성을 가지는 아미노산 서열(핵산 서열)을 포함할 수 있다. 예를 들면, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%의 서열 상동성을 갖는 폴리뉴클레오티드를 포함한다. 폴리뉴클레오티드에 대한 “서열 상동성의 %”는 두 개의 최적으로 배열된 서열과 비교 영역을 비교함으로써 확인되며, 비교 영역에서의 폴리뉴클레오티드 서열의 일부는 두 서열의 최적 배열에 대한 참고 서열 (추가 또는 삭제를 포함하지 않음)에 비해 추가 또는 삭제 (즉, 갭)를 포함할 수 있다.
또한, 본 발명의 일 구체예에 있어서, 상기 엑소좀은 간섬유화 유발 유전자의 발현을 억제시킬 수 있는 핵산 (즉, 항섬유화 핵산)이 형질주입된 것일 수 있다. 즉, 세포외소포체는 간섬유화-촉진 유전자의 발현을 억제하는 핵산을 더 포함할 수 있다. 상기 핵산은 간섬유화 유발 유전자의 발현을 억제시킬 수 있는 핵산으로서, 간섬유화 유전자를 발현하는 핵산과 결합 또는 간섬유화 유전자와 직접 결합하여 발현을 억제시키는 방식으로 간섬유화 유발 유전자의 발현을 억제시킬 수 있다. 본 발명의 세포외소포체는 상기 핵산을 통해 간세포에 의한 섬유화 촉진 인자 생성을 억제하고, 간 조직 내 섬유화를 감소시킬 수 있다.
본 발명에서의 "형질주입"은 동물세포에 DNA 또는 RNA를 직접 도입하여 세포의 유전형질을 변이시키는 방법을 의미하며, 이는 당해 기술분야에 공지된 방법, 예를 들어, 칼슘 인산염　형질주입법(calcium phosphate transfection), 리포펙션법(lipofection), 전기천공법(electroporation), 미량주사법(microinjection), 마이크로프로젝틸법(microprojectile)을 이용할 수 있으나, 이에 제한되지 않는다. 진핵생물의 경우 DNA인산칼슘침전법 또는 리포펙션, PEI 등의 상품화된 시약과 DNA를 혼합하여 세포를 처리하는 방법을 이용할 수 있다.
본 발명에 따른 항섬유화 핵산은 상기 공지된 방법을 통해 세포외소포체 내로 도입되어 항섬유화 활성을 발휘할 수 있다.
상기 핵산은 상기 간섬유화-촉진 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 안티센스 올리고뉴클레오티드, 작은 간섭 RNA (siRNA), 짧은 헤어핀 RNA (shRNA), 마이크로RNA (miRNA), RNA 간섭 (RNAi), 및 리보자임 (ribozyme) 분자로 이루어진 군에서 선택된 하나 이상일 수 있으나, 이에 한정되지 않는다. 바람직하게는, 상기 핵산은 miRNA 및 siRNA로 이루어진 군으로부터 선택된 하나 이상의 핵산을 포함한다. 상기 핵산은 간섬유화를 촉진하는 유전자의 활성 또는 발현을 억제할 수 있는 것이라면 제한 없이 포함되나, 바람직하게는 miR-150일 수 있다.
또한, 본 발명은 (a) 지방유래줄기세포의 세포외소포체로 발현되는 유전자 내에 간성상세포의 수용체와 결합하는 펩타이드를 발현시키는 유전자를 도입하는 단계; (b) 상기 유전자가 도입된 세포를 배지에서 배양하여 세포외소포체를 수득하는 단계; 및 (c) 상기 수득된 세포외소포체에 간섬유화 유발 유전자의 발현을 억제시킬 수 있는 핵산을 형질주입시키는 단계;를 포함하는 간질환 예방 또는 치료용 발현벡터 제조방법을 제공한다.
혹은, 본 발명은 (S1) 세포를 간성상세포 수용체에 특이적인 펩타이드를 코딩하는 유전자가 삽입된 재조합 벡터로 형질전환 시키는 단계;
(S2) 상기 형질전환된 세포의 배양액으로부터 세포외소포체를 수득하는 단계; 및
(S3) 상기 세포외소포체에 간섬유화-촉진 유전자의 발현을 억제하는 핵산을 도입하는 단계를 포함하는, 간성상세포 특이적 세포외소포체의 제조방법으로서,
상기 세포외소포체는 상기 간성상세포 수용체에 특이적인 펩타이드가 발현된 것을 특징으로 하는, 제조방법을 제공한다.
본 발명에서의 "세포외소포체"는 엑소좀(exosome), 엑토솜(ectosome) 또는 미세소포(microvesicle)일 수 있으나, 본 발명의 일 구체예에 있어서, 상기 "세포외소포체"는 엑소좀일 수 있다.
본 발명에서의 "배지"는 지방유래줄기세포 배양배지일 수 있다. 본 발명의 일 구체예에 있어서, 상기 지방유래줄기세포 배양배지는 지방유래줄기세포를 FBS(inactivated fetal bovine serum) 및 P/S(penicillin-streptomycin)을 첨가한 DMEM high low glucose 배지 또는 FBS-Free DMEM low glucose로 배지일 수 있다.
본 발명의 약학적 조성물이 치료, 예방, 개선할 수 있는 상기 간질환은 이에 제한되지는 않으나, 간섬유증, 간경화, 급성간염, 만성간염 또는 간암일 수 있으며, 바람직하게는 간섬유증 또는 간경화 일 수 있다.
본 발명의 조성물 내의 상기 세포외소포체의 함량은 질환의 증상, 증상의 진행 정도, 환자의 상태 등에 따라서 적절히 조절 가능하며, 예컨대, 전체 조성물 중량을 기준으로 0.0001 내지 99.9중량%, 또는 0.001 내지 50중량%일 수 있으나, 이에 한정되는 것은 아니다. 상기 함량비는 용매를 제거한 건조량을 기준으로 한 값이다.
본 발명에 따른 약학적 조성물은 약학적 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 및 희석제를 더 포함할 수 있다. 상기 부형제는 예를 들어, 희석제, 결합제, 붕해제, 활택제, 흡착제, 보습제, 필름-코팅 물질, 및 제어방출첨가제로 이루어진 군으로부터 선택된 하나 이상일 수 있다.
본 발명에 따른 약학적 조성물은, 각각 통상의 방법에 따라 산제, 과립제, 서방형 과립제, 장용과립제, 액제, 점안제, 엘실릭제, 유제, 현탁액제, 주정제, 트로키제, 방향수제, 리모나아데제, 정제, 서방형정제, 장용정제, 설하정, 경질캅셀제, 연질캅셀제, 서방캅셀제, 장용캅셀제, 환제, 틴크제, 연조엑스제, 건조엑스제, 유동엑스제, 주사제, 캡슐제, 관류액, 경고제, 로션제, 파스타제, 분무제, 흡입제, 패취제, 멸균주사용액, 또는에어로졸 등의 외용제 등의 형태로 제형화하여 사용될 수 있으며, 상기 외용제는 크림, 젤, 패치, 분무제, 연고제, 경고제, 로션제, 리니멘트제, 파스타제 또는 카타플라스마제 등의 제형을 가질 수 있다.
본 발명에 따른 약학적 조성물에 포함될 수 있는 담체, 부형제 및 희석제로는 락토즈, 덱스트로즈, 수크로스, 올리고당, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말티톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로오스, 미정질 셀룰로오스, 폴리비닐 피롤리돈, 물, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 탈크, 마그네슘 스테아레이트 및 광물유를 들 수 있다.
제제화할 경우에는 보통 사용하는 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제된다.
본 발명에 따른 정제, 산제, 과립제, 캡슐제, 환제, 트로키제의 첨가제로 옥수수전분, 감자전분, 밀전분, 유당, 백당, 포도당, 과당, 디-만니톨, 침강탄산칼슘, 합성규산알루미늄, 인산일수소칼슘, 황산칼슘, 염화나트륨, 탄산수소나트륨, 정제 라놀린, 미결정셀룰로오스, 덱스트린, 알긴산나트륨, 메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 카올린, 요소, 콜로이드성실리카겔, 히드록시프로필스타치, 히드록시프로필메칠셀룰로오스(HPMC) 1928, HPMC 2208, HPMC 2906, HPMC 2910, 프로필렌글리콜, 카제인, 젖산칼슘, 프리모젤 등 부형제; 젤라틴, 아라비아고무, 에탄올, 한천가루, 초산프탈산셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스칼슘, 포도당, 정제수, 카제인나트륨, 글리세린, 스테아린산, 카르복시메칠셀룰로오스나트륨, 메칠셀룰로오스나트륨, 메칠셀룰로오스, 미결정셀룰로오스, 덱스트린, 히드록시셀룰로오스, 히드록시프로필스타치, 히드록시메칠셀룰로오스, 정제쉘락, 전분호, 히드록시프로필셀룰로오스, 히드록시프로필메칠셀룰로오스, 폴리비닐알코올, 폴리비닐피롤리돈 등의 결합제가 사용될 수 있으며, 히드록시프로필메칠셀룰로오스, 옥수수전분, 한천가루, 메칠셀룰로오스, 벤토나이트, 히드록시프로필스타치, 카르복시메칠셀룰로오스나트륨, 알긴산나트륨, 카르복시메칠셀룰로오스칼슘, 구연산칼슘, 라우릴황산나트륨, 무수규산, 1-히드록시프로필셀룰로오스, 덱스트란, 이온교환수지, 초산폴리비닐, 포름알데히드처리 카제인 및 젤라틴, 알긴산, 아밀로오스, 구아르고무(Guar gum), 중조, 폴리비닐피롤리돈, 인산칼슘, 겔화전분, 아라비아고무, 아밀로펙틴, 펙틴, 폴리인산나트륨, 에칠셀룰로오스, 백당, 규산마그네슘알루미늄, 디-소르비톨액, 경질무수규산 등 붕해제; 스테아린산칼슘, 스테아린산마그네슘, 스테아린산, 수소화식물유(Hydrogenated vegetable oil), 탈크, 석송자, 카올린, 바셀린, 스테아린산나트륨, 카카오지, 살리실산나트륨, 살리실산마그네슘, 폴리에칠렌글리콜(PEG) 4000, PEG 6000, 유동파라핀, 수소첨가대두유(Lubri wax), 스테아린산알루미늄, 스테아린산아연, 라우릴황산나트륨, 산화마그네슘, 마크로골(Macrogol), 합성규산알루미늄, 무수규산, 고급지방산, 고급알코올, 실리콘유, 파라핀유, 폴리에칠렌글리콜지방산에테르, 전분, 염화나트륨, 초산나트륨, 올레인산나트륨, dl-로이신, 경질무수규산 등의 활택제;가 사용될 수 있다.
본 발명에 따른 액제의 첨가제로는 물, 묽은 염산, 묽은 황산, 구연산나트륨, 모노스테아린산슈크로스류, 폴리옥시에칠렌소르비톨지방산에스텔류(트윈에스텔), 폴리옥시에칠렌모노알킬에텔류, 라놀린에텔류, 라놀린에스텔류, 초산, 염산, 암모니아수, 탄산암모늄, 수산화칼륨, 수산화나트륨, 프롤아민, 폴리비닐피롤리돈, 에칠셀룰로오스, 카르복시메칠셀룰로오스나트륨 등이 사용될 수 있다.
본 발명에 따른 시럽제에는 백당의 용액, 다른 당류 혹은 감미제 등이 사용될 수 있으며, 필요에 따라 방향제, 착색제, 보존제, 안정제, 현탁화제, 유화제, 점조제 등이 사용될 수 있다.
본 발명에 따른 유제에는 정제수가 사용될 수 있으며, 필요에 따라 유화제, 보존제, 안정제, 방향제 등이 사용될 수 있다.
본 발명에 따른 현탁제에는 아카시아, 트라가칸타, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 카르복시메칠셀룰로오스나트륨, 미결정셀룰로오스, 알긴산나트륨, 히드록시프로필메칠셀룰로오스(HPMC), HPMC 1828, HPMC 2906, HPMC 2910 등 현탁화제가 사용될 수 있으며, 필요에 따라 계면활성제, 보존제, 안정제, 착색제, 방향제가 사용될 수 있다.
본 발명에 따른 주사제에는 주사용 증류수, 0.9% 염화나트륨주사액, 링겔주사액, 덱스트로스주사액, 덱스트로스+염화나트륨주사액, 피이지(PEG), 락테이티드 링겔주사액, 에탄올, 프로필렌글리콜, 비휘발성유-참기름, 면실유, 낙화생유, 콩기름, 옥수수기름, 올레인산에칠, 미리스트산 이소프로필, 안식향산벤젠과 같은 용제; 안식향산나트륨, 살리실산나트륨, 초산나트륨, 요소, 우레탄, 모노에칠아세트아마이드, 부타졸리딘, 프로필렌글리콜, 트윈류, 니정틴산아미드, 헥사민, 디메칠아세트아마이드와 같은 용해보조제; 약산 및 그 염(초산과 초산나트륨), 약염기 및 그 염(암모니아 및 초산암모니움), 유기화합물, 단백질, 알부민, 펩 톤, 검류와 같은 완충제; 염화나트륨과 같은 등장화제; 중아황산나트륨(NaHSO3) 이산화탄소가스, 메타중아황산나트륨(Na2S2O5), 아황산나트륨(Na2SO3), 질소가스(N2), 에칠렌디아민테트라초산과 같은 안정제; 소디움비설파이드 0.1%, 소디움포름알데히드 설폭실레이트, 치오우레아, 에칠렌디아민테트라초산디나트륨, 아세톤소디움비설파이트와 같은 황산화제; 벤질알코올, 클로로부탄올, 염산프로카인, 포도당, 글루콘산칼슘과 같은 무통화제; 시엠시나트륨, 알긴산나트륨, 트윈 80, 모노스테아린산알루미늄과 같은 현탁화제를 포함할 수 있다.
본 발명에 따른 좌제에는 카카오지, 라놀린, 위텝솔, 폴리에틸렌글리콜, 글리세로젤라틴, 메칠셀룰로오스, 카르복시메칠셀룰로오스, 스테아린산과 올레인산의 혼합물, 수바날(Subanal), 면실유, 낙화생유, 야자유, 카카오버터+콜레스테롤, 레시틴, 라네트왁스, 모노스테아린산글리세롤, 트윈 또는 스판, 임하우젠(Imhausen), 모놀렌(모노스테아린산프로필렌글리콜), 글리세린, 아뎁스솔리두스(Adeps solidus), 부티룸 태고-G(Buytyrum Tego-G), 세베스파마 16 (Cebes Pharma 16), 헥사라이드베이스 95, 코토마(Cotomar), 히드록코테 SP, S-70-XXA, S-70-XX75(S-70-XX95), 히드록코테(Hydrokote) 25, 히드록코테 711, 이드로포스탈 (Idropostal), 마사에스트라리움(Massa estrarium, A, AS, B, C, D, E, I, T), 마사-MF, 마수폴, 마수폴-15, 네오수포스탈-엔, 파라마운드-B, 수포시로(OSI, OSIX, A, B, C, D, H, L), 좌제기제 IV 타입 (AB, B, A, BC, BBG, E, BGF, C, D, 299), 수포스탈 (N, Es), 웨코비 (W, R, S, M ,Fs), 테제스터 트리글리세라이드 기제 (TG-95, MA, 57)와 같은 기제가 사용될 수 있다.
경구 투여를 위한 고형제제에는 정제, 환제, 산제, 과립제, 캡슐제 등이 포함되며, 이러한 고형제제는 상기 추출물에 적어도 하나 이상의 부형제 예를 들면, 전분, 칼슘카보네이트(calcium carbonate), 수크로스(sucrose) 또는 락토오스(lactose), 젤라틴 등을 섞어 조제된다. 또한 단순한 부형제 이외에 마그네슘 스티레이트 탈크 같은 윤활제들도 사용된다.
경구 투여를 위한 액상제제로는 현탁제, 내용액제, 유제, 시럽제 등이 해당되는데 흔히 사용되는 단순희석제인 물, 리퀴드 파라핀 이외에 여러 가지 부형제, 예를 들면 습윤제, 감미제, 방향제, 보존제 등이 포함될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조제제, 좌제가 포함된다. 비수성용제, 현탁제로는 프로필렌글리콜 (propylene glycol), 폴리에틸렌 글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다.
본 발명에 따른 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 본 발명에 있어서, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효용량 수준은 환자 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
본 발명에 따른 약학적 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여 투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있으며, 단일 또는 다중 투여될 수 있다. 상기한 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 본 발명이 속하는 기술분야에 통상의 기술자에 의해 용이하게 결정될 수 있다.
본 발명의 약학적 조성물은 개체에게 다양한 경로로 투여될 수 있다. 투여의 모든 방식은 예상될 수 있는데, 예를 들면, 경구 복용, 피하 주사, 복강 투여, 정맥 주사, 근육 주사, 척수 주위 공간(경막내) 주사, 설하 투여, 볼점막 투여, 직장 내 삽입, 질 내 삽입, 안구 투여, 귀 투여, 비강 투여, 흡입, 입 또는 코를 통한 분무, 피부 투여, 경피 투여 등에 따라 투여될 수 있다.
본 발명의 약학적 조성물은 치료할 질환, 투여 경로, 환자의 연령, 성별, 체중 및 질환의 중등도 등의 여러 관련 인자와 함께 활성성분인 약물의 종류에 따라 결정된다. 구체적으로, 본 발명에 따른 조성물의 유효량은 환자의 나이, 성별, 체중에 따라 달라질 수 있으며, 일반적으로는 체중 1 kg 당 0.001 내지 150 mg, 바람직하게는 0.01 내지 100 mg을 매일 또는 격일 투여하거나 1일 1 내지 3회로 나누어 투여할 수 있다. 그러나 투여 경로, 질환의 중증도, 성별, 체중, 연령 등에 따라서 증감될 수 있으므로 상기 투여량이 어떠한 방법으로도 본 발명의 범위를 한정하는 것은 아니다.
본 발명에서 “개체”란 질병의 치료를 필요로 하는 대상을 의미하고, 보다 구체적으로는 인간 또는 비-인간인 영장류, 생쥐 (mouse), 쥐 (rat), 개, 고양이, 말, 및 소 등의 포유류를 의미한다.
본 발명에서 “투여”란 임의의 적절한 방법으로 개체에게 소정의 본 발명의 조성물을 제공하는 것을 의미한다.
본 발명에서 “예방”이란 목적하는 질환의 발병을 억제하거나 지연시키는 모든 행위를 의미하고, “치료”란 본 발명에 따른 약학적 조성물의 투여에 의해 목적하는 질환과 그에 따른 대사 이상 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미하며, “개선”이란 본 발명에 따른 조성물의 투여에 의해 목적하는 질환과 관련된 파라미터, 예를 들면 증상의 정도를 감소시키는 모든 행위를 의미한다.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하고자 한다. 이들 실시예는 오로지 본 발명을 예시하기 위한 것으로서, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지 않는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.
실시예 1. 간성상세포를 표적으로 하는 지방유래줄기세포 유래 엑소좀의 제조
지방유래줄기세포를 사용하여 간성상세포를 특이적 타겟으로 하는 엑소좀을 제조하였다. 참고로, 지방유래줄기세포는 엑소좀을 생산하기 위한 donor cell로서 사용된 것에 불과하며, 지방유래줄기세포 외에 NK세포와 같은 면역세포도 엑소좀 제조를 위한 donor cell로 사용 가능하다. 따라서, 엑소좀을 제조하기 위한 세포의 종류는 지방유래줄기세포 등 특정 세포 종류에 한정되는 것은 아니다.
먼저, 간성상세포의 수용체를 표적하는 펩타이드를 발현하는 엑소좀을 수득하기 위해, 상기 펩타이드를 발현하는 재조합 벡터로 지방유래줄기세포를 형질전환시켰다. 먼저 pDisplay 벡터 (invitrogen)에 간성상세포 (HSC)의 PDGFR (Platelet Derived Growth Factor Receptor)를 표적하는 펩타이드를 인코딩하는 유전자 서열 (TGCTCCCGGAATCTCATAGACTGT; 서열번호 1)을 삽입하여 재조합 벡터를 제조하였으며, 형질감염시약 (lipofectamine, invitrogen)을 제조사의 지침에 따라 사용하여 지방유래줄기세포를 상기 재조합 벡터로 형질전환시켰다.
상기와 같이 형질전환된 지방유래줄기세포는 PDGFR 표적 펩타이드를 발현하며, 상기 재조합 단백질이 표면에 발현된 엑소좀을 생성한다. 상기 엑소좀은 PDGFR 표적 펩타이드를 통해 간성상세포를 타겟할 수 있다. 따라서, 형질전환된 지방유래줄기세포로부터 상기 엑소좀을 추출하였다. 구체적으로, 형질전환된 지방유래줄기세포를 10% FBS (inactivated fetal bovine serum) 및 1% P/S (penicillin-streptomycin)을 첨가한 DMEM low glucose 배지에서 37℃, 5% CO2 조건으로 배양하였다. 24시간 후 상기 배지를 FBS-Free DMEM low glucose로 배지를 교환하였으며, 배지 교환 24시간 후 배양 배지를 걷어 분별원심분리 (differential centrifugation) 방법으로 1000 rpm으로 원심분리하여 세포를 제거하였다. 이어서, 엑소좀 추출 키트 (Thermo Fisher scientific)를 사용하여 상기 세포가 제거된 배양 배지로부터 간성상세포를 표적하는 엑소좀을 추출하였다.
이어서, 상기 과정을 통해 수득한 표적 엑소좀에 항섬유화 miRNA의 대표예로서 miR150을 탑재하였다. Exosome transfection reagent인 Exo-Fect kit (SBI System biosciences)을 사용하여 상기 miRNA를 간성상세포 특이적 엑소좀 내에 형질주입하였다.
실시예 2. 간성상세포 특이적 엑소좀의 특성 분석
상기 실시예 1을 통해 수득한 간성상세포 특이적 엑소좀의 형태 및 특성을 관찰하였다. 구체적으로, 투과전자현미경 (TEM) 및 유세포분석기 (FACs)을 이용하여 엑소좀의 구조를 분석하였으며, 조혈모세포에 본 발명의 엑소좀을 처리하였을 때의 유전자 발현 양상을 유세포 분석기 (FACs)로 유전자 발현 양상을 관찰했다.
본 발명에 따른 간성상세포 특이적 엑소좀은 나노미터 단위의 미세한 구형 구조를 갖는 것을 확인할 수 있었다 (도 2). 또한, 유세포분석기를 이용하여 조혈모세포 내에서 세포사멸과 증식과 분화를 조절하는 인자인 c-Myc의 발현 양상을 관찰한 결과, 대조군 엑소좀 처리 대비, 본 발명의 간성상세포 특이적 엑소좀 처리 시 FITC-/PE-에서 FITC+/PE+로의 발현 향상이 변화하는 것을 확인하였다 (도 3).
실시예 3. 간성상세포에서의 지방유래줄기세포 유래 표적 엑소좀의 효능 평가
간 조직이 손상되면 간세포 (hepatocyte)나 쿠퍼세포에서 TGF-β가 분비되어 간 성상세포 (HSC)를 활성화시키며, 활성화된 간성상세포는 콜라젠 등을 생성하여 감섬유화를 유발한다.
항섬유화 miRNA가 도입된 간성상세포 특이적 엑소좀의 항암 효능을 평가하기 위해, 간성상세포에서 20ng/ml TGF-β1을 처리하여 간성상세포의 활성화를 유도하여 간경화증 유사 상태를 구현하였으며, 지방유래줄기세포 유래 간성상세포 특이적 엑소좀 (t-EV; PDGFR 특이적 펩타이드가 표면에 발현된 엑소좀), miR150이 형질주입된 간성상세포 특이적 엑소좀 (t-EV+miRNA150)을 각각 처리하여 섬유화 유발인자들의 변화를 확인하였다.
먼저, TGF-β1를 처리하지 않은 상태에서 대조군 엑소좀과 miR150이 도입된 엑소좀의 효과를 비교한 결과, TGF-β1처리시 간성상세포가 활성화되어 섬유화 인자들의 발현이 크게 증가하였으나, miR150이 형질주입된 표적 엑소좀 처리시 Collagen I 및 SMA와 같은 대표적 섬유화 인자들의 발현이 감소하는 것을 확인할 수 있었다 (도 4 및 5).
실시예 4. 간 손상 동물 모델에서 간성상세포 특이적 엑소좀의 간섬유화 억제 및 간경변 개선 효과
BALB/C Nude mouse (in vivo)에 티오아세트아미드 (thioacetamide; TAA) 200mg/ml를 복강주사하여 간병변 모델을 구축하였다. 상기 간 손상 동물모델에 본 발명에 따른 엑소좀을 처리하여 간섬유화 관련 유전자 발현 양상을 확인하고자 하였다.
그룹은 다음과 같이 나누었다: 일반적인 엑소좀 (Normal)을 처리한 대조군; PDGFR 표적 펩타이드를 발현하는 지방유래줄기세포 유래 엑소좀 투여군 (t-EV); miR150이 형질주입된, PDGFR 표적 펩타이드를 발현하는 지방유래줄기세포 유래 엑소좀 투여군 (t-EV+miR150); TAA 처리군 (TAA); TAA 및 t-EV 투여군 (TAA+t-EV); 및 TAA 및 t-EV+miR150 투여군 (TAA+t-EV+miR150). 각 성분은 상기 간경변 마우스에 Tail vein injection 방식으로 2주간 주입하였으며, 투여 스케쥴이 끝난 후 마우스를 희생하여 결과를 확인하였다.
그 결과, 도 6에 나타낸 바와 같이, miR150이 도입된 간성상세포 특이적 엑소좀을 처리한 그룹 (t-EV+miRNA150)은 기타 그룹에 비해 간섬유화 촉진 인자인 MMP의 발현이 감소하고, MMP 억제 인자인 TIMP의 발현은 증가한 것을 확인할 수 있었다.
또한, 마우스 모델들로부터 분리된 간의 외형을 관찰하였을 때에도, miR150이 도입된 간성상세포 특이적 엑소좀을 처리한 그룹 (t-EV+miRNA150)의 간은 기타 그룹에 비해 간경변이 확연하게 감소된 것을 확인할 수 있었다 (도 7).
실시예 5. 간 손상 동물 모델에서 간성상세포 특이적 엑소좀의 조직 섬유화 억제 효과
앞선 실시예와 마찬가지로 BALB/C Nude mouse (in vivo)에 티오아세트아미드 (thioacetamide; TAA) 200mg/ml를 복강주사하여 간병변 모델을 구축하였다. 상기 간 손상 동물모델에 본 발명에 따른 엑소좀을 처리한 후 간 조직의 섬유화 정도를 비교하였다.
간 섬유화 정도는 Masson 염색을 통해 관찰하였다. 대조군 엑소좀 (Ct); TAA; TAA 및 PDGFR 표적 펩타이드를 발현하는 지방유래줄기세포 유래 엑소좀 (TAA+Exo); 또는 TAA 및 miR150이 형질주입된, PDGFR 표적 펩타이드를 발현하는 지방유래줄기세포 유래 엑소좀 (TAA+Exo+miR150)이 투여된 각 마우스로부터 간 조직을 분리한 후, Masson 염색을 수행하여 간 조직의 섬유화 정도를 비교하였다. 그 결과, 도 8에 나타낸 바와 같이 다른 그룹에 비해 TAA+Exo+miR150 처리군에서 조직 섬유화가 현저히 억제된 것을 확인할 수 있었다.
실시예 6. 간 손상 동물 모델에서 지방유래줄기세포 유래 표적 엑소좀의 효능 평가
이어서, 간경변 동물모델에서 본 발명에 따른 엑소좀의 투여에 따른 간섬유화 관련 유전자 발현 양상을 IHC 염색을 통해 확인하였다.
앞선 실시예와 같이 대조군 엑소좀 (Ct), TAA, TAA+Exo, 및 TAA+Exo+miR150 각각을 간경변 마우스에 Tail vein injection 방식으로 2주간 주입하였으며, 마우스를 희생하여 결과를 확인하였다.
IHC로 섬유화 인자들을 염색한 결과, miR150이 도입된 간성상세포 특이적 엑소좀이 처리된 그룹은 기타 그룹에 비해 간 섬유화 인자인 COL1A1 및 α-SMA의 발현이 감소하고, 섬유화를 촉진하는 MMP의 억제 인자인 TIMP1은 발현이 증한 것을 확인할 수 있었다 (도 9 내지 도 11).
상기 실시예들은 본 발명에 따른 엑소좀이 표면에 발현된 간성상세포 특이적 인자를 통해 간성상세포를 타겟팅 할 수 있으며, 내부에 도입된 항-섬유화 miRNA를 통해 간에에서 섬유화 인자들의 발현을 감소시키고 조직 섬유화를 억제할 수 있음을 보여준다. 따라서, 본 발명에 따른 엑소좀은 간성상세포 특이적으로 항섬유화 기능을 발휘할 수 있으므로 간 섬유화와 관련된 다양한 간질환의 치료제로 활용될 것으로 기대된다.
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.
본 발명의 세포외소포체는 간성상세포 표적화 유전자로 형질전환된 세포로부터 수득된 것으로서, 표면에 간성상세포의 수용체에 특이적인 펩타이드가 발현된 것을 특징으로 한다. 특히, 본 발명의 세포외소포체에는 간섬유화 억제성 핵산이 도입될 수 있는 바, 상기 핵산이 도입된 세포외소포체는 간성상세포에 특이적으로 작용하여 간섬유화 촉진 인자들의 발현을 억제하고, 간조직 내 염증을 감소시킬 수 있다. 따라서 본 발명의 세포외소포체는 간을 표적화하여 섬유화를 억제할 수 있으므로, 간섬유화 및 간경화 등 다양한 간질환의 치료에 활용될 수 있다.

Claims (17)

  1. 간성상세포의 수용체에 특이적인 펩타이드가 표면에 발현된 세포외소포체를 유효성분으로 포함하는, 간질환의 예방 또는 치료용 약학적 조성물.
  2. 제1항에 있어서,
    상기 간성상세포의 수용체는 PDGFR (Platelet Derived Growth Factor Receptor)인 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  3. 제1항에 있어서,
    상기 펩타이드는 서열번호 1의 핵산 서열을 포함하는 폴리뉴클레오티드로부터 발현되는 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  4. 제1항에 있어서,
    상기 세포외소포체는 상기 간성상세포의 수용체에 특이적인 펩타이드를 코딩하는 유전자가 삽입된 재조합 벡터로 형질전환된 세포로부터 수득된 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  5. 제4항에 있어서,
    상기 세포는 줄기세포, 골수유래줄기세포, 제대혈유래줄기세포, 및 지방유래줄기세포로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  6. 제5항에 있어서,
    상기 세포는 인체 또는 동물 유래 세포인 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  7. 제1항에 있어서,
    상기 세포외소포체는 엑소좀인 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  8. 제1항에 있어서,
    상기 세포외소포체는 간섬유화-촉진 유전자의 발현을 억제하는 핵산을 더 포함하는 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  9. 제8항에 있어서,
    상기 핵산은 상기 간섬유화-촉진 유전자의 mRNA에 상보적으로 결합하는 안티센스 뉴클레오티드, 안티센스 올리고뉴클레오티드, 작은 간섭 RNA (siRNA), 짧은 헤어핀 RNA (shRNA), 마이크로RNA (miRNA), RNA 간섭 (RNAi), 및 리보자임 (ribozyme) 분자로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  10. 제8항에 있어서,
    상기 간섬유화-촉진 유전자는 Collagen I, Collagen II, α-SMA, 및 MMP 코딩 유전자로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  11. 제1항에 있어서,
    상기 간질환은 간섬유증, 간경화, 급성간염, 만성간염, 및 간암으로 이루어진 군에서 선택된 하나 이상인 것을 특징으로 하는, 간질환의 예방 또는 치료용 약학적 조성물.
  12. (S1) 세포를 간성상세포의 수용체에 특이적인 펩타이드를 코딩하는 유전자가 삽입된 재조합 벡터로 형질전환 시키는 단계;
    (S2) 상기 형질전환된 세포의 배양액으로부터 세포외소포체를 수득하는 단계; 및
    (S3) 상기 세포외소포체에 간섬유화-촉진 유전자의 발현을 억제하는 핵산을 도입하는 단계를 포함하는, 간성상세포 특이적 세포외소포체의 제조방법으로서,
    상기 세포외소포체는 상기 간성상세포의 수용체에 특이적인 펩타이드가 발현된 것을 특징으로 하는, 제조방법.
  13. 제12항에 있어서, 상기 세포외소포체는 엑소좀인 것을 특징으로 하는, 제조방법.
  14. 제12항에 있어서, 상기 세포외소포체는 간질환의 예방 또는 치료에 사용되기 위한 것인, 제조방법.
  15. 제1항의 약학적 조성물의 간질환의 예방 또는 치료 용도.
  16. 제1항의 약학적 조성물을 이를 필요로 하는 개체에 투여하는 단계를 포함하는, 간질환의 예방 또는 치료방법.
  17. 간질환의 치료제를 제조하기 위한 제1항의 약학적 조성물의 용도.
PCT/KR2022/013640 2021-09-14 2022-09-13 간세포 표적화 엑소좀 및 이의 간질환의 예방 또는 치료를 위한 용도 WO2023043152A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2021-0122642 2021-09-14
KR1020210122642A KR20230039884A (ko) 2021-09-14 2021-09-14 간질환 예방 또는 치료용 표적 엑소좀 조성물 및 이의 용도

Publications (1)

Publication Number Publication Date
WO2023043152A1 true WO2023043152A1 (ko) 2023-03-23

Family

ID=85603169

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/013640 WO2023043152A1 (ko) 2021-09-14 2022-09-13 간세포 표적화 엑소좀 및 이의 간질환의 예방 또는 치료를 위한 용도

Country Status (2)

Country Link
KR (1) KR20230039884A (ko)
WO (1) WO2023043152A1 (ko)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170103697A (ko) * 2016-03-03 2017-09-13 고려대학교 산학협력단 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
KR20180057546A (ko) * 2016-11-21 2018-05-30 성균관대학교산학협력단 지방줄기세포유래 엑소좀을 유효성분으로 포함하는 간 섬유증 예방 또는 치료용 조성물
KR20200012713A (ko) * 2018-07-27 2020-02-05 주식회사 엑소스템텍 엑소좀을 유효성분으로 포함하는 급성 간질환의 예방 또는 치료용 조성물

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20210086986A (ko) 2019-12-30 2021-07-09 동국대학교 산학협력단 펜플루리돌을 유효성분으로 포함하는 stk32c 과발현 암, 비알코올성 지방간염(nash), 또는 간섬유화 예방 또는 치료용 약학 조성물

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20170103697A (ko) * 2016-03-03 2017-09-13 고려대학교 산학협력단 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
KR20180057546A (ko) * 2016-11-21 2018-05-30 성균관대학교산학협력단 지방줄기세포유래 엑소좀을 유효성분으로 포함하는 간 섬유증 예방 또는 치료용 조성물
KR20200012713A (ko) * 2018-07-27 2020-02-05 주식회사 엑소스템텍 엑소좀을 유효성분으로 포함하는 급성 간질환의 예방 또는 치료용 조성물

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHO, YONG-WOO ET AL.: "Development of Liver Fibrosis Treatment Using Stem Cell-Derived Exosomes", GOVERNMENT PROJECT FINAL REPORT, KR, vol. TRKO202200006844, 1 February 2020 (2020-02-01), KR, pages 1 - 86, XP009547691 *
HU QIAOBIN, LEE JI-YOUNG, LUO YANGCHAO: "Nanoparticles Targeting Hepatic Stellate Cells for the Treatment of Liver Fibrosis", ENGINEERED SCIENCE, vol. 6, 1 January 2019 (2019-01-01), pages 12 - 21, XP055965374, ISSN: 2576-988X, DOI: 10.30919/es8d507 *
REDDY L. HARIVARDHAN, COUVREUR PATRICK: "Nanotechnology for therapy and imaging of liver diseases", JOURNAL OF HEPATOLOGY, ELSEVIER, AMSTERDAM, NL, vol. 55, no. 6, 1 December 2011 (2011-12-01), AMSTERDAM, NL , pages 1461 - 1466, XP093048175, ISSN: 0168-8278, DOI: 10.1016/j.jhep.2011.05.039 *
YOU DONG GIL; OH BYEONG HOON; NGUYEN VAN QUY; LIM GYEONG TAEK; UM WOORAM; JUNG JAE MIN; JEON JUEUN; CHOI JI SUK; CHOI YOUNG CHAN; : "Vitamin A-coupled stem cell-derived extracellular vesicles regulate the fibrotic cascade by targeting activated hepatic stellate cells in vivo", JOURNAL OF CONTROLLED RELEASE, ELSEVIER, AMSTERDAM, NL, vol. 336, 24 June 2021 (2021-06-24), AMSTERDAM, NL , pages 285 - 295, XP086732027, ISSN: 0168-3659, DOI: 10.1016/j.jconrel.2021.06.031 *

Also Published As

Publication number Publication date
KR20230039884A (ko) 2023-03-22

Similar Documents

Publication Publication Date Title
WO2018026203A1 (ko) 지방 유래 줄기세포로부터 추출된 엑소좀을 유효성분으로 포함하는 폐 섬유증 예방 또는 치료용 조성물
US20060247195A1 (en) Method of altering cell properties by administering rna
WO2019050071A1 (ko) 엑소좀 또는 엑소좀 유래 리보핵산을 포함하는 간섬유증 예방 또는 치료용 조성물
WO2019107939A1 (ko) 줄기세포 유래 엑소좀 생성 촉진용 조성물
JP2019534050A (ja) 調節可能な細胞系およびそれらの使用方法
WO2021210872A1 (ko) 트롬빈 처리 줄기세포에서 유래된 엑소좀을 포함하는 당뇨병성 피부질환 예방 또는 치료용 조성물
WO2018030630A1 (ko) Sox 유전자가 이입된 비바이러스성 미니써클 벡터 및 이의 제조방법
WO2023043152A1 (ko) 간세포 표적화 엑소좀 및 이의 간질환의 예방 또는 치료를 위한 용도
KR20230148138A (ko) 뇌신경계질환 예방 또는 치료용 약학적 조성물
KR20010071601A (ko) 뇌실막 신경 간세포 및 이의 분리 방법
WO2010077093A2 (ko) 에리스로포이에틴을 함유하는 발모 촉진 또는 탈모 방지용 조성물
WO2023043191A1 (ko) Iap 단백질을 과발현하는 줄기세포의 배양액을 포함하는 간질환 예방 또는 치료용 약학적 조성물
US20080112927A1 (en) Cells and methods utilizing same for modifying the electrophysiological function of excitable tissues
KR102551880B1 (ko) 부신피질자극호르몬분비호르몬을 유효성분으로 포함하는 신경세포구 형성 촉진용 조성물
WO2014042292A1 (ko) 단백질 인산화효소 c 활성화제를 포함하는 줄기세포 부착 촉진용 조성물 및 줄기세포의 부착 촉진 방법
WO2019190175A2 (ko) 편도 유래 중간엽 줄기세포로부터 운동신경세포의 분화방법
WO2019168364A1 (ko) 줄기세포의 티오레독신 발현을 증진시키는 방법
WO2023120971A1 (ko) PGC-1α 를 과발현하는 지방유래줄기세포가 탑재된 간섬유화의 예방 또는 치료용 스캐폴드
WO2023224388A1 (ko) 금속 나노 입자-핵산 결합체를 기반으로 하는 유전자 운반체
WO2023121050A1 (ko) 허혈-재관류 손상을 예방 또는 치료하기 위한 조성물 및 그의 용도
WO2024106959A1 (ko) 줄기세포 스페로이드를 포함하는 조직 재생 촉진용 조성물
AU2006207381A1 (en) Method of treatment by administration of RNA
WO2021194256A1 (ko) 인간 배아줄기세포 유래 중간엽 줄기세포를 포함하는 망막색소변성의 예방 또는 치료용 약학적 조성물
WO2021189558A1 (zh) 肠道菌群调节剂与间充质干细胞的组合物及其应用
CN115702926B (zh) Versican蛋白在制备心肌损伤后修复的药物中的应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22870236

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE